Starting /dee2/code/volunteer_pipeline.sh SRR21853503 current disk space = 1550641041408 free memory = 1598078184 SRR21853503 SRAfilesize 0fc93ef9e5c315e24815c83b76d1ce15 SRR21853503.sra SRR21853503.sra file validated SRR21853503 is single end SRR21853503 is conventional basespace SRR21853503 read1 length is 35-101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR21853503_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 35-101 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.53325 37.0 37.0 37.0 37.0 37.0 2 35.78775 37.0 37.0 37.0 37.0 37.0 3 35.96175 37.0 37.0 37.0 37.0 37.0 4 35.81625 37.0 37.0 37.0 37.0 37.0 5 35.97675 37.0 37.0 37.0 37.0 37.0 6 36.01575 37.0 37.0 37.0 37.0 37.0 7 35.98075 37.0 37.0 37.0 37.0 37.0 8 36.02425 37.0 37.0 37.0 37.0 37.0 9 35.93025 37.0 37.0 37.0 37.0 37.0 10-11 36.05 37.0 37.0 37.0 37.0 37.0 12-13 36.104 37.0 37.0 37.0 37.0 37.0 14-15 35.98625 37.0 37.0 37.0 37.0 37.0 16-17 35.89475 37.0 37.0 37.0 37.0 37.0 18-19 35.92575 37.0 37.0 37.0 37.0 37.0 20-21 35.8905 37.0 37.0 37.0 37.0 37.0 22-23 35.9175 37.0 37.0 37.0 37.0 37.0 24-25 35.83225 37.0 37.0 37.0 37.0 37.0 26-27 35.76625 37.0 37.0 37.0 37.0 37.0 28-29 35.85125 37.0 37.0 37.0 37.0 37.0 30-31 35.75775 37.0 37.0 37.0 37.0 37.0 32-33 35.70975 37.0 37.0 37.0 37.0 37.0 34-35 35.824749999999995 37.0 37.0 37.0 37.0 37.0 36-37 35.82345586396599 37.0 37.0 37.0 37.0 37.0 38-39 35.746686671667916 37.0 37.0 37.0 37.0 37.0 40-41 35.78269567391848 37.0 37.0 37.0 37.0 37.0 42-43 35.72993248312078 37.0 37.0 37.0 37.0 37.0 44-45 35.659164791197796 37.0 37.0 37.0 37.0 37.0 46-47 35.78294573643411 37.0 37.0 37.0 37.0 37.0 48-49 35.616654163540886 37.0 37.0 37.0 37.0 37.0 50-51 35.709427356839214 37.0 37.0 37.0 37.0 37.0 52-53 35.6011502875719 37.0 37.0 37.0 37.0 37.0 54-55 35.523130782695674 37.0 37.0 37.0 37.0 37.0 56-57 35.66991747936984 37.0 37.0 37.0 37.0 37.0 58-59 35.63565891472868 37.0 37.0 37.0 37.0 37.0 60-61 35.61290322580645 37.0 37.0 37.0 37.0 37.0 62-63 35.66666666666667 37.0 37.0 37.0 37.0 37.0 64-65 35.599399849962495 37.0 37.0 37.0 37.0 37.0 66-67 35.677419354838705 37.0 37.0 37.0 37.0 37.0 68-69 35.68217054263566 37.0 37.0 37.0 37.0 37.0 70-71 35.71067766941735 37.0 37.0 37.0 37.0 37.0 72-73 35.65566391597899 37.0 37.0 37.0 37.0 37.0 74-75 35.60872359160325 37.0 37.0 37.0 37.0 37.0 76-77 35.535267633816915 37.0 37.0 37.0 37.0 37.0 78-79 35.64032016008004 37.0 37.0 37.0 37.0 37.0 80-81 35.538769384692344 37.0 37.0 37.0 37.0 37.0 82-83 35.6368184092046 37.0 37.0 37.0 37.0 37.0 84-85 35.55752876438219 37.0 37.0 37.0 37.0 37.0 86-87 35.653826913456726 37.0 37.0 37.0 37.0 37.0 88-89 35.50275137568784 37.0 37.0 37.0 37.0 37.0 90-91 35.4032016008004 37.0 37.0 37.0 37.0 37.0 92-93 35.52326163081541 37.0 37.0 37.0 37.0 37.0 94-95 35.52201100550275 37.0 37.0 37.0 37.0 37.0 96-97 35.49381903728748 37.0 37.0 37.0 37.0 37.0 98-99 35.50016661383789 37.0 37.0 37.0 37.0 37.0 100-101 35.37011186332424 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 2101 1 0.0 2101 2 0.0 2101 3 0.0 2101 4 0.0 2101 5 0.0 2101 6 0.0 2101 7 0.0 2101 8 0.0 2101 9 0.0 2101 10-11 0.0 2101 12-13 0.0 2101 14-15 0.0 2101 16-17 0.0 2101 18-19 0.0 2101 20-21 0.0 2101 22-23 0.0 2101 24-25 0.0 2101 26-27 0.0 2101 28-29 0.0 2101 30-31 0.0 2101 32-33 0.0 2101 34-35 0.0 2101 36-37 0.0 2101 