Starting /dee2/code/volunteer_pipeline.sh SRR21853498 current disk space = 1550586286080 free memory = 1367279988 SRR21853498 SRAfilesize 828a3717c44adfaa10f8a7991c518cfc SRR21853498.sra SRR21853498.sra file validated SRR21853498 is single end SRR21853498 is conventional basespace SRR21853498 read1 length is 95-101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR21853498_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 95-101 %GC 47 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.7045 37.0 37.0 37.0 37.0 37.0 2 35.809 37.0 37.0 37.0 37.0 37.0 3 36.0235 37.0 37.0 37.0 37.0 37.0 4 36.0515 37.0 37.0 37.0 37.0 37.0 5 36.1125 37.0 37.0 37.0 37.0 37.0 6 36.25 37.0 37.0 37.0 37.0 37.0 7 36.1645 37.0 37.0 37.0 37.0 37.0 8 36.172 37.0 37.0 37.0 37.0 37.0 9 36.0925 37.0 37.0 37.0 37.0 37.0 10-11 36.21725 37.0 37.0 37.0 37.0 37.0 12-13 36.1185 37.0 37.0 37.0 37.0 37.0 14-15 36.127250000000004 37.0 37.0 37.0 37.0 37.0 16-17 36.08325 37.0 37.0 37.0 37.0 37.0 18-19 36.079750000000004 37.0 37.0 37.0 37.0 37.0 20-21 35.987 37.0 37.0 37.0 37.0 37.0 22-23 35.9875 37.0 37.0 37.0 37.0 37.0 24-25 36.037 37.0 37.0 37.0 37.0 37.0 26-27 35.9445 37.0 37.0 37.0 37.0 37.0 28-29 35.866749999999996 37.0 37.0 37.0 37.0 37.0 30-31 35.870000000000005 37.0 37.0 37.0 37.0 37.0 32-33 35.8835 37.0 37.0 37.0 37.0 37.0 34-35 35.930499999999995 37.0 37.0 37.0 37.0 37.0 36-37 35.98825 37.0 37.0 37.0 37.0 37.0 38-39 35.875 37.0 37.0 37.0 37.0 37.0 40-41 35.95625 37.0 37.0 37.0 37.0 37.0 42-43 35.848749999999995 37.0 37.0 37.0 37.0 37.0 44-45 35.7475 37.0 37.0 37.0 37.0 37.0 46-47 35.921 37.0 37.0 37.0 37.0 37.0 48-49 35.823750000000004 37.0 37.0 37.0 37.0 37.0 50-51 35.835 37.0 37.0 37.0 37.0 37.0 52-53 35.87425 37.0 37.0 37.0 37.0 37.0 54-55 35.822500000000005 37.0 37.0 37.0 37.0 37.0 56-57 35.857749999999996 37.0 37.0 37.0 37.0 37.0 58-59 35.775999999999996 37.0 37.0 37.0 37.0 37.0 60-61 35.803 37.0 37.0 37.0 37.0 37.0 62-63 35.81325 37.0 37.0 37.0 37.0 37.0 64-65 35.80575 37.0 37.0 37.0 37.0 37.0 66-67 35.839 37.0 37.0 37.0 37.0 37.0 68-69 35.7575 37.0 37.0 37.0 37.0 37.0 70-71 35.7855 37.0 37.0 37.0 37.0 37.0 72-73 35.721000000000004 37.0 37.0 37.0 37.0 37.0 74-75 35.66875 37.0 37.0 37.0 37.0 37.0 76-77 35.591 37.0 37.0 37.0 37.0 37.0 78-79 35.760000000000005 37.0 37.0 37.0 37.0 37.0 80-81 35.6935 37.0 37.0 37.0 37.0 37.0 82-83 35.732 37.0 37.0 37.0 37.0 37.0 84-85 35.7445 37.0 37.0 37.0 37.0 37.0 86-87 35.6295 37.0 37.0 37.0 37.0 37.0 88-89 35.584 37.0 37.0 37.0 37.0 37.0 90-91 35.631 37.0 37.0 37.0 37.0 37.0 92-93 35.6905 37.0 37.0 37.0 37.0 37.0 94-95 35.632 37.0 37.0 37.0 37.0 37.0 96-97 35.54200510370358 37.0 37.0 37.0 37.0 37.0 98-99 35.60937403014522 37.0 37.0 37.0 37.0 37.0 100-101 35.44521404923289 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 2101 1 0.0 2101 2 0.0 2101 3 0.0 2101 4 0.0 2101 5 0.0 2101 6 0.0 2101 7 0.0 2101 8 0.0 2101 9 0.0 2101 10-11 0.0 2101 12-13 0.0 2101 14-15 0.0 2101 16-17 0.0 2101 18-19 0.0 2101 20-21 