Starting /dee2/code/volunteer_pipeline.sh SRR21853499 current disk space = 1550583119872 free memory = 1599932824 SRR21853499 SRAfilesize d6528529fd83ab2925d05c0df5a6de3e SRR21853499.sra SRR21853499.sra file validated SRR21853499 is single end SRR21853499 is conventional basespace SRR21853499 read1 length is 35-101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR21853499_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 35-101 %GC 47 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.27125 37.0 37.0 37.0 37.0 37.0 2 34.80625 37.0 37.0 37.0 25.0 37.0 3 35.62475 37.0 37.0 37.0 37.0 37.0 4 35.73725 37.0 37.0 37.0 37.0 37.0 5 35.95825 37.0 37.0 37.0 37.0 37.0 6 35.99275 37.0 37.0 37.0 37.0 37.0 7 35.66725 37.0 37.0 37.0 37.0 37.0 8 35.76575 37.0 37.0 37.0 37.0 37.0 9 35.70475 37.0 37.0 37.0 37.0 37.0 10-11 35.905249999999995 37.0 37.0 37.0 37.0 37.0 12-13 35.84675 37.0 37.0 37.0 37.0 37.0 14-15 35.915499999999994 37.0 37.0 37.0 37.0 37.0 16-17 35.818749999999994 37.0 37.0 37.0 37.0 37.0 18-19 35.8745 37.0 37.0 37.0 37.0 37.0 20-21 35.81225 37.0 37.0 37.0 37.0 37.0 22-23 35.86725 37.0 37.0 37.0 37.0 37.0 24-25 35.66825 37.0 37.0 37.0 37.0 37.0 26-27 35.724000000000004 37.0 37.0 37.0 37.0 37.0 28-29 35.706500000000005 37.0 37.0 37.0 37.0 37.0 30-31 35.57625 37.0 37.0 37.0 37.0 37.0 32-33 35.6375 37.0 37.0 37.0 37.0 37.0 34-35 35.6395 37.0 37.0 37.0 37.0 37.0 36-37 35.53488372093023 37.0 37.0 37.0 37.0 37.0 38-39 35.53538384596149 37.0 37.0 37.0 37.0 37.0 40-41 35.64241060265066 37.0 37.0 37.0 37.0 37.0 42-43 35.5181295323831 37.0 37.0 37.0 37.0 37.0 44-45 35.57914478619655 37.0 37.0 37.0 37.0 37.0 46-47 35.56514128532133 37.0 37.0 37.0 37.0 37.0 48-49 35.53438359589897 37.0 37.0 37.0 37.0 37.0 50-51 35.66716679169792 37.0 37.0 37.0 37.0 37.0 52-53 35.61915478869717 37.0 37.0 37.0 37.0 37.0 54-55 35.560390097524376 37.0 37.0 37.0 37.0 37.0 56-57 35.463365841460366 37.0 37.0 37.0 37.0 37.0 58-59 35.45361340335084 37.0 37.0 37.0 37.0 37.0 60-61 35.40285071267817 37.0 37.0 37.0 37.0 37.0 62-63 35.46136534133534 37.0 37.0 37.0 37.0 37.0 64-65 35.46486621655414 37.0 37.0 37.0 37.0 37.0 66-67 35.36584146036509 37.0 37.0 37.0 37.0 37.0 68-69 35.24406101525381 37.0 37.0 37.0 37.0 37.0 70-71 35.18029507376845 37.0 37.0 37.0 31.0 37.0 72-73 35.36734183545886 37.0 37.0 37.0 31.0 37.0 74-75 35.3935983995999 37.0 37.0 37.0 37.0 37.0 76-77 35.21855463865967 37.0 37.0 37.0 31.0 37.0 78-79 35.253364304057506 37.0 37.0 37.0 31.0 37.0 80-81 35.2543771885943 37.0 37.0 37.0 31.0 37.0 82-83 35.34467233616808 37.0 37.0 37.0 37.0 37.0 84-85 35.23786893446723 37.0 37.0 37.0 31.0 37.0 86-87 35.330665332666335 37.0 37.0 37.0 31.0 37.0 88-89 35.24462231115558 37.0 37.0 37.0 31.0 37.0 90-91 35.32391195597799 37.0 37.0 37.0 31.0 37.0 92-93 35.270135067533765 37.0 37.0 37.0 31.0 37.0 94-95 35.16614488425394 37.0 37.0 37.0 25.0 37.0 96-97 35.20601703847045 37.0 37.0 37.0 25.0 37.0 98-99 35.228391426049825 37.0 37.0 37.0 25.0 37.0 100-101 35.13806283767085 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100-101 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 1.0 22 0.0 23 0.0 24 4.0 25 6.0 26 17.0 27 23.0 28 27.0 29 50.0 30 95.0 31 99.0 32 123.0 33 182.0 34 310.0 35 521.0 36 2171.0 37 370.