Starting /dee2/code/volunteer_pipeline.sh SRR21853502 current disk space = 1550642855936 free memory = 1603175380 SRR21853502 SRAfilesize f7d18d9c8261270f06f9aac437b57a9e SRR21853502.sra SRR21853502.sra file validated SRR21853502 is single end SRR21853502 is conventional basespace SRR21853502 read1 length is 48-101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR21853502_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 48-101 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.081 37.0 37.0 37.0 25.0 37.0 2 34.86375 37.0 37.0 37.0 25.0 37.0 3 35.437 37.0 37.0 37.0 37.0 37.0 4 35.6455 37.0 37.0 37.0 37.0 37.0 5 35.738 37.0 37.0 37.0 37.0 37.0 6 35.891 37.0 37.0 37.0 37.0 37.0 7 35.697 37.0 37.0 37.0 37.0 37.0 8 35.856 37.0 37.0 37.0 37.0 37.0 9 35.8235 37.0 37.0 37.0 37.0 37.0 10-11 35.896249999999995 37.0 37.0 37.0 37.0 37.0 12-13 35.761250000000004 37.0 37.0 37.0 37.0 37.0 14-15 35.7535 37.0 37.0 37.0 37.0 37.0 16-17 35.82 37.0 37.0 37.0 37.0 37.0 18-19 35.669250000000005 37.0 37.0 37.0 37.0 37.0 20-21 35.7945 37.0 37.0 37.0 37.0 37.0 22-23 35.794 37.0 37.0 37.0 37.0 37.0 24-25 35.629000000000005 37.0 37.0 37.0 37.0 37.0 26-27 35.50425 37.0 37.0 37.0 37.0 37.0 28-29 35.71075 37.0 37.0 37.0 37.0 37.0 30-31 35.4865 37.0 37.0 37.0 37.0 37.0 32-33 35.60525 37.0 37.0 37.0 37.0 37.0 34-35 35.6975 37.0 37.0 37.0 37.0 37.0 36-37 35.59875 37.0 37.0 37.0 37.0 37.0 38-39 35.5605 37.0 37.0 37.0 37.0 37.0 40-41 35.541250000000005 37.0 37.0 37.0 37.0 37.0 42-43 35.44775 37.0 37.0 37.0 37.0 37.0 44-45 35.4965 37.0 37.0 37.0 37.0 37.0 46-47 35.52775 37.0 37.0 37.0 37.0 37.0 48-49 35.53106276569142 37.0 37.0 37.0 37.0 37.0 50-51 35.435858964741186 37.0 37.0 37.0 37.0 37.0 52-53 35.49587396849212 37.0 37.0 37.0 37.0 37.0 54-55 35.36534133533384 37.0 37.0 37.0 37.0 37.0 56-57 35.42085521380345 37.0 37.0 37.0 37.0 37.0 58-59 35.371592898224556 37.0 37.0 37.0 31.0 37.0 60-61 35.487621905476374 37.0 37.0 37.0 37.0 37.0 62-63 35.28657164291073 37.0 37.0 37.0 31.0 37.0 64-65 35.46636659164791 37.0 37.0 37.0 37.0 37.0 66-67 35.26456614153538 37.0 37.0 37.0 37.0 37.0 68-69 35.310077519379846 37.0 37.0 37.0 37.0 37.0 70-71 35.23605901475369 37.0 37.0 37.0 31.0 37.0 72-73 35.29914957478739 37.0 37.0 37.0 37.0 37.0 74-75 35.245372686343174 37.0 37.0 37.0 31.0 37.0 76-77 35.29489744872436 37.0 37.0 37.0 31.0 37.0 78-79 35.32166083041521 37.0 37.0 37.0 31.0 37.0 80-81 35.26488244122061 37.0 37.0 37.0 31.0 37.0 82-83 35.32266133066533 37.0 37.0 37.0 31.0 37.0 84-85 35.30990495247624 37.0 37.0 37.0 31.0 37.0 86-87 35.235867933966986 37.0 37.0 37.0 31.0 37.0 88-89 35.31390695347674 37.0 37.0 37.0 31.0 37.0 90-91 35.22439722488214 37.0 37.0 37.0 31.0 37.0 92-93 35.28278278278279 37.0 37.0 37.0 37.0 37.0 94-95 35.11213804542966 37.0 37.0 37.0 25.0 37.0 96-97 35.14695209733429 37.0 37.0 37.0 25.0 37.0 98-99 35.15789706568293 37.0 37.0 37.0 25.0 37.0 100-101 35.087288095967125 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100-101 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 1.0 23 5.0 24 4.0 25 7.0 26 19.0 27 20.0 28 45.0 29 54.0 30 81.0 31 110.0 32 125.0 33 200.0 34 271.0 35 548.0 36 2142.0 37 368.