0.0 2101 22-23 0.0 2101 24-25 0.0 2101 26-27 0.0 2101 28-29 0.0 2101 30-31 0.0 2101 32-33 0.0 2101 34-35 0.0 2101 36-37 0.0 2101 38-39 0.0 2101 40-41 0.0 2101 42-43 0.0 2101 44-45 0.0 2101 46-47 0.0 2101 48-49 0.0 2101 50-51 0.0 2101 52-53 0.0 2101 54-55 0.0 2101 56-57 0.0 2101 58-59 0.0 2101 60-61 0.0 2101 62-63 0.0 2101 64-65 0.0 2101 66-67 0.0 2101 68-69 0.0 2101 70-71 0.0 2101 72-73 0.0 2101 74-75 0.0 2101 76-77 0.0 2101 78-79 0.0 2101 80-81 0.0 2101 82-83 0.0 2101 84-85 0.0 2101 86-87 0.0 2101 88-89 0.0 2101 90-91 0.0 2101 92-93 0.0 2101 94-95 0.0 2101 96-97 0.0 2101 98-99 0.0 2101 100-101 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 1.0 23 3.0 24 3.0 25 2.0 26 5.0 27 13.0 28 22.0 29 45.0 30 50.0 31 73.0 32 116.0 33 143.0 34 210.0 35 459.0 36 2233.0 37 622.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 26.25 14.274999999999999 18.9 40.575 2 24.275 20.7 32.45 22.575 3 24.075 24.9 26.0 25.025 4 25.650000000000002 28.599999999999998 20.575 25.174999999999997 5 24.725 32.925 22.575 19.775000000000002 6 20.9 35.55 21.825 21.725 7 18.575 18.625 42.0 20.8 8 21.8 24.075 25.15 28.975 9 20.474999999999998 22.8 30.425 26.3 10-11 24.5375 29.75 22.2125 23.5 12-13 23.075000000000003 24.1375 27.1625 25.624999999999996 14-15 21.425 26.8 27.3875 24.3875 16-17 23.2125 26.2125 26.275 24.3 18-19 24.2625 26.687499999999996 25.4375 23.6125 20-21 22.6125 26.575 26.35 24.462500000000002 22-23 22.8125 26.674999999999997 26.0375 24.474999999999998 24-25 22.9625 26.25 26.5125 24.275 26-27 22.925 26.7625 26.775 23.5375 28-29 23.025000000000002 27.1375 26.25 23.5875 30-31 22.975 27.212500000000002 25.7125 24.099999999999998 32-33 23.25 27.737499999999997 26.937499999999996 22.075 34-35 22.7125 26.85 27.224999999999998 23.2125 36-37 23.775 26.325 26.0 23.9 38-39 24.212500000000002 26.650000000000002 26.375 22.7625 40-41 23.6125 26.875 25.874999999999996 23.6375 42-43 22.95 26.825 26.6 23.625 44-45 23.5875 27.025 26.8125 22.575 46-47 24.0375 26.9125 25.5125 23.5375 48-49 22.35 27.5625 27.3875 22.7 50-51 23.2375 27.212500000000002 25.912499999999998 23.6375 52-53 22.975 26.950000000000003 26.0375 24.0375 54-55 23.0 27.3375 25.924999999999997 23.7375 56-57 22.650000000000002 26.1125 27.487499999999997 23.75 58-59 23.2875 27.212500000000002 26.5125 22.9875 60-61 23.7 26.075 26.7625 23.4625 62-63 22.9875 26.487500000000004 26.5875 23.9375 64-65 23.474999999999998 26.8 25.587500000000002 24.1375 66-67 23.799999999999997 27.200000000000003 26.200000000000003 22.8 68-69 22.650000000000002 27.3625 26.2625 23.724999999999998 70-71 23.474999999999998 27.8125 25.2875 23.425 72-73 23.4375 27.1125 26.1625 23.2875 74-75 23.3625 26.687499999999996 26.237500000000004 23.7125 76-77 23.525 26.55 26.237500000000004 23.6875 78-79 23.3875 26.825 26.35 23.4375 80-81 23.849999999999998 26.825 26.5375 22.787499999999998 82-83 23.799999999999997 26.650000000000002 26.4625 23.0875 84-85 23.674999999999997 25.650000000000002 26.887499999999996 23.7875 