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 29.68242060515129 14.653663415853963 17.429357339334832 38.234558639659916 2 23.790220420572584 21.053965036736763 33.417785659994934 21.73802888269572 3 23.13078269567392 23.455863965991497 26.25656414103526 27.156789197299325 4 26.93173293323331 29.057264316079017 19.70492623155789 24.306076519129782 5 27.53188297074269 31.932983245811453 21.80545136284071 18.72968242060515 6 21.45536384096024 35.55888972243061 22.080520130032507 20.905226306576644 7 18.6046511627907 18.37959489872468 40.86021505376344 22.155538884721178 8 20.555138784696176 24.456114028507127 27.00675168792198 27.981995498874717 9 22.18054513628407 22.680670167541887 29.132283070767688 26.006501625406354 10-11 24.893723430857715 29.632408102025504 21.99299824956239 23.48087021755439 12-13 22.330582645661416 24.681170292573142 27.35683920980245 25.63140785196299 14-15 22.818204551137786 26.93173293323331 26.269067266816705 23.980995248812203 16-17 24.518629657414355 26.319079769942487 25.76894223555889 23.393348337084273 18-19 22.85571392848212 25.36884221055264 26.63165791447862 25.143785946486624 20-21 23.13078269567392 26.206551637909474 27.056764191047762 23.605901475368842 22-23 23.943485871467868 27.731932983245812 26.03150787696924 22.29307326831708 24-25 23.718429607401852 25.568892223055762 26.006501625406354 24.706176544136035 26-27 23.005751437859466 26.544136034008503 26.86921730432608 23.58089522380595 28-29 23.605901475368842 27.406851712928233 25.51887971992998 23.468367091772944 30-31 23.143285821455365 26.281570392598148 27.431857964491122 23.143285821455365 32-33 22.843210802700675 26.469117279319832 25.818954738684667 24.868717179294826 34-35 24.168542135533883 26.38159539884971 25.868967241810452 23.58089522380595 36-37 23.843460865216304 26.219054763690924 25.206301575393848 24.731182795698924 38-39 23.143285821455365 26.806701675418854 26.744186046511626 23.305826456614152 40-41 23.943485871467868 27.656914228557138 25.76894223555889 22.630657664416105 42-43 23.40585146286572 26.819204801200303 26.969242310577645 22.80570142535634 44-45 23.85596399099775 26.79419854963741 26.231557889472366 23.118279569892472 46-47 24.668667166791696 26.669167291822955 25.206301575393848 23.455863965991497 48-49 23.080770192548137 27.38184546136534 26.39409852463116 23.143285821455365 50-51 24.618654663665918 25.943985996499126 25.868967241810452 23.568392098024507 52-53 23.443360840210055 26.144036009002253 25.218804701175294 25.1937984496124 54-55 23.80595148787197 27.369342335583895 26.131532883220803 22.693173293323333 56-57 23.643410852713178 27.069267316829208 26.006501625406354 23.280820205051263 58-59 23.618404601150285 26.481620405101275 26.494123530882717 23.40585146286572 60-61 23.668417104276067 26.38159539884971 26.84421105276319 23.10577644411103 62-63 22.843210802700675 27.069267316829208 26.269067266816705 23.818454613653415 64-65 24.893723430857715 26.456614153538382 25.743935983995996 22.9057264316079 66-67 22.31807951987997 27.544386096524132 25.818954738684667 24.318579644911228 68-69 23.74343585896474 26.669167291822955 26.056514128532132 23.53088272068017 70-71 23.718429607401852 27.46936734183546 25.256314078519633 23.55588897224306 72-73 24.568642160540136 26.231557889472366 25.818954738684667 23.380845211302827 74-75 24.081020255063766 