38-39 0.0 2101 40-41 0.0 2101 42-43 0.0 2101 44-45 0.0 2101 46-47 0.0 2101 48-49 0.0 2101 50-51 0.0 2101 52-53 0.0 2101 54-55 0.0 2101 56-57 0.0 2101 58-59 0.0 2101 60-61 0.0 2101 62-63 0.0 2101 64-65 0.0 2101 66-67 0.0 2101 68-69 0.0 2101 70-71 0.0 2101 72-73 0.0 2101 74-75 0.0 2101 76-77 0.0 2101 78-79 0.0 2101 80-81 0.0 2101 82-83 0.0 2101 84-85 0.0 2101 86-87 0.0 2101 88-89 0.0 2101 90-91 0.0 2101 92-93 0.0 2101 94-95 0.0 2101 96-97 0.0 2101 98-99 0.0 2101 100-101 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 2.0 21 1.0 22 1.0 23 4.0 24 4.0 25 6.0 26 17.0 27 21.0 28 34.0 29 42.0 30 55.0 31 78.0 32 94.0 33 158.0 34 242.0 35 500.0 36 2175.0 37 565.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 28.732183045761438 13.42835708927232 17.60440110027507 40.235058764691175 2 25.70642660665166 18.95473868467117 32.13303325831458 23.20580145036259 3 27.25681420355089 23.15578894723681 23.030757689422355 26.556639159789945 4 25.881470367591895 31.357839459864966 18.104526131532882 24.656164041010253 5 29.40735183795949 29.582395598899723 20.730182545636406 20.280070017504375 6 22.280570142535634 33.383345836459114 20.730182545636406 23.605901475368842 7 19.579894973743436 16.854213553388348 39.68492123030758 23.88097024256064 8 22.680670167541887 21.530382595648913 26.281570392598148 29.507376844211052 9 22.605651412853213 20.080020005001252 29.532383095773945 27.781945486371594 10-11 25.693923480870218 27.19429857464366 20.030007501875467 27.081770442610654 12-13 23.680920230057513 22.2430607651913 26.39409852463116 27.68192048012003 14-15 23.268317079269817 25.906476619154787 25.23130782695674 25.593898474618655 16-17 25.018754688672168 24.58114528632158 23.55588897224306 26.84421105276319 18-19 24.318579644911228 26.006501625406354 24.318579644911228 25.35633908477119 20-21 24.8062015503876 24.656164041010253 24.23105776444111 26.30657664416104 22-23 24.593648412103025 24.456114028507127 24.893723430857715 26.056514128532132 24-25 24.20605151287822 24.943735933983497 24.3935983995999 26.456614153538382 26-27 23.85596399099775 24.99374843710928 24.956239059764943 26.19404851212803 28-29 24.831207801950487 24.543635908977244 24.5311327831958 26.094023505876468 30-31 24.281070267566893 25.23130782695674 24.656164041010253 25.831457864466117 32-33 25.09377344336084 25.23130782695674 24.981245311327832 24.69367341835459 34-35 25.78144536134033 24.36859214803701 24.493623405851466 25.35633908477119 36-37 24.10602650662666 25.6064016004001 24.681170292573142 25.6064016004001 38-39 25.256314078519633 24.456114028507127 24.568642160540136 25.71892973243311 40-41 26.019004751187797 25.10627656914228 23.55588897224306 25.318829707426854 42-43 25.143785946486624 24.5311327831958 24.593648412103025 25.731432858214554 44-45 25.006251562890725 25.656414103525883 23.74343585896474 25.593898474618655 46-47 23.93098274568642 24.831207801950487 25.218804701175294 26.019004751187797 48-49 24.468617154288573 24.781195298824706 24.18104526131533 26.569142285571395 50-51 24.656164041010253 25.456364091022753 23.80595148787197 26.081520380095025 52-53 23.63090772693173 25.79394848712178 24.88122030507627 25.693923480870218 54-55 24.01850462615654 25.168792198049513 25.831457864466117 24.981245311327832 56-57 24.23105776444111 24.831207801950487 25.006251562890725 