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 28.275 14.475 19.5 37.75 2 24.20785804816223 19.64512040557668 32.623574144486696 23.523447401774398 3 24.55 24.474999999999998 25.124999999999996 25.85 4 25.624999999999996 29.95 19.125 25.3 5 27.400000000000002 30.725 22.15 19.725 6 20.125 34.725 22.75 22.400000000000002 7 19.35 17.65 39.300000000000004 23.7 8 23.225 21.975 27.224999999999998 27.575 9 20.599999999999998 22.15 28.525 28.725 10-11 25.5625 29.425 21.025 23.9875 12-13 22.900000000000002 24.4125 25.9875 26.700000000000003 14-15 23.925 24.6875 25.95 25.4375 16-17 24.175 25.337500000000002 25.6125 24.875 18-19 24.65 25.5125 25.525 24.3125 20-21 23.8875 24.9 26.0375 25.174999999999997 22-23 23.8625 26.224999999999998 25.525 24.3875 24-25 24.9 24.9875 25.55 24.5625 26-27 24.224999999999998 26.674999999999997 24.5 24.6 28-29 23.474999999999998 26.1 25.6125 24.8125 30-31 23.775 25.85 25.025 25.35 32-33 24.1375 25.837500000000002 26.2625 23.7625 34-35 24.462500000000002 25.4875 24.975 25.074999999999996 36-37 24.5 25.75 25.4 24.349999999999998 38-39 24.587500000000002 25.8625 25.0125 24.5375 40-41 24.4375 26.35 24.6625 24.55 42-43 23.775 24.587500000000002 26.174999999999997 25.4625 44-45 24.4 25.637500000000003 25.587500000000002 24.375 46-47 24.887500000000003 25.4375 25.525 24.15 48-49 23.71546443305413 24.915614451806476 25.653206650831358 25.715714464308036 50-51 24.48112028007002 25.76894223555889 25.806451612903224 23.943485871467868 52-53 24.131032758189548 24.681170292573142 25.28132033008252 25.906476619154787 54-55 23.23080770192548 25.431357839459867 25.93148287071768 25.406351587896975 56-57 23.305826456614152 25.218804701175294 26.456614153538382 25.018754688672168 58-59 23.25581395348837 26.03150787696924 25.618904726181547 25.09377344336084 60-61 23.593398349587396 25.55638909727432 25.35633908477119 25.49387346836709 62-63 23.893473368342086 26.91922980745186 25.431357839459867 23.755938984746187 64-65 24.593648412103025 25.168792198049513 25.906476619154787 24.33108277069267 66-67 23.118279569892472 25.418854713678417 25.743935983995996 25.71892973243311 68-69 23.78094523630908 25.756439109777446 25.893973493373345 24.568642160540136 70-71 24.90622655663916 25.468867216804203 25.068767191797946 24.55613903475869 72-73 22.836418209104554 26.17558779389695 25.87543771885943 25.11255627813907 74-75 24.974987493746873 26.338169084542272 25.087543771885944 23.59929964982491 76-77 24.324662331165584 25.700350175087543 24.662331165582792 25.312656328164078 78-79 23.999499749874936 25.7503751875938 25.53776888444222 24.712356178089045 80-81 25.362681340670335 24.749874937468736 25.82541270635318 24.062031015507753 82-83 23.51175587793897 26.338169084542272 25.275137568784395 24.874937468734366 84-85 24.12456228114057 25.6128064032016 25.587793896948476 24.674837418709355 86-87 24.387193596798397 25.212606303151574 25.78789394697349 24.61230615307654 88-89 24.012006003001503 25.350175087543768 25.80040020010005 24.83741870935468 90-91 24.490306441525952 26.153846153846157 24.978111319574733 24.377736085053158 92-93 24.2992992992993 25.11261261261261 25.8008008008008 24.78728728728729 94-95 24.089600800901014 26.88024027030409 25.003128519584532 24.02703040921036 96-97 24.248873309964946 25.863795693540307 24.812218327491237 25.07511266900351 98-99 23.233092247176753 25.885039969547012 25.9865499302119 24.895317853064334 100-101 25.717063684978125 11.71609139523578 31.66423594231081 30.90260897747529 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 1.0 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 0.5 22 1.0 23 1.0 24 0.5 25 1.0 26 2.0 27 1.5 28 3.0 29 6.0 30 9.0 31 11.5 32 12.5 33 21.0 34 40.5 35 51.5 36 54.0 37 66.0 38 82.5 39 100.0 40 120.0 41 129.0 42 163.5 43 201.0 44 208.5 45 206.5 46 218.5 47 212.0 48 190.5 49 187.5 50 157.5 51 138.5 52 140.0 53 123.0 54 110.0 55 106.0 56 89.5 57 84.0 58 77.5 59 71.5 60 67.5 61 50.5 62 52.0 63 54.5 64 52.5 65 49.0 66 35.5 67 37.0 68 38.0 69 29.5 70 26.5 71 22.0 72 22.0 73 19.5 74 12.0 75 10.5 76 8.5 77 6.0 78 4.0 79 2.5 80 1.5 81 0.5 82 0.5 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 1.375 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 48-49 1.