Starting /dee2/code/volunteer_pipeline.sh SRR21853501 current disk space = 1550586052608 free memory = 1599263012 SRR21853501 SRAfilesize 3ae930b2dfc405f90ce5657dcd923119 SRR21853501.sra SRR21853501.sra file validated SRR21853501 is single end SRR21853501 is conventional basespace SRR21853501 read1 length is 87-101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR21853501_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 87-101 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.538 37.0 37.0 37.0 37.0 37.0 2 35.726 37.0 37.0 37.0 37.0 37.0 3 35.9555 37.0 37.0 37.0 37.0 37.0 4 35.963 37.0 37.0 37.0 37.0 37.0 5 36.0955 37.0 37.0 37.0 37.0 37.0 6 36.0555 37.0 37.0 37.0 37.0 37.0 7 36.088 37.0 37.0 37.0 37.0 37.0 8 35.982 37.0 37.0 37.0 37.0 37.0 9 36.006 37.0 37.0 37.0 37.0 37.0 10-11 36.116749999999996 37.0 37.0 37.0 37.0 37.0 12-13 36.11425 37.0 37.0 37.0 37.0 37.0 14-15 35.9715 37.0 37.0 37.0 37.0 37.0 16-17 36.0345 37.0 37.0 37.0 37.0 37.0 18-19 35.9825 37.0 37.0 37.0 37.0 37.0 20-21 35.89675 37.0 37.0 37.0 37.0 37.0 22-23 35.9935 37.0 37.0 37.0 37.0 37.0 24-25 35.93625 37.0 37.0 37.0 37.0 37.0 26-27 35.83825 37.0 37.0 37.0 37.0 37.0 28-29 35.9075 37.0 37.0 37.0 37.0 37.0 30-31 35.695 37.0 37.0 37.0 37.0 37.0 32-33 35.907 37.0 37.0 37.0 37.0 37.0 34-35 35.771 37.0 37.0 37.0 37.0 37.0 36-37 35.80425 37.0 37.0 37.0 37.0 37.0 38-39 35.81825 37.0 37.0 37.0 37.0 37.0 40-41 35.80775 37.0 37.0 37.0 37.0 37.0 42-43 35.81375 37.0 37.0 37.0 37.0 37.0 44-45 35.744749999999996 37.0 37.0 37.0 37.0 37.0 46-47 35.839 37.0 37.0 37.0 37.0 37.0 48-49 35.65625 37.0 37.0 37.0 37.0 37.0 50-51 35.6485 37.0 37.0 37.0 37.0 37.0 52-53 35.673249999999996 37.0 37.0 37.0 37.0 37.0 54-55 35.675 37.0 37.0 37.0 37.0 37.0 56-57 35.7055 37.0 37.0 37.0 37.0 37.0 58-59 35.60425 37.0 37.0 37.0 37.0 37.0 60-61 35.71925 37.0 37.0 37.0 37.0 37.0 62-63 35.706 37.0 37.0 37.0 37.0 37.0 64-65 35.695 37.0 37.0 37.0 37.0 37.0 66-67 35.560500000000005 37.0 37.0 37.0 37.0 37.0 68-69 35.628 37.0 37.0 37.0 37.0 37.0 70-71 35.66275 37.0 37.0 37.0 37.0 37.0 72-73 35.64825 37.0 37.0 37.0 37.0 37.0 74-75 35.53125 37.0 37.0 37.0 37.0 37.0 76-77 35.51925 37.0 37.0 37.0 37.0 37.0 78-79 35.714 37.0 37.0 37.0 37.0 37.0 80-81 35.57 37.0 37.0 37.0 37.0 37.0 82-83 35.6345 37.0 37.0 37.0 37.0 37.0 84-85 35.61375 37.0 37.0 37.0 37.0 37.0 86-87 35.56075 37.0 37.0 37.0 37.0 37.0 88-89 35.476369092273075 37.0 37.0 37.0 37.0 37.0 90-91 35.55063765941485 37.0 37.0 37.0 37.0 37.0 92-93 35.50412603150788 37.0 37.0 37.0 37.0 37.0 94-95 35.58297115549523 37.0 37.0 37.0 37.0 37.0 96-97 35.52164783712105 37.0 37.0 37.0 37.0 37.0 98-99 35.46633331750641 37.0 37.0 37.0 37.0 37.0 100-101 35.3679345316464 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 2101 1 0.0 2101 2 0.0 2101 3 0.0 2101 4 0.0 2101 5 0.0 2101 6 0.0 2101 7 0.0 2101 8 0.0 2101 9 0.0 2101 10-11 0.0 2101 12-13 0.0 2101 14-15 0.0 2101 16-17 0.0 2101 18-19 0.0 2101 20-21 0.0 2101 22-23 0.0 2101 24-25 0.0 2101 26-27 0.0 2101 28-29 0.0 2101 30-31 0.0 2101 32-33 0.0 2101 34-35 0.0 2101 36-37 0.0 2101 38-39 0.0 2101 40-41 0.0 2101 42-43 0.0 2101 44-45 0.0 2101 46-47 0.0 2101 48-49 0.0 2101 50-51 0.0 2101 52-53 0.0 2101 54-55 0.0 2101 56-57 0.0 2101 58-59 0.0 2101 60-61 0.0 2101 62-63 0.0 2101 64-65 0.0 2101 66-67 0.0 2101 68-69 0.0 2101 70-71 0.0 2101 72-73 0.0 2101 74-75 0.0 2101 76-77 0.0 2101 78-79 0.0 2101 80-81 0.0 2101 82-83 0.0 2101 84-85 0.0 2101 86-87 0.0 2101 88-89 0.0 2101 90-91 0.0 2101 92-93 0.0 2101 94-95 0.0 2101 96-97 0.0 2101 98-99 0.0 2101 100-101 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 1.0 21 0.0 22 0.0 23 5.0 24 4.0 25 9.0 26 15.0 27 16.0 28 26.0 29 41.0 30 72.0 31 77.0 32 92.0 33 171.0 34 208.0 35 465.0 36 2239.0 37 559.