27.106776694173547 25.568892223055762 23.243310827706924 76-77 24.406101525381345 26.019004751187797 25.918979744936234 23.655913978494624 78-79 23.971489308490685 25.684631736901338 26.334875578341876 24.0090033762661 80-81 24.312156078039017 26.43821910955478 26.013006503251624 23.23661830915458 82-83 24.137068534267133 25.700350175087543 26.100550275137568 24.062031015507753 84-85 24.099549774887443 26.300650325162582 26.113056528264135 23.486743371685844 86-87 24.599799899949975 26.813406703351678 25.950475237618807 22.63631815907954 88-89 24.449724862431214 26.600800400200097 25.78789394697349 23.1615807903952 90-91 23.92446223111556 27.07603801900951 25.962981490745374 23.036518259129565 92-93 24.54977488744372 25.975487743871934 26.32566283141571 23.149074537268636 94-95 24.36827620715537 26.407305479109333 26.507380535401552 22.71703777833375 96-97 24.67418546365915 25.476190476190474 27.330827067669173 22.518796992481203 98-99 24.71037555697008 24.824952259707192 26.747294716740928 23.717377466581794 100-101 26.557482337829157 12.05844572896596 32.835581245985864 28.548490687219015 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 11.0 1 7.0 2 2.5 3 1.5 4 1.0 5 0.5 6 0.0 7 1.0 8 1.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.5 20 1.5 21 2.0 22 3.0 23 3.5 24 2.5 25 3.0 26 7.5 27 11.5 28 9.0 29 6.5 30 10.5 31 14.5 32 16.5 33 28.5 34 40.0 35 46.5 36 59.0 37 75.0 38 97.0 39 120.0 40 145.5 41 172.0 42 184.5 43 194.5 44 199.5 45 202.5 46 201.0 47 199.5 48 209.5 49 191.0 50 154.0 51 147.5 52 132.0 53 110.5 54 102.5 55 99.5 56 99.5 57 82.0 58 67.5 59 58.5 60 58.0 61 52.0 62 43.0 63 36.0 64 34.0 65 39.0 66 40.0 67 38.0 68 31.0 69 27.0 70 18.0 71 11.0 72 11.5 73 11.5 74 7.5 75 3.5 76 3.0 77 2.0 78 3.0 79 2.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 1.325 3 0.025 4 0.025 5 0.025 6 0.025 7 0.025 8 0.025 9 0.025 10-11 0.025 12-13 0.025 14-15 0.025 16-17 0.025 18-19 0.025 20-21 0.025 22-23 0.025 24-25 0.025 26-27 0.025 28-29 0.025 30-31 0.025 32-33 0.025 34-35 0.025 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 34-35 1.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 1.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 5.0 96-97 21.0 98-99 359.0 100-101 3613.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.975 #Duplication Level Percentage of deduplicated Percentage of total 1 93.7079860177467 87.125 2 5.969346598547997 11.1 3 0.21511158913686476 0.6 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.05377789728421619 0.4 9 0.0 0.0 >10 0.05377789728421619 0.775 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACAGCGATAGATCTCGTAT 21 0.525 TruSeq Adapter, Index 1 (97% over 36bp) GATCGGAAGAGCACACGTCTGAACTCCAGTCACAGCGATAGATCGCGTAT 10 0.25 TruSeq Adapter, Index 1 (97% over 36bp) TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT 8 0.2 No Hit AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA 8 0.2 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 691939 spots for SRR21853499.sra Written 691939 spots for SRR21853499.sra Read 691939 spots for SRR21853499.sra Written 691939 spots for SRR21853499.sra Read 691939 spots for SRR21853499.sra Written 691939 spots for SRR21853499.sra Read 691939 spots for SRR21853499.sra Written 691939 spots for SRR21853499.sra Read 691939 spots for SRR21853499.sra