Starting /dee2/code/volunteer_pipeline.sh SRR21853500 current disk space = 1550583410688 free memory = 1599922900 SRR21853500 SRAfilesize 3c6cb93de10b515af7fe3b949b743ed4 SRR21853500.sra SRR21853500.sra file validated SRR21853500 is single end SRR21853500 is conventional basespace SRR21853500 read1 length is 35-101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR21853500_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 35-101 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.2465 37.0 37.0 37.0 37.0 37.0 2 34.82475 37.0 37.0 37.0 25.0 37.0 3 35.454 37.0 37.0 37.0 37.0 37.0 4 35.6545 37.0 37.0 37.0 37.0 37.0 5 35.626 37.0 37.0 37.0 37.0 37.0 6 35.7435 37.0 37.0 37.0 37.0 37.0 7 35.566 37.0 37.0 37.0 37.0 37.0 8 35.7555 37.0 37.0 37.0 37.0 37.0 9 35.7685 37.0 37.0 37.0 37.0 37.0 10-11 35.85625 37.0 37.0 37.0 37.0 37.0 12-13 35.789500000000004 37.0 37.0 37.0 37.0 37.0 14-15 35.7425 37.0 37.0 37.0 37.0 37.0 16-17 35.7795 37.0 37.0 37.0 37.0 37.0 18-19 35.69425 37.0 37.0 37.0 37.0 37.0 20-21 35.7285 37.0 37.0 37.0 37.0 37.0 22-23 35.758750000000006 37.0 37.0 37.0 37.0 37.0 24-25 35.76875 37.0 37.0 37.0 37.0 37.0 26-27 35.6125 37.0 37.0 37.0 37.0 37.0 28-29 35.527249999999995 37.0 37.0 37.0 37.0 37.0 30-31 35.5975 37.0 37.0 37.0 37.0 37.0 32-33 35.52825 37.0 37.0 37.0 37.0 37.0 34-35 35.6025 37.0 37.0 37.0 37.0 37.0 36-37 35.456864216054015 37.0 37.0 37.0 37.0 37.0 38-39 35.561390347586894 37.0 37.0 37.0 37.0 37.0 40-41 35.545886471617905 37.0 37.0 37.0 37.0 37.0 42-43 35.46036509127282 37.0 37.0 37.0 37.0 37.0 44-45 35.512128032008 37.0 37.0 37.0 37.0 37.0 46-47 35.56989247311828 37.0 37.0 37.0 37.0 37.0 48-49 35.525381345336335 37.0 37.0 37.0 37.0 37.0 50-51 35.50312578144536 37.0 37.0 37.0 37.0 37.0 52-53 35.45286321580395 37.0 37.0 37.0 37.0 37.0 54-55 35.4558639659915 37.0 37.0 37.0 37.0 37.0 56-57 35.46761690422606 37.0 37.0 37.0 37.0 37.0 58-59 35.34662336169335 37.0 37.0 37.0 37.0 37.0 60-61 35.35692846423211 37.0 37.0 37.0 37.0 37.0 62-63 35.3104052026013 37.0 37.0 37.0 37.0 37.0 64-65 35.396547410557915 37.0 37.0 37.0 37.0 37.0 66-67 35.28696522391794 37.0 37.0 37.0 37.0 37.0 68-69 35.21916437327996 37.0 37.0 37.0 31.0 37.0 70-71 35.25594195646735 37.0 37.0 37.0 31.0 37.0 72-73 35.389291968976735 37.0 37.0 37.0 37.0 37.0 74-75 35.41205904428321 37.0 37.0 37.0 37.0 37.0 76-77 35.307480610457844 37.0 37.0 37.0 31.0 37.0 78-79 35.28646484863648 37.0 37.0 37.0 31.0 37.0 80-81 35.389542156617466 37.0 37.0 37.0 37.0 37.0 82-83 35.3382536902677 37.0 37.0 37.0 37.0 37.0 84-85 35.16437327995997 37.0 37.0 37.0 25.0 37.0 86-87 35.27870903177383 37.0 37.0 37.0 31.0 37.0 88-89 35.24972151285637 37.0 37.0 37.0 31.0 37.0 90-91 35.27052052052052 37.0 37.0 37.0 31.0 37.0 92-93 35.252535639519365 37.0 37.0 37.0 25.0 37.0 94-95 35.18973717146433 37.0 37.0 37.0 25.0 37.0 96-97 35.392850003150066 37.0 37.0 37.0 37.0 37.0 98-99 35.19568840738914 37.0 37.0 37.0 31.0 37.0 100-101 35.05511754691955 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100-101 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 19 1.0 20 0.0 21 0.0 22 1.0 23 2.0 24 5.0 25 14.0 26 11.0 27 27.0 28 43.0 29 52.0 30 68.0 31 99.0 32 151.0 33 196.0 34 281.0 35 581.0 36 2109.0 37 359.