25.93148287071768 58-59 25.006251562890725 24.20605151287822 25.28132033008252 25.506376594148538 60-61 24.76869217304326 24.681170292573142 25.03125781445361 25.51887971992998 62-63 25.55638909727432 24.20605151287822 24.843710927731934 25.393848462115532 64-65 25.44386096524131 24.36859214803701 24.706176544136035 25.481370342585645 66-67 23.905976494123532 25.30632658164541 24.93123280820205 25.85646411602901 68-69 25.668917229307326 25.168792198049513 24.193548387096776 24.968742185546386 70-71 24.8062015503876 25.98149537384346 23.768442110527634 25.44386096524131 72-73 24.76869217304326 25.618904726181547 24.143535883970994 25.468867216804203 74-75 24.059022133299987 25.146930098787045 24.546705014380393 26.24734275353258 76-77 25.11255627813907 25.475237618809405 24.399699849924964 25.012506253126567 78-79 24.712356178089045 25.237618809404704 23.349174587293646 26.700850425212607 80-81 25.012506253126567 25.57528764382191 24.074537268634316 25.337668834417208 82-83 24.637318659329665 25.65032516258129 23.974487243621812 25.737868934467233 84-85 25.437718859429715 24.474737368684345 24.637318659329665 25.45022511255628 86-87 24.312156078039017 25.087543771885944 24.974987493746873 25.625312656328163 88-89 25.387693846923458 24.64982491245623 24.949974987493746 25.012506253126567 90-91 25.350175087543768 25.22511255627814 23.56178089044522 25.86293146573287 92-93 25.200100050025014 24.387193596798397 24.599799899949975 25.812906453226613 94-95 24.77488744372186 24.562281140570285 24.79989994997499 25.86293146573287 96-97 24.55262169941184 24.039544487548493 24.852959579526967 26.554874233512706 98-99 25.841269841269842 23.606349206349204 24.85079365079365 25.701587301587303 100-101 26.53991200502828 10.826524198617223 30.405405405405407 32.22815839094909 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 2.0 1 1.5 2 0.5 3 0.5 4 1.0 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 1.0 22 0.5 23 1.0 24 1.5 25 1.5 26 3.0 27 4.0 28 3.5 29 7.0 30 10.5 31 12.5 32 16.5 33 17.0 34 24.0 35 33.0 36 43.0 37 67.5 38 73.5 39 82.5 40 107.5 41 131.5 42 149.5 43 162.0 44 175.0 45 183.5 46 191.0 47 180.0 48 164.0 49 149.0 50 141.5 51 135.0 52 129.0 53 130.5 54 125.0 55 114.0 56 109.5 57 101.0 58 89.0 59 80.0 60 74.0 61 71.5 62 68.5 63 61.0 64 53.5 65 50.0 66 56.0 67 59.5 68 59.0 69 55.0 70 51.5 71 46.5 72 29.0 73 25.5 74 22.5 75 15.0 76 11.5 77 11.5 78 10.0 79 5.0 80 2.0 81 2.0 82 2.0 83 2.5 84 2.5 85 1.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.025 3 0.025 4 0.025 5 0.025 6 0.025 7 0.025 8 0.025 9 0.025 10-11 0.025 12-13 0.025 14-15 0.025 16-17 0.025 18-19 0.025 20-21 0.025 22-23 0.025 24-25 0.025 26-27 0.025 28-29 0.025 30-31 0.025 32-33 0.025 34-35 0.025 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 34-35 1.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 1.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 1.0 96-97 28.0 98-99 324.0 100-101 3645.