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 26.025 13.450000000000001 18.6 41.925000000000004 2 24.85 20.3 31.8 23.05 3 24.875 23.375 26.424999999999997 25.324999999999996 4 25.624999999999996 29.9 20.9 23.575 5 27.825 31.1 21.875 19.2 6 21.575 34.35 21.875 22.2 7 19.175 16.925 41.125 22.775000000000002 8 22.2 23.375 25.474999999999998 28.95 9 21.125 21.675 30.325000000000003 26.875 10-11 24.474999999999998 29.375 21.5625 24.587500000000002 12-13 22.75 23.7 26.825 26.724999999999998 14-15 23.4625 25.7125 26.325 24.5 16-17 24.3625 24.95 26.0375 24.65 18-19 24.0375 25.85 25.0125 25.1 20-21 23.4875 25.55 26.674999999999997 24.2875 22-23 23.474999999999998 25.687500000000004 26.200000000000003 24.637500000000003 24-25 22.975 24.675 27.1625 25.1875 26-27 23.2375 26.687499999999996 25.2875 24.7875 28-29 24.099999999999998 24.5625 26.025 25.3125 30-31 23.724999999999998 25.324999999999996 26.187500000000004 24.762500000000003 32-33 23.5 27.150000000000002 24.4375 24.9125 34-35 23.5125 25.5 26.275 24.712500000000002 36-37 23.4375 25.7625 25.912499999999998 24.887500000000003 38-39 23.8625 26.125 25.4375 24.575 40-41 23.8625 26.0 25.2875 24.85 42-43 23.7125 25.4875 26.4125 24.3875 44-45 23.2875 26.55 25.7125 24.45 46-47 23.150000000000002 25.724999999999998 25.424999999999997 25.7 48-49 23.05 26.375 25.387500000000003 25.1875 50-51 23.7 26.0125 25.4 24.887500000000003 52-53 24.65 25.525 24.962500000000002 24.8625 54-55 23.200000000000003 25.35 26.375 25.074999999999996 56-57 23.9125 26.4625 24.45 25.174999999999997 58-59 23.2875 25.837500000000002 25.0 25.874999999999996 60-61 24.15 26.7125 25.112499999999997 24.025 62-63 24.099999999999998 26.137500000000003 25.4375 24.325 64-65 24.2375 25.9625 25.5125 24.2875 66-67 23.125 25.8125 25.6 25.4625 68-69 24.2625 26.424999999999997 25.224999999999998 24.087500000000002 70-71 23.474999999999998 26.35 25.724999999999998 24.45 72-73 23.8125 25.2625 25.575 25.35 74-75 24.05 26.325 25.4875 24.1375 76-77 23.7125 25.7125 25.074999999999996 25.5 78-79 23.6375 26.137500000000003 24.962500000000002 25.2625 80-81 24.087500000000002 26.35 24.425 25.137500000000003 82-83 23.525 26.137500000000003 25.55 24.7875 84-85 24.275 26.237500000000004 25.387500000000003 24.099999999999998 86-87 24.3125 26.8 25.724999999999998 23.1625 88-89 24.406101525381345 26.469117279319832 24.81870467616904 24.306076519129782 90-91 23.843460865216304 26.531632908227053 25.531382845711427 24.093523380845213 92-93 23.768442110527634 26.081520380095025 25.918979744936234 24.23105776444111 94-95 24.746780042515944 25.772164561710643 25.084406652494685 24.39664874327873 96-97 24.780976220275345 26.307884856070086 25.494367959949937 23.416770963704632 98-99 23.746200607902736 26.10182370820669 25.569908814589663 24.58206686930091 100-101 25.695216907675196 12.31527093596059 30.859685364690925 31.12982679167329 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 1.0 6 1.0 7 0.0 8 0.5 9 1.0 10 0.5 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 1.0 23 1.0 24 0.0 25 0.0 26 2.0 27 4.0 28 7.5 29 11.0 30 9.0 31 8.5 32 14.0 33 22.5 34 35.0 35 48.0 36 51.5 37 57.5 38 85.0 39 102.0 40 129.0 41 172.5 42 187.5 43 215.5 44 231.5 45 217.0 46 208.5 47 190.0 48 179.5 49 174.0 50 159.0 51 137.5 52 126.0 53 117.5 54 107.5 55 102.0 56 85.5 57 73.0 58 66.0 59 68.0 60 63.5 61 53.0 62 46.5 63 45.5 64 50.5 65 42.0 66 42.0 67 41.5 68 27.0 69 24.5 70 26.5 71 29.0 72 28.0 73 20.0 74 10.5 75 7.0 76 8.0 77 8.5 78 6.0 79 4.0 80 4.0 81 1.