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 29.775000000000002 14.725 15.6 39.900000000000006 2 24.675655049605698 20.478249809208855 32.078351564487406 22.76774357669804 3 26.35 22.975 24.474999999999998 26.200000000000003 4 25.1 30.3 19.15 25.45 5 28.349999999999998 31.15 20.65 19.85 6 21.55 35.225 21.0 22.225 7 18.099999999999998 19.3 39.675 22.925 8 22.325 23.375 27.05 27.250000000000004 9 22.525000000000002 22.125 28.825 26.525 10-11 24.712500000000002 29.95 21.6125 23.724999999999998 12-13 22.75 24.2875 26.700000000000003 26.2625 14-15 23.025000000000002 25.4375 26.525 25.0125 16-17 24.625 25.0125 25.0375 25.324999999999996 18-19 24.2875 26.05 25.5 24.1625 20-21 23.7375 25.412499999999998 26.375 24.474999999999998 22-23 23.3 26.887499999999996 25.3125 24.5 24-25 23.1 25.124999999999996 26.325 25.45 26-27 23.2625 25.7375 26.087500000000002 24.9125 28-29 24.3125 26.0 24.75 24.9375 30-31 23.7625 25.162499999999998 26.4125 24.6625 32-33 22.900000000000002 26.2875 25.912499999999998 24.9 34-35 23.825 25.5 25.624999999999996 25.05 36-37 23.068267066766694 26.131532883220803 25.6064016004001 25.1937984496124 38-39 23.99349837459365 26.281570392598148 25.131282820705174 24.593648412103025 40-41 23.13078269567392 26.431607901975497 25.51887971992998 24.918729682420604 42-43 23.193298324581146 26.344086021505376 25.468867216804203 24.99374843710928 44-45 24.168542135533883 26.156539134783696 24.20605151287822 25.468867216804203 46-47 24.48112028007002 25.95648912228057 24.593648412103025 24.968742185546386 48-49 23.655913978494624 26.04401100275069 25.49387346836709 24.8062015503876 50-51 22.95573893473368 26.30657664416104 25.618904726181547 25.11877969492373 52-53 23.40585146286572 26.39409852463116 24.643660915228807 25.55638909727432 54-55 23.305826456614152 25.63140785196299 25.993998499624904 25.068767191797946 56-57 23.99349837459365 26.106526631657918 26.019004751187797 23.88097024256064 58-59 23.35875953482556 26.384894335375762 25.984744279104667 24.27160185069401 60-61 23.186593296648326 26.150575287643825 26.225612806403202 24.437218609304654 62-63 24.062031015507753 25.71285642821411 24.749874937468736 25.475237618809405 64-65 23.605203902927197 26.144608456342254 26.182136602451838 24.06805103827871 66-67 23.1048286214661 25.69427070302727 25.40655491618714 25.794345759319487 68-69 23.867900925694272 25.93194896172129 25.243932949712285 24.956217162872154 70-71 23.842882161621215 26.019514635976982 25.50662997247936 24.630973229922443 72-73 24.956217162872154 25.268951713785338 25.869402051538653 23.90542907180385 74-75 25.243932949712285 24.68101075806855 25.73179884913685 24.34325744308231 76-77 23.68026019514636 25.50662997247936 25.04378283712785 25.769326995246434 78-79 24.668501376032022 26.394796097072803 24.88116087065299 24.055541656242184 80-81 24.293219914936202 26.044533400050035 25.469101826369776 24.193144858643983 82-83 23.78033525143858 26.26970227670753 25.519139354515886 24.430823117338004 84-85 24.1556167125344 26.46985238929197 24.86865148861646 24.505879409557167 86-87 25.01876407305479 27.195396547410557 24.618463847885916 23.167375531648737 88-89 24.33379206805955 26.01025897660453 25.372200675591145 24.283748279744778 90-91 24.374374374374376 26.151151151151154 25.487987987987985 23.986486486486484 92-93 24.515079464397445 26.091853335001876 24.8654736578651 24.527593542735577 94-95 24.130162703379224 26.245306633291616 24.893617021276597 24.730913642052567 96-97 24.812218327491237 25.01251877816725 25.225338007010517 24.949924887330997 98-99 24.984066284257487 25.315487571701723 25.952836201402167 23.747609942638622 100-101 26.081404628890663 12.785315243415802 30.566640063846766 30.566640063846766 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 2.0 1 1.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 1.0 24 1.5 25 3.0 26 3.5 27 3.5 28 6.0 29 9.5 30 10.5 31 16.5 32 22.5 33 29.5 34 36.5 35 44.5 36 54.5 37 67.5 38 89.5 39 109.5 40 123.0 41 142.0 42 170.5 43 185.0 44 192.5 45 211.5 46 215.0 47 203.0 48 184.0 49 173.0 50 162.5 51 147.5 52 131.5 53 114.0 54 114.5 55 108.0 56 98.5 57 82.0 58 71.5 59 73.5 60 61.0 61 50.5 62 47.5 63 44.5 64 43.0 65 41.5 66 37.5 67 38.5 68 46.0 69 40.5 70 28.5 71 25.0 72 21.5 73 16.5 74 13.0 75 10.5 76 8.5 77 4.5 78 2.5 79 2.5 80 2.5 81 2.0 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 1.725 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 34-35 1.