86-87 23.200000000000003 27.075 26.5125 23.2125 88-89 23.0375 27.450000000000003 26.1 23.4125 90-91 24.224999999999998 26.3625 26.187500000000004 23.225 92-93 24.025 26.6625 25.937500000000004 23.375 94-95 23.0875 27.5625 26.150000000000002 23.200000000000003 96-97 24.0990990990991 26.18868868868869 25.900900900900904 23.81131131131131 98-99 23.14039096217314 26.16146230007616 27.354658542777354 23.343488194973343 100-101 23.35195530726257 12.386272944932163 33.85474860335195 30.40702314445331 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 10.0 1 7.5 2 2.5 3 0.0 4 1.0 5 1.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 1.0 17 2.5 18 2.0 19 1.0 20 1.0 21 2.5 22 5.0 23 3.5 24 2.0 25 3.0 26 4.5 27 6.0 28 11.5 29 18.0 30 17.5 31 18.5 32 22.5 33 34.5 34 43.0 35 52.0 36 62.5 37 84.0 38 105.0 39 111.5 40 126.5 41 141.0 42 183.0 43 211.5 44 213.0 45 213.5 46 202.0 47 210.5 48 207.5 49 192.5 50 167.5 51 134.5 52 128.0 53 128.0 54 119.5 55 107.5 56 90.5 57 70.0 58 61.5 59 60.0 60 51.5 61 38.0 62 36.0 63 37.5 64 37.5 65 44.0 66 31.5 67 23.5 68 21.0 69 11.0 70 10.5 71 9.5 72 12.5 73 11.0 74 7.5 75 7.0 76 4.0 77 3.0 78 3.0 79 1.0 80 0.5 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 95 2.0 96 4.0 97 21.0 98 68.0 99 285.0 100 975.0 101 2645.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.875 #Duplication Level Percentage of deduplicated Percentage of total 1 93.45895020188425 86.8 2 6.056527590847914 11.25 3 0.3768506056527591 1.05 4 0.0 0.0 5 0.026917900403768503 0.125 6 0.0 0.0 7 0.026917900403768503 0.17500000000000002 8 0.0 0.0 9 0.026917900403768503 0.22499999999999998 >10 0.026917900403768503 0.375 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACAGCGATAGATCTCGTAT 15 0.375 TruSeq Adapter, Index 1 (97% over 36bp) AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA 9 0.22499999999999998 No Hit TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT 7 0.17500000000000002 No Hit CCGGAACCCAAAGACTTTGATTTCTCATAAGGTGCCGGCGGAGTCCTATA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 479970 spots for SRR21853498.sra Written 479970 spots for SRR21853498.sra Read 479970 spots for SRR21853498.sra Written 479970 spots for SRR21853498.sra Read 479970 spots for SRR21853498.sra Written 479970 spots for SRR21853498.sra Read 479970 spots for SRR21853498.sra Written 479970 spots for SRR21853498.sra Read 479970 spots for SRR21853498.sra Written 479970 spots for SRR21853498.sra Read 479970 spots for SRR21853498.sra Written 479970 spots for SRR21853498.sra Read 479970 spots for SRR21853498.sra Written 479970 spots for SRR21853498.sra Read 479970 spots for SRR21853498.sra Written 479970 spots for SRR21853498.sra Read 479981 spots for SRR21853498.sra Written 479981 spots for SRR21853498.sra Read 479970 spots for SRR21853498.sra Written 479970 spots for SRR21853498.sra Read 479970 spots for SRR21853498.sra Written 479970 spots for SRR21853498.sra Read 479970 spots for SRR21853498.sra Written 479970 spots for