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.60000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 91.75764192139738 84.05 2 7.478165938864628 13.700000000000001 3 0.6550218340611353 1.7999999999999998 4 0.08187772925764192 0.3 5 0.0 0.0 6 0.02729257641921397 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTTACCAGGGCTTGACATGCCGCGAATCCTCTTGAAAGAGAGGGGTGCCC 6 0.15 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 396672 spots for SRR21853503.sra Written 396672 spots for SRR21853503.sra Read 396672 spots for SRR21853503.sra Written 396672 spots for SRR21853503.sra Read 396672 spots for SRR21853503.sra Written 396672 spots for SRR21853503.sra Read 396672 spots for SRR21853503.sra Written 396672 spots for SRR21853503.sra Read 396672 spots for SRR21853503.sra Written 396672 spots for SRR21853503.sra Read 396672 spots for SRR21853503.sra Written 396672 spots for SRR21853503.sra Read 396672 spots for SRR21853503.sra Written 396672 spots for SRR21853503.sra Read 396672 spots for SRR21853503.sra Written 396672 spots for SRR21853503.sra Read 396672 spots for SRR21853503.sra Written 396672 spots for SRR21853503.sra Read 396687 spots for SRR21853503.sra Written 396687 spots for SRR21853503.sra Read 396672 spots for SRR21853503.sra Written 396672 spots for SRR21853503.sra Read 396672 spots for SRR21853503.sra Written 396672 spots for SRR21853503.sra Read 396672 spots for SRR21853503.sra Written 396672 spots for SRR21853503.sra Read 396672 spots for SRR21853503.sra Written 396672 spots for SRR21853503.sra Read 396672 spots for SRR21853503.sra Written 396672 spots for SRR21853503.sra Read 396672 spots for SRR21853503.sra Written 396672 spots for SRR21853503.sra Read 396672 spots for SRR21853503.sra Written 396672 spots for SRR21853503.sra Read 396672 spots for SRR21853503.sra Written 396672 spots for SRR21853503.sra Read 396672 spots for SRR21853503.sra Written 396672 spots for SRR21853503.sra Read 396672 spots for SRR21853503.sra Written 396672 spots for SRR21853503.sra SRR ids: ['SRR21853503.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_9pjb_vf4 SRR21853503.sra spots: 7933455 blocks: [[1, 396672], [396673, 793344], [793345, 1190016], [1190017, 1586688], [1586689, 1983360], [1983361, 2380032], [2380033, 2776704], [2776705, 3173376], [3173377, 3570048], [3570049, 3966720], [3966721, 4363392], [4363393, 4760064], [4760065, 5156736], [5156737, 5553408], [5553409, 5950080], [5950081, 6346752], [6346753, 6743424], [6743425, 7140096], [7140097, 7536768], [7536769, 7933455]] SRR21853503 file size 2133042 SRR21853503 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR21853503 SRR21853503_1.fastq Input file: SRR21853503_1.fastq trimmed: SRR21853503-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Fri Dec 6 16:28:16 2024 >> started Fri Dec 6 16:28:21 2024 >> done (4.405s) 7933455 reads processed; of these: 2 ( 0.00%) short reads filtered out after trimming by size control 9366 ( 0.12%) empty reads filtered out after trimming by size control 7924087 (99.88%) reads available; of these: 261 ( 0.00%) trimmed reads available after processing 7923826 (100.00%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 21 2 0.00% 22 0 0.00% 23 0 0.00% 24 2 0.00% 25 0 0.00% 26 2 0.00% 27 1 0.00% 28 0 0.00% 29 1 0.00% 30 0 0.00% 31 3 0.00% 32 3 0.00% 33 6 0.00% 34 4 0.00% 35 16 0.00% 36 17 0.00% 37 18 0.00% 38 17 0.00% 39 11 0.00% 40 19 0.00% 41 21 0.00% 42 17 0.00% 43 24 0.00% 44 18 0.00% 45 13 0.00% 46 21 0.00% 47 20 0.00% 48 19 0.00% 49 22 0.00% 50 16 0.00% 51 17 0.00% 52 17 0.00% 53 22 0.00% 54 21 0.00% 55 17 0.00% 56 20 0.00% 57 20 0.00% 58 20 0.00% 59 23 0.00% 60 26 0.00% 61 30 0.00% 62 30 0.00% 63 39 0.00% 64 31 0.00% 