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 1.0 60-61 0.0 62-63 1.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 1.0 90-91 0.0 92-93 1.0 94-95 0.0 96-97 34.0 98-99 341.0 100-101 3620.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.925 #Duplication Level Percentage of deduplicated Percentage of total 1 94.22411498536066 88.5 2 5.536332179930796 10.4 3 0.18631887143997872 0.525 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.053233963268565346 0.575 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACTCTCGCGCATCGCGTAT 13 0.325 TruSeq Adapter, Index 8 (97% over 36bp) GATCGGAAGAGCACACGTCTGAACTCCAGTCACTCTCGCGCATCTCGTAT 10 0.25 TruSeq Adapter, Index 8 (97% over 36bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 959684 spots for SRR21853500.sra Written 959684 spots for SRR21853500.sra Read 959684 spots for SRR21853500.sra Written 959684 spots for SRR21853500.sra Read 959684 spots for SRR21853500.sra Written 959684 spots for SRR21853500.sra Read 959684 spots for SRR21853500.sra Written 959684 spots for SRR21853500.sra Read 959684 spots for SRR21853500.sra Written 959684 spots for SRR21853500.sra Read 959684 spots for SRR21853500.sra Written 959684 spots for SRR21853500.sra Read 959688 spots for SRR21853500.sra Written 959688 spots for SRR21853500.sra Read 959684 spots for SRR21853500.sra Written 959684 spots for SRR21853500.sra Read 959684 spots for SRR21853500.sra Written 959684 spots for SRR21853500.sra Read 959684 spots for SRR21853500.sra Written 959684 spots for SRR21853500.sra Read 959684 spots for SRR21853500.sra Written 959684 spots for SRR21853500.sra Read 959684 spots for SRR21853500.sra Written 959684 spots for SRR21853500.sra Read 959684 spots for SRR21853500.sra Written 959684 spots for SRR21853500.sra Read 959684 spots for SRR21853500.sra Written 959684 spots for SRR21853500.sra Read 959684 spots for SRR21853500.sra Written 959684 spots for SRR21853500.sra Read 959684 spots for SRR21853500.sra Written 959684 spots for SRR21853500.sra Read 959684 spots for SRR21853500.sra Written 959684 spots for SRR21853500.sra Read 959684 spots for SRR21853500.sra Written 959684 spots for SRR21853500.sra Read 959684 spots for SRR21853500.sra Written 959684 spots for SRR21853500.sra Read 959684 spots for SRR21853500.sra Written 959684 spots for SRR21853500.sra SRR ids: ['SRR21853500.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_3mvonyv1 SRR21853500.sra spots: 19193684 blocks: [[1, 959684], [959685, 1919368], [1919369, 2879052], [2879053, 3838736], [3838737, 4798420], [4798421, 5758104], [5758105, 6717788], [6717789, 7677472], [7677473, 8637156], [8637157, 9596840], [9596841, 10556524], [10556525, 11516208], [11516209, 12475892], [12475893, 13435576], [13435577, 14395260], [14395261, 15354944], [15354945, 16314628], [16314629, 17274312], [17274313, 18233996], [18233997, 19193684]] SRR21853500 file size 5169986 SRR21853500 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR21853500 SRR21853500_1.fastq Input file: SRR21853500_1.fastq trimmed: SRR21853500-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Fri Dec 6 16:23:08 2024 >> started Fri Dec 6 16:23:17 2024 >> done (9.072s) 19193684 reads processed; of these: 15 ( 0.00%) short reads filtered out after trimming by size control 80441 ( 0.42%) empty reads filtered out after trimming by size control 19113228 (99.58%) reads available; of these: 369 ( 0.00%) trimmed reads available after processing 19112859 (100.00%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 