SRR21853498.sra Read 479970 spots for SRR21853498.sra Written 479970 spots for SRR21853498.sra Read 479970 spots for SRR21853498.sra Written 479970 spots for SRR21853498.sra Read 479970 spots for SRR21853498.sra Written 479970 spots for SRR21853498.sra Read 479970 spots for SRR21853498.sra Written 479970 spots for SRR21853498.sra Read 479970 spots for SRR21853498.sra Written 479970 spots for SRR21853498.sra Read 479970 spots for SRR21853498.sra Written 479970 spots for SRR21853498.sra Read 479970 spots for SRR21853498.sra Written 479970 spots for SRR21853498.sra Read 479970 spots for SRR21853498.sra Written 479970 spots for SRR21853498.sra SRR ids: ['SRR21853498.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd__pdsacx9 SRR21853498.sra spots: 9599411 blocks: [[1, 479970], [479971, 959940], [959941, 1439910], [1439911, 1919880], [1919881, 2399850], [2399851, 2879820], [2879821, 3359790], [3359791, 3839760], [3839761, 4319730], [4319731, 4799700], [4799701, 5279670], [5279671, 5759640], [5759641, 6239610], [6239611, 6719580], [6719581, 7199550], [7199551, 7679520], [7679521, 8159490], [8159491, 8639460], [8639461, 9119430], [9119431, 9599411]] SRR21853498 file size 2580559 SRR21853498 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR21853498 SRR21853498_1.fastq Input file: SRR21853498_1.fastq trimmed: SRR21853498-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Fri Dec 6 16:19:02 2024 >> started Fri Dec 6 16:19:08 2024 >> done (6.007s) 9599411 reads processed; of these: 3 ( 0.00%) short reads filtered out after trimming by size control 48493 ( 0.51%) empty reads filtered out after trimming by size control 9550915 (99.49%) reads available; of these: 307 ( 0.00%) trimmed reads available after processing 9550608 (100.00%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 20 2 0.00% 21 0 0.00% 22 1 0.00% 23 0 0.00% 24 1 0.00% 25 1 0.00% 26 0 0.00% 27 2 0.00% 28 1 0.00% 29 1 0.00% 30 1 0.00% 31 4 0.00% 32 4 0.00% 33 7 0.00% 34 2 0.00% 35 18 0.00% 36 11 0.00% 37 22 0.00% 38 14 0.00% 39 13 0.00% 40 21 0.00% 41 13 0.00% 42 24 0.00% 43 21 0.00% 44 20 0.00% 45 19 0.00% 46 23 0.00% 47 20 0.00% 48 27 0.00% 49 20 0.00% 50 29 0.00% 51 31 0.00% 52 27 0.00% 53 24 0.00% 54 31 0.00% 55 33 0.00% 56 25 0.00% 57 37 0.00% 58 35 0.00% 59 31 0.00% 60 46 0.00% 61 47 0.00% 62 44 0.00% 63 43 0.00% 64 53 0.00% 65 61 0.00% 66 33 0.00% 67 46 0.00% 68 62 0.00% 69 49 0.00% 70 71 0.00% 71 62 0.00% 72 71 0.00% 73 70 0.00% 74 61 0.00% 75 55 0.00% 76 78 0.00% 77 78 0.00% 78 91 0.00% 79 82 0.00% 80 98 0.00% 81 115 0.00% 82 95 0.00% 83 111 0.00% 84 143 0.00% 85 168 0.00% 86 149 0.00% 87 149 0.00% 88 158 0.00% 89 197 0.00% 90 261 0.00% 91 738 0.01% 92 343 0.00% 93 412 0.00% 94 568 0.01% 95 1910 0.02% 96 12376 0.13% 97 51427 0.54% 98 191197 2.00% 99 645291 6.76% 100 2391760 25.04% 101 6251430 65.45% 9550915 reads passed initial QC criterion=sequence-density sequence-density=0.16 sequence-density-rank=1 fanout-score=1.97 fanout-score-rank=21 