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 1.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 2.0 92-93 0.0 94-95 1.0 96-97 17.0 98-99 404.0 100-101 3574.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.675 #Duplication Level Percentage of deduplicated Percentage of total 1 93.64825193488124 87.725 2 6.058179877235122 11.35 3 0.21350413664264745 0.6 4 0.05337603416066186 0.2 5 0.02668801708033093 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTGCTGCTCCAGGTGGGCAAGAACCAGCCGCCGCCGCAGGTCACGGCCTA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 851645 spots for SRR21853502.sra Written 851645 spots for SRR21853502.sra Read 851645 spots for SRR21853502.sra Written 851645 spots for SRR21853502.sra Read 851645 spots for SRR21853502.sra Written 851645 spots for SRR21853502.sra Read 851645 spots for SRR21853502.sra Written 851645 spots for SRR21853502.sra Read 851645 spots for SRR21853502.sra Written 851645 spots for SRR21853502.sra Read 851645 spots for SRR21853502.sra Written 851645 spots for SRR21853502.sra Read 851645 spots for SRR21853502.sra Written 851645 spots for SRR21853502.sra Read 851645 spots for SRR21853502.sra Written 851645 spots for SRR21853502.sra Read 851645 spots for SRR21853502.sra Written 851645 spots for SRR21853502.sra Read 851645 spots for SRR21853502.sra Written 851645 spots for SRR21853502.sra Read 851645 spots for SRR21853502.sra Written 851645 spots for SRR21853502.sra Read 851645 spots for SRR21853502.sra Written 851645 spots for SRR21853502.sra Read 851645 spots for SRR21853502.sra Written 851645 spots for SRR21853502.sra Read 851645 spots for SRR21853502.sra Written 851645 spots for SRR21853502.sra Read 851645 spots for SRR21853502.sra Written 851645 spots for SRR21853502.sra Read 851645 spots for SRR21853502.sra Written 851645 spots for SRR21853502.sra Read 851645 spots for SRR21853502.sra Written 851645 spots for SRR21853502.sra Read 851645 spots for SRR21853502.sra Written 851645 spots for SRR21853502.sra Read 851647 spots for SRR21853502.sra Written 851647 spots for SRR21853502.sra Read 851645 spots for SRR21853502.sra Written 851645 spots for SRR21853502.sra SRR ids: ['SRR21853502.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_vt4np7pd SRR21853502.sra spots: 17032902 blocks: [[1, 851645], [851646, 1703290], [1703291, 2554935], [2554936, 3406580], [3406581, 4258225], [4258226, 5109870], [5109871, 5961515], [5961516, 6813160], [6813161, 7664805], [7664806, 8516450], [8516451, 9368095], [9368096, 10219740], [10219741, 11071385], [11071386, 11923030], [11923031, 12774675], [12774676, 13626320], [13626321, 14477965], [14477966, 15329610], [15329611, 16181255], [16181256, 17032902]] SRR21853502 file size 4586787 SRR21853502 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR21853502 SRR21853502_1.fastq Input file: SRR21853502_1.fastq trimmed: SRR21853502-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Fri Dec 6 16:28:42 2024 >> started Fri Dec 6 16:28:51 2024 >> done (8.505s) 17032902 reads processed; of these: 8 ( 0.00%) short reads filtered out after trimming by size control 32841 ( 0.19%) empty reads filtered out after trimming by size control 17000053 (99.81%) reads available; of these: 298 ( 0.00%) trimmed reads available after processing 16999755 (100.00%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 19 1 0.00% 20 1 0.00% 21 2 0.00% 22 2 0.00% 23 2 0.00% 24 1 0.00% 25 2 0.00% 26 1 0.00% 27 1 0.00% 28 5 0.00% 29 6 0.00% 