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 87 1.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 1.0 95 2.0 96 2.0 97 8.0 98 76.0 99 276.0 100 975.0 101 2659.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.35 #Duplication Level Percentage of deduplicated Percentage of total 1 93.27798607391537 87.075 2 6.320299946438136 11.799999999999999 3 0.4017139796464917 1.125 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 444838 spots for SRR21853501.sra Written 444838 spots for SRR21853501.sra Read 444838 spots for SRR21853501.sra Written 444838 spots for SRR21853501.sra Read 444838 spots for SRR21853501.sra Written 444838 spots for SRR21853501.sra Read 444838 spots for SRR21853501.sra Written 444838 spots for SRR21853501.sra Read 444838 spots for SRR21853501.sra Written 444838 spots for SRR21853501.sra Read 444838 spots for SRR21853501.sra Written 444838 spots for SRR21853501.sra Read 444838 spots for SRR21853501.sra Written 444838 spots for SRR21853501.sra Read 444838 spots for SRR21853501.sra Written 444838 spots for SRR21853501.sra Read 444838 spots for SRR21853501.sra Written 444838 spots for SRR21853501.sra Read 444838 spots for SRR21853501.sra Written 444838 spots for SRR21853501.sra Read 444838 spots for SRR21853501.sra Written 444838 spots for SRR21853501.sra Read 444838 spots for SRR21853501.sra Written 444838 spots for SRR21853501.sra Read 444838 spots for SRR21853501.sra Written 444838 spots for SRR21853501.sra Read 444838 spots for SRR21853501.sra Written 444838 spots for SRR21853501.sra Read 444838 spots for SRR21853501.sra Written 444838 spots for SRR21853501.sra Read 444838 spots for SRR21853501.sra Written 444838 spots for SRR21853501.sra Read 444838 spots for SRR21853501.sra Written 444838 spots for SRR21853501.sra Read 444838 spots for SRR21853501.sra Written 444838 spots for SRR21853501.sra Read 444838 spots for SRR21853501.sra Written 444838 spots for SRR21853501.sra Read 444852 spots for SRR21853501.sra Written 444852 spots for SRR21853501.sra SRR ids: ['SRR21853501.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_8lhj544w SRR21853501.sra spots: 8896774 blocks: [[1, 444838], [444839, 889676], [889677, 1334514], [1334515, 1779352], [1779353, 2224190], [2224191, 2669028], [2669029, 3113866], [3113867, 3558704], [3558705, 4003542], [4003543, 4448380], [4448381, 4893218], [4893219, 5338056], [5338057, 5782894], [5782895, 6227732], [6227733, 6672570], [6672571, 7117408], [7117409, 7562246], [7562247, 8007084], [8007085, 8451922], [8451923, 8896774]] SRR21853501 file size 2391832 SRR21853501 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR21853501 SRR21853501_1.fastq Input file: SRR21853501_1.fastq trimmed: SRR21853501-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Fri Dec 6 16:23:27 2024 >> started Fri Dec 6 16:23:35 2024 >> done (7.691s) 8896774 reads processed; of these: 2 ( 0.00%) short reads filtered out after trimming by size control 10425 ( 0.12%) empty reads filtered out after trimming by size control 8886347 (99.88%) reads available; of these: 268 ( 0.00%) trimmed reads available after processing 8886079 (100.00%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 25 1 0.00% 26 0 0.00% 27 0 0.00% 28 1 0.00% 29 2 0.00% 30 0 0.00% 31 2 0.00% 32 5 0.00% 33 8 