Written 691939 spots for SRR21853499.sra Read 691939 spots for SRR21853499.sra Written 691939 spots for SRR21853499.sra Read 691953 spots for SRR21853499.sra Written 691953 spots for SRR21853499.sra Read 691939 spots for SRR21853499.sra Written 691939 spots for SRR21853499.sra Read 691939 spots for SRR21853499.sra Written 691939 spots for SRR21853499.sra Read 691939 spots for SRR21853499.sra Written 691939 spots for SRR21853499.sra Read 691939 spots for SRR21853499.sra Written 691939 spots for SRR21853499.sra Read 691939 spots for SRR21853499.sra Written 691939 spots for SRR21853499.sra Read 691939 spots for SRR21853499.sra Written 691939 spots for SRR21853499.sra Read 691939 spots for SRR21853499.sra Written 691939 spots for SRR21853499.sra Read 691939 spots for SRR21853499.sra Written 691939 spots for SRR21853499.sra Read 691939 spots for SRR21853499.sra Written 691939 spots for SRR21853499.sra Read 691939 spots for SRR21853499.sra Written 691939 spots for SRR21853499.sra Read 691939 spots for SRR21853499.sra Written 691939 spots for SRR21853499.sra Read 691939 spots for SRR21853499.sra Written 691939 spots for SRR21853499.sra Read 691939 spots for SRR21853499.sra Written 691939 spots for SRR21853499.sra SRR ids: ['SRR21853499.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_6t2wx3h9 SRR21853499.sra spots: 13838794 blocks: [[1, 691939], [691940, 1383878], [1383879, 2075817], [2075818, 2767756], [2767757, 3459695], [3459696, 4151634], [4151635, 4843573], [4843574, 5535512], [5535513, 6227451], [6227452, 6919390], [6919391, 7611329], [7611330, 8303268], [8303269, 8995207], [8995208, 9687146], [9687147, 10379085], [10379086, 11071024], [11071025, 11762963], [11762964, 12454902], [12454903, 13146841], [13146842, 13838794]] SRR21853499 file size 3724153 SRR21853499 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR21853499 SRR21853499_1.fastq Input file: SRR21853499_1.fastq trimmed: SRR21853499-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Fri Dec 6 16:22:22 2024 >> started Fri Dec 6 16:22:30 2024 >> done (7.393s) 13838794 reads processed; of these: 13 ( 0.00%) short reads filtered out after trimming by size control 116309 ( 0.84%) empty reads filtered out after trimming by size control 13722472 (99.16%) reads available; of these: 281 ( 0.00%) trimmed reads available after processing 13722191 (100.00%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 19 1 0.00% 20 3 0.00% 21 1 0.00% 22 2 0.00% 23 3 0.00% 24 4 0.00% 25 2 0.00% 26 6 0.00% 27 2 0.00% 28 6 0.00% 29 4 0.00% 30 5 0.00% 31 4 0.00% 32 1 0.00% 33 2 0.00% 34 4 0.00% 35 48 0.00% 36 41 0.00% 37 58 0.00% 38 56 0.00% 39 59 0.00% 40 53 0.00% 41 71 0.00% 42 68 0.00% 43 60 0.00% 44 78 0.00% 45 60 0.00% 46 55 0.00% 47 75 0.00% 48 58 0.00% 49 69 0.00% 50 71 0.00% 51 68 0.00% 52 103 0.00% 53 81 0.00% 54 78 0.00% 55 96 0.00% 56 107 0.00% 57 118 0.00% 58 117 0.00% 59 116 0.00% 60 119 0.00% 61 86 0.00% 62 154 0.00% 63 122 0.00% 64 132 0.00% 65 124 0.00% 66 112 0.00% 67 155 0.00% 68 185 0.00% 69 156 0.00% 70 167 0.00% 71 185 0.00% 72 154 0.00% 73 166 0.00% 74 174 0.00% 75 202 0.00% 76 205 0.00% 77 237 0.00% 78 249 0.00% 79 262 0.00% 80 284 0.00% 81 303 0.00% 82 307 0.00% 83 324 0.00% 84 337 0.00% 85 405 0.00% 86 401 0.00% 87 463 0.00% 88 441 0.00% 89 551 0.00% 90 621 