30 2 0.00% 31 1 0.00% 32 2 0.00% 33 6 0.00% 34 3 0.00% 35 37 0.00% 36 40 0.00% 37 40 0.00% 38 43 0.00% 39 48 0.00% 40 54 0.00% 41 37 0.00% 42 60 0.00% 43 54 0.00% 44 64 0.00% 45 56 0.00% 46 59 0.00% 47 68 0.00% 48 58 0.00% 49 80 0.00% 50 70 0.00% 51 75 0.00% 52 65 0.00% 53 84 0.00% 54 89 0.00% 55 74 0.00% 56 65 0.00% 57 84 0.00% 58 97 0.00% 59 102 0.00% 60 112 0.00% 61 112 0.00% 62 102 0.00% 63 90 0.00% 64 98 0.00% 65 85 0.00% 66 112 0.00% 67 117 0.00% 68 119 0.00% 69 110 0.00% 70 107 0.00% 71 107 0.00% 72 119 0.00% 73 105 0.00% 74 135 0.00% 75 151 0.00% 76 157 0.00% 77 145 0.00% 78 167 0.00% 79 144 0.00% 80 152 0.00% 81 172 0.00% 82 199 0.00% 83 178 0.00% 84 200 0.00% 85 203 0.00% 86 210 0.00% 87 236 0.00% 88 265 0.00% 89 316 0.00% 90 403 0.00% 91 802 0.00% 92 323 0.00% 93 453 0.00% 94 1080 0.01% 95 3957 0.02% 96 23735 0.14% 97 87973 0.52% 98 335474 1.97% 99 1164734 6.85% 100 4095677 24.09% 101 11279276 66.35% 17000053 reads passed initial QC criterion=sequence-density sequence-density=0.13 sequence-density-rank=1 fanout-score=3.26 fanout-score-rank=10 prefix-density=0.20 prefix-fanout=2.2 sequence=CCTTTCCAGGGCCTCAAGTCCACCGCCGGCCTCCCC criterion=fanout-score sequence-density=0.06 sequence-density-rank=15 fanout-score=178.56 fanout-score-rank=1 prefix-density=0.45 prefix-fanout=22.1 sequence=CGCCGCCGCCGC Started job on | Dec 06 16:29:07 Started mapping on | Dec 06 16:29:07 Finished on | Dec 06 16:29:29 Mapping speed, Million of reads per hour | 2781.83 Number of input reads | 17000053 Average input read length | 100 UNIQUE READS: Uniquely mapped reads number | 16308750 Uniquely mapped reads % | 95.93% Average mapped length | 100.21 Number of splices: Total | 6097905 Number of splices: Annotated (sjdb) | 5773381 Number of splices: GT/AG | 6007129 Number of splices: GC/AG | 79081 Number of splices: AT/AC | 3323 Number of splices: Non-canonical | 8372 Mismatch rate per base, % | 0.40% Deletion rate per base | 0.01% Deletion average length | 2.16 Insertion rate per base | 0.01% Insertion average length | 1.92 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 327530 % of reads mapped to multiple loci | 1.93% Number of reads mapped to too many loci | 117795 % of reads mapped to too many loci | 0.69% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.35% % of reads unmapped: other | 0.10% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 363773 363773 363773 N_multimapping 327530 327530 327530 N_noFeature 857478 8448287 8500663 N_ambiguous 250887 16608 18430 UnstrandedReadsAssigned:15200385 PositiveStrandReadsAssigned:7843855 NegativeStrandReadsAssigned:7789657 Dataset is classified unstranded MeadianReadLen=101 20thPercentileLength=100 echo kmer=95 SRR21853502 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR21853502-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,000,053 reads, 15,593,985 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,147 rounds 52973 SRR21853502.ke.tsv 35125 SRR21853502.se.tsv 88098 total ==> SRR21853502.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 77.9036 11.2469 PNS24247 1044 945 74.512 9.52788 PNS24249 1928 1829 86.4879 5.71405 PNS24246 1044 945 74.512 9.52788 PNS24248 1044 945 74.512 9.52788 PNS24244 1471 1372 68.0727 5.99544 PNS24243 293 194 17 10.5889 KQK14069 1603 1504 6850.95 550.434 KQK14071 474 375 1591.51 512.839 ==> SRR21853502.se.tsv <== BRADI_1g14170v3 9524 BRADI_1g53295v3 137 BRADI_1g59795v3 415 BRADI_1g07683v3 0 BRADI_1g00485v3 84 BRADI_1g20270v3 1241 BRADI_1g74790v3 148 BRADI_1g09890v3 2 BRADI_1g77505v3 271 BRADI_1g48960v3 0 SRR21853502 completed mapping pipeline successfully