0.00% 34 5 0.00% 35 8 0.00% 36 12 0.00% 37 13 0.00% 38 13 0.00% 39 11 0.00% 40 19 0.00% 41 13 0.00% 42 12 0.00% 43 18 0.00% 44 17 0.00% 45 15 0.00% 46 18 0.00% 47 10 0.00% 48 13 0.00% 49 15 0.00% 50 13 0.00% 51 25 0.00% 52 13 0.00% 53 26 0.00% 54 18 0.00% 55 21 0.00% 56 13 0.00% 57 25 0.00% 58 22 0.00% 59 24 0.00% 60 33 0.00% 61 12 0.00% 62 20 0.00% 63 34 0.00% 64 25 0.00% 65 36 0.00% 66 30 0.00% 67 29 0.00% 68 21 0.00% 69 34 0.00% 70 31 0.00% 71 29 0.00% 72 23 0.00% 73 28 0.00% 74 42 0.00% 75 40 0.00% 76 27 0.00% 77 40 0.00% 78 40 0.00% 79 37 0.00% 80 41 0.00% 81 36 0.00% 82 38 0.00% 83 60 0.00% 84 56 0.00% 85 63 0.00% 86 45 0.00% 87 67 0.00% 88 65 0.00% 89 85 0.00% 90 111 0.00% 91 307 0.00% 92 89 0.00% 93 190 0.00% 94 503 0.01% 95 1949 0.02% 96 12387 0.14% 97 45523 0.51% 98 175883 1.98% 99 608184 6.84% 100 2140065 24.08% 101 5899558 66.39% 8886347 reads passed initial QC criterion=sequence-density sequence-density=0.10 sequence-density-rank=1 fanout-score=2.17 fanout-score-rank=21 prefix-density=0.11 prefix-fanout=2.0 sequence=GCTCCTTTCCAGGG criterion=fanout-score sequence-density=0.05 sequence-density-rank=22 fanout-score=202.68 fanout-score-rank=1 prefix-density=0.45 prefix-fanout=21.6 sequence=CGCCGCCGCCGT Started job on | Dec 06 16:23:52 Started mapping on | Dec 06 16:23:52 Finished on | Dec 06 16:24:14 Mapping speed, Million of reads per hour | 1454.13 Number of input reads | 8886347 Average input read length | 100 UNIQUE READS: Uniquely mapped reads number | 8539543 Uniquely mapped reads % | 96.10% Average mapped length | 100.24 Number of splices: Total | 3190108 Number of splices: Annotated (sjdb) | 3021015 Number of splices: GT/AG | 3143071 Number of splices: GC/AG | 41003 Number of splices: AT/AC | 1888 Number of splices: Non-canonical | 4146 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.01% Deletion average length | 2.14 Insertion rate per base | 0.01% Insertion average length | 1.93 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 170549 % of reads mapped to multiple loci | 1.92% Number of reads mapped to too many loci | 62282 % of reads mapped to too many loci | 0.70% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.18% % of reads unmapped: other | 0.10% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 176255 176255 176255 N_multimapping 170549 170549 170549 N_noFeature 456592 4436060 4446893 N_ambiguous 130544 8602 9523 UnstrandedReadsAssigned:7952407 PositiveStrandReadsAssigned:4094881 NegativeStrandReadsAssigned:4083127 Dataset is classified unstranded MeadianReadLen=101 20thPercentileLength=100 echo kmer=95 SRR21853501 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR21853501-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 8,886,347 reads, 8,167,661 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,083 rounds 52973 SRR21853501.ke.tsv 35125 SRR21853501.se.tsv 88098 total ==> SRR21853501.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 15.7719 4.38553 PNS24247 1044 945 39.9366 9.83561 PNS24249 1928 1829 32.7971 4.17334 PNS24246 1044 945 39.9366 9.83561 PNS24248 1044 945 39.9366 9.83561 PNS24244 1471 1372 52.6212 8.92624 PNS24243 293 194 5 5.99833 KQK14069 1603 1504 3335.82 516.199 KQK14071 474 375 863.079 535.65 ==> SRR21853501.se.tsv <== BRADI_1g14170v3 4840 BRADI_1g53295v3 66 BRADI_1g59795v3 232 BRADI_1g07683v3 0 BRADI_1g00485v3 38 BRADI_1g20270v3 719 BRADI_1g74790v3 56 BRADI_1g09890v3 0 BRADI_1g77505v3 165 BRADI_1g48960v3 0 SRR21853501 completed mapping pipeline successfully