0.00% 91 1312 0.01% 92 761 0.01% 93 872 0.01% 94 1126 0.01% 95 3160 0.02% 96 18305 0.13% 97 72980 0.53% 98 275441 2.01% 99 930925 6.78% 100 3422679 24.94% 101 8985214 65.48% 13722472 reads passed initial QC criterion=sequence-density sequence-density=0.18 sequence-density-rank=1 fanout-score=2.09 fanout-score-rank=21 prefix-density=0.17 prefix-fanout=2.1 sequence=CCGTCAATTCCTTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=31 fanout-score=10.49 fanout-score-rank=1 prefix-density=0.04 prefix-fanout=3.7 sequence=GAAGAGCACCGCACGTCGCGCGGTGTCCGGTGCGCCCCCGGCGGCCCATGAAAATCCGGAGGACCGAGTACCGTTCACGCCCGGTCGTACTCATAACCGCATCAGGTCTCCAAGGTGAACAGCCTCTGGCCAATGGAACAATGTAGGCAAGGGAAGTCGGCAAAACGGATCCGTAACTTCGGGAAAAGGATTGGCTCTGAGGACTGGGCTCGGGGGTCCCGGCCCCAAACCCGTCGGCTGTCGGCGGATTGCTCGAGCTGCTCACGCGGCGAGAGCGGGTCGCCGCGTGCCGGCCGGGGGACGGACCGGGAGTCGCCCCTTCGGGGGCTTTCCCCGAGCGCTGAACAGTCGACTCAGAACTGGTACGGACAAGGGGAATCCGACTGTTTAATTAAAACAAAGCATTGCGATGGTCCTCGCGGATGCTGACGCAATGTGATTTCTGCCCAGTGCTCTGAATGTCAAAGTGAAGAAATTCAACCAAGCGCGGGTAAACGGCGGGAGTAACTAT Started job on | Dec 06 16:22:48 Started mapping on | Dec 06 16:22:48 Finished on | Dec 06 16:23:29 Mapping speed, Million of reads per hour | 1204.90 Number of input reads | 13722472 Average input read length | 100 UNIQUE READS: Uniquely mapped reads number | 11451523 Uniquely mapped reads % | 83.45% Average mapped length | 100.21 Number of splices: Total | 4384382 Number of splices: Annotated (sjdb) | 4159472 Number of splices: GT/AG | 4325786 Number of splices: GC/AG | 49814 Number of splices: AT/AC | 2878 Number of splices: Non-canonical | 5904 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.01% Deletion average length | 2.11 Insertion rate per base | 0.01% Insertion average length | 1.93 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 642484 % of reads mapped to multiple loci | 4.68% Number of reads mapped to too many loci | 467897 % of reads mapped to too many loci | 3.41% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 7.99% % of reads unmapped: other | 0.47% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1628465 1628465 1628465 N_multimapping 642484 642484 642484 N_noFeature 726419 5942018 6084800 N_ambiguous 178019 13904 14049 UnstrandedReadsAssigned:10547085 PositiveStrandReadsAssigned:5495601 NegativeStrandReadsAssigned:5352674 Dataset is classified unstranded MeadianReadLen=101 20thPercentileLength=100 echo kmer=95 SRR21853499 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR21853499-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,722,472 reads, 11,052,252 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,235 rounds 52973 SRR21853499.ke.tsv 35125 SRR21853499.se.tsv 88098 total ==> SRR21853499.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 0 0 PNS24247 1044 945 93.2805 16.936 PNS24249 1928 1829 37.8328 3.54901 PNS24246 1044 945 93.2805 16.936 PNS24248 1044 945 93.2805 16.936 PNS24244 1471 1372 102.326 12.7962 PNS24243 293 194 16 14.1504 KQK14069 1603 1504 3101.87 353.856 KQK14071 474 375 1087.64 497.627 ==> SRR21853499.se.tsv <== BRADI_1g14170v3 5152 BRADI_1g53295v3 83 BRADI_1g59795v3 621 BRADI_1g07683v3 0 BRADI_1g00485v3 66 BRADI_1g20270v3 144 BRADI_1g74790v3 67 BRADI_1g09890v3 0 BRADI_1g77505v3 171 BRADI_1g48960v3 0 SRR21853499 completed mapping pipeline successfully