prefix-density=0.15 prefix-fanout=2.0 sequence=CCGTCAATTCCTTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=32 fanout-score=10.39 fanout-score-rank=1 prefix-density=0.04 prefix-fanout=3.6 sequence=GAAGAGCACCGCACGTCGCGCGGTGTCCGGTGCGCCCCCGGCGGCCCATGAAAATCCGGAGGACCGAGTACCGTTCACGCCCGGTCGTACTCATAACCGCATCAGGTCTCCAAGGTGAACAGCCTCTGGCCAATGGAACAATGTAGGCAAGGGAAGTCGGCAAAACGGATCCGTAACTTCGGGAAAAGGATTGGCTCTGAGGACTGGGCTCGGGGGTCCCGGCCCCAAACCCGTCGGCTGTCGGCGGATTGCTCGAGCTGCTCACGCGGCGAGAGCGGGTCGCCGCGTGCCGGCCGGGGGACGGACCGGGAGTCGCCCCTTCGGGGGCTTTCCCCGAGCGCTGAACAGTCGACTCAGAACTGGTACGGACAAGGGGAATCCGACTGTTTAATTAAAACAAAGCATTGCGATGGTCCTCGCGGATGCTGACGCAATGTGATTTCTGCCCAGTGCTCTGAATGTCAAAGTGAAGAAATTCAACCAAGCGCGGGTAAACGGCGGGAGTAACTAT Started job on | Dec 06 16:19:32 Started mapping on | Dec 06 16:19:32 Finished on | Dec 06 16:20:00 Mapping speed, Million of reads per hour | 1227.97 Number of input reads | 9550915 Average input read length | 100 UNIQUE READS: Uniquely mapped reads number | 7981311 Uniquely mapped reads % | 83.57% Average mapped length | 100.23 Number of splices: Total | 3069498 Number of splices: Annotated (sjdb) | 2912295 Number of splices: GT/AG | 3028584 Number of splices: GC/AG | 34855 Number of splices: AT/AC | 2035 Number of splices: Non-canonical | 4024 Mismatch rate per base, % | 0.33% Deletion rate per base | 0.01% Deletion average length | 2.12 Insertion rate per base | 0.01% Insertion average length | 1.93 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 439985 % of reads mapped to multiple loci | 4.61% Number of reads mapped to too many loci | 303672 % of reads mapped to too many loci | 3.18% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 8.19% % of reads unmapped: other | 0.45% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1129619 1129619 1129619 N_multimapping 439985 439985 439985 N_noFeature 525021 4155087 4247235 N_ambiguous 123231 9877 10052 UnstrandedReadsAssigned:7333059 PositiveStrandReadsAssigned:3816347 NegativeStrandReadsAssigned:3724024 Dataset is classified unstranded MeadianReadLen=101 20thPercentileLength=100 echo kmer=95 SRR21853498 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR21853498-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 9,550,915 reads, 7,691,285 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,114 rounds 52973 SRR21853498.ke.tsv 35125 SRR21853498.se.tsv 88098 total ==> SRR21853498.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 0 0 PNS24247 1044 945 74.5546 19.7973 PNS24249 1928 1829 34.7379 4.76598 PNS24246 1044 945 74.5546 19.7973 PNS24248 1044 945 74.5546 19.7973 PNS24244 1471 1372 53.5983 9.80301 PNS24243 293 194 11 14.2283 KQK14069 1603 1504 1539.2 256.808 KQK14071 474 375 625.097 418.292 ==> SRR21853498.se.tsv <== BRADI_1g14170v3 2824 BRADI_1g53295v3 76 BRADI_1g59795v3 426 BRADI_1g07683v3 0 BRADI_1g00485v3 33 BRADI_1g20270v3 96 BRADI_1g74790v3 57 BRADI_1g09890v3 0 BRADI_1g77505v3 125 BRADI_1g48960v3 0 SRR21853498 completed mapping pipeline successfully