2 0.00% 20 3 0.00% 21 1 0.00% 22 0 0.00% 23 3 0.00% 24 6 0.00% 25 0 0.00% 26 1 0.00% 27 4 0.00% 28 5 0.00% 29 3 0.00% 30 6 0.00% 31 5 0.00% 32 7 0.00% 33 4 0.00% 34 6 0.00% 35 57 0.00% 36 55 0.00% 37 52 0.00% 38 73 0.00% 39 68 0.00% 40 72 0.00% 41 55 0.00% 42 59 0.00% 43 67 0.00% 44 58 0.00% 45 67 0.00% 46 89 0.00% 47 94 0.00% 48 89 0.00% 49 77 0.00% 50 95 0.00% 51 112 0.00% 52 105 0.00% 53 103 0.00% 54 111 0.00% 55 101 0.00% 56 99 0.00% 57 123 0.00% 58 137 0.00% 59 140 0.00% 60 134 0.00% 61 154 0.00% 62 160 0.00% 63 121 0.00% 64 143 0.00% 65 176 0.00% 66 158 0.00% 67 168 0.00% 68 155 0.00% 69 172 0.00% 70 191 0.00% 71 210 0.00% 72 212 0.00% 73 201 0.00% 74 172 0.00% 75 196 0.00% 76 254 0.00% 77 223 0.00% 78 264 0.00% 79 257 0.00% 80 243 0.00% 81 290 0.00% 82 296 0.00% 83 331 0.00% 84 341 0.00% 85 382 0.00% 86 409 0.00% 87 384 0.00% 88 410 0.00% 89 470 0.00% 90 579 0.00% 91 1128 0.01% 92 567 0.00% 93 684 0.00% 94 1410 0.01% 95 4412 0.02% 96 26612 0.14% 97 98225 0.51% 98 376868 1.97% 99 1296888 6.79% 100 4616983 24.16% 101 12679380 66.34% 19113228 reads passed initial QC criterion=sequence-density sequence-density=0.07 sequence-density-rank=1 fanout-score=1.98 fanout-score-rank=33 prefix-density=0.06 prefix-fanout=2.0 sequence=CCGTCAATTCCTTT criterion=fanout-score sequence-density=0.04 sequence-density-rank=20 fanout-score=248.09 fanout-score-rank=1 prefix-density=0.38 prefix-fanout=26.2 sequence=CAGCAGCAGCAA Started job on | Dec 06 16:23:34 Started mapping on | Dec 06 16:23:34 Finished on | Dec 06 16:24:23 Mapping speed, Million of reads per hour | 1404.24 Number of input reads | 19113228 Average input read length | 100 UNIQUE READS: Uniquely mapped reads number | 17091587 Uniquely mapped reads % | 89.42% Average mapped length | 100.21 Number of splices: Total | 6317155 Number of splices: Annotated (sjdb) | 5983655 Number of splices: GT/AG | 6233726 Number of splices: GC/AG | 70797 Number of splices: AT/AC | 3762 Number of splices: Non-canonical | 8870 Mismatch rate per base, % | 0.39% Deletion rate per base | 0.01% Deletion average length | 2.16 Insertion rate per base | 0.01% Insertion average length | 1.98 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 431173 % of reads mapped to multiple loci | 2.26% Number of reads mapped to too many loci | 339648 % of reads mapped to too many loci | 1.78% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 6.30% % of reads unmapped: other | 0.25% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1590468 1590468 1590468 N_multimapping 431173 431173 431173 N_noFeature 894857 8864867 8895499 N_ambiguous 262177 18468 19212 UnstrandedReadsAssigned:15934553 PositiveStrandReadsAssigned:8208252 NegativeStrandReadsAssigned:8176876 Dataset is classified unstranded MeadianReadLen=101 20thPercentileLength=100 echo kmer=95 SRR21853500 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR21853500-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 19,113,228 reads, 16,396,493 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,102 rounds 52973 SRR21853500.ke.tsv 35125 SRR21853500.se.tsv 88098 total ==> SRR21853500.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 0 0 PNS24247 1044 945 129.125 15.5056 PNS24249 1928 1829 103.609 6.42828 PNS24246 1044 945 129.125 15.5056 PNS24248 1044 945 129.125 15.5056 PNS24244 1471 1372 246.016 20.3479 PNS24243 293 194 28 16.3782 KQK14069 1603 1504 6719.2 506.967 KQK14071 474 375 1826.15 552.606 ==> SRR21853500.se.tsv <== BRADI_1g14170v3 9901 BRADI_1g53295v3 135 BRADI_1g59795v3 610 BRADI_1g07683v3 0 BRADI_1g00485v3 49 BRADI_1g20270v3 220 BRADI_1g74790v3 204 BRADI_1g09890v3 0 BRADI_1g77505v3 252 BRADI_1g48960v3 0 SRR21853500 completed mapping pipeline successfully