65 36 0.00% 66 29 0.00% 67 21 0.00% 68 31 0.00% 69 35 0.00% 70 29 0.00% 71 30 0.00% 72 27 0.00% 73 35 0.00% 74 40 0.00% 75 40 0.00% 76 28 0.00% 77 48 0.00% 78 38 0.00% 79 47 0.00% 80 37 0.00% 81 42 0.00% 82 49 0.00% 83 61 0.00% 84 53 0.00% 85 74 0.00% 86 52 0.00% 87 83 0.00% 88 88 0.00% 89 90 0.00% 90 137 0.00% 91 482 0.01% 92 155 0.00% 93 211 0.00% 94 423 0.01% 95 1620 0.02% 96 9884 0.12% 97 37566 0.47% 98 142343 1.80% 99 530745 6.70% 100 1813324 22.88% 101 5385408 67.96% 7924087 reads passed initial QC criterion=sequence-density sequence-density=0.30 sequence-density-rank=1 fanout-score=2.44 fanout-score-rank=17 prefix-density=0.33 prefix-fanout=2.2 sequence=GGTGGTGCATGGC criterion=fanout-score sequence-density=0.01 sequence-density-rank=37 fanout-score=34.42 fanout-score-rank=1 prefix-density=0.04 prefix-fanout=4.2 sequence=ACCAAGGAGTCTGACATGCGTGCGAGTCGACGGGTTCTGAAACCTGGGATGCGCAAGGAAGCTGACGAGCGGGAGGCCCTCACGGGCCGCACCGCTGGCCGACCCTGATCTTCTGTGAAGGGTTCGAGTTGGAGCACGCCTGTCGGGACCCGAAAGATGGTGAACTATGCCTGAGCGGGGCGAAGCCAGAGGAA Started job on | Dec 06 16:28:38 Started mapping on | Dec 06 16:28:38 Finished on | Dec 06 16:28:50 Mapping speed, Million of reads per hour | 2377.23 Number of input reads | 7924087 Average input read length | 100 UNIQUE READS: Uniquely mapped reads number | 6847932 Uniquely mapped reads % | 86.42% Average mapped length | 100.24 Number of splices: Total | 2366130 Number of splices: Annotated (sjdb) | 2233944 Number of splices: GT/AG | 2330750 Number of splices: GC/AG | 30359 Number of splices: AT/AC | 1243 Number of splices: Non-canonical | 3778 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.01% Deletion average length | 2.25 Insertion rate per base | 0.01% Insertion average length | 2.03 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 479853 % of reads mapped to multiple loci | 6.06% Number of reads mapped to too many loci | 440028 % of reads mapped to too many loci | 5.55% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.19% % of reads unmapped: other | 0.79% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 596302 596302 596302 N_multimapping 479853 479853 479853 N_noFeature 364778 3567331 3555149 N_ambiguous 105112 7661 7841 UnstrandedReadsAssigned:6378042 PositiveStrandReadsAssigned:3272940 NegativeStrandReadsAssigned:3284942 Dataset is classified unstranded MeadianReadLen=101 20thPercentileLength=100 echo kmer=95 SRR21853503 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR21853503-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 7,924,087 reads, 6,668,520 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,146 rounds 52973 SRR21853503.ke.tsv 35125 SRR21853503.se.tsv 88098 total ==> SRR21853503.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 0.00506371 0.00159004 PNS24247 1044 945 40.9488 11.3887 PNS24249 1928 1829 91.6158 13.165 PNS24246 1044 945 40.9488 11.3887 PNS24248 1044 945 40.9488 11.3887 PNS24244 1471 1372 8.53265 1.63454 PNS24243 293 194 4 5.41906 KQK14069 1603 1504 4718.23 824.511 KQK14071 474 375 672.503 471.334 ==> SRR21853503.se.tsv <== BRADI_1g14170v3 5963 BRADI_1g53295v3 61 BRADI_1g59795v3 159 BRADI_1g07683v3 0 BRADI_1g00485v3 20 BRADI_1g20270v3 427 BRADI_1g74790v3 86 BRADI_1g09890v3 2 BRADI_1g77505v3 104 BRADI_1g48960v3 0 SRR21853503 completed mapping pipeline successfully