Starting /dee2/code/volunteer_pipeline.sh SRR21853504 current disk space = 1550609207296 free memory = 1297858576 SRR21853504 SRAfilesize f1d9fb52cd78ff0dae43ddde0dd02d60 SRR21853504.sra SRR21853504.sra file validated SRR21853504 is single end SRR21853504 is conventional basespace SRR21853504 read1 length is 62-101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR21853504_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 62-101 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.0075 37.0 37.0 37.0 25.0 37.0 2 34.787 37.0 37.0 37.0 25.0 37.0 3 35.3755 37.0 37.0 37.0 37.0 37.0 4 35.584 37.0 37.0 37.0 37.0 37.0 5 35.698 37.0 37.0 37.0 37.0 37.0 6 35.7525 37.0 37.0 37.0 37.0 37.0 7 35.523 37.0 37.0 37.0 37.0 37.0 8 35.8025 37.0 37.0 37.0 37.0 37.0 9 35.7185 37.0 37.0 37.0 37.0 37.0 10-11 35.68425 37.0 37.0 37.0 37.0 37.0 12-13 35.637 37.0 37.0 37.0 37.0 37.0 14-15 35.724000000000004 37.0 37.0 37.0 37.0 37.0 16-17 35.686 37.0 37.0 37.0 37.0 37.0 18-19 35.72425 37.0 37.0 37.0 37.0 37.0 20-21 35.67475 37.0 37.0 37.0 37.0 37.0 22-23 35.61875 37.0 37.0 37.0 37.0 37.0 24-25 35.520250000000004 37.0 37.0 37.0 37.0 37.0 26-27 35.55200000000001 37.0 37.0 37.0 37.0 37.0 28-29 35.5265 37.0 37.0 37.0 37.0 37.0 30-31 35.428 37.0 37.0 37.0 37.0 37.0 32-33 35.50425 37.0 37.0 37.0 37.0 37.0 34-35 35.460750000000004 37.0 37.0 37.0 37.0 37.0 36-37 35.423249999999996 37.0 37.0 37.0 37.0 37.0 38-39 35.322 37.0 37.0 37.0 31.0 37.0 40-41 35.31975 37.0 37.0 37.0 37.0 37.0 42-43 35.375 37.0 37.0 37.0 37.0 37.0 44-45 35.352999999999994 37.0 37.0 37.0 37.0 37.0 46-47 35.329750000000004 37.0 37.0 37.0 37.0 37.0 48-49 35.43075 37.0 37.0 37.0 37.0 37.0 50-51 35.351 37.0 37.0 37.0 37.0 37.0 52-53 35.42775 37.0 37.0 37.0 37.0 37.0 54-55 35.39375 37.0 37.0 37.0 31.0 37.0 56-57 35.38125 37.0 37.0 37.0 37.0 37.0 58-59 35.3805 37.0 37.0 37.0 37.0 37.0 60-61 35.2915 37.0 37.0 37.0 37.0 37.0 62-63 35.31054238559639 37.0 37.0 37.0 37.0 37.0 64-65 35.3953488372093 37.0 37.0 37.0 37.0 37.0 66-67 35.17857278226511 37.0 37.0 37.0 25.0 37.0 68-69 35.22986493246623 37.0 37.0 37.0 31.0 37.0 70-71 35.17383691845923 37.0 37.0 37.0 25.0 37.0 72-73 35.26563281640821 37.0 37.0 37.0 31.0 37.0 74-75 35.18434217108555 37.0 37.0 37.0 25.0 37.0 76-77 35.15782891445723 37.0 37.0 37.0 31.0 37.0 78-79 35.223167375531645 37.0 37.0 37.0 31.0 37.0 80-81 35.32749562171628 37.0 37.0 37.0 37.0 37.0 82-83 35.069802351763826 37.0 37.0 37.0 25.0 37.0 84-85 35.08056042031524 37.0 37.0 37.0 25.0 37.0 86-87 35.148111083312486 37.0 37.0 37.0 25.0 37.0 88-89 35.25744308231173 37.0 37.0 37.0 31.0 37.0 90-91 35.17917917917918 37.0 37.0 37.0 25.0 37.0 92-93 35.10985985985986 37.0 37.0 37.0 25.0 37.0 94-95 35.105605605605604 37.0 37.0 37.0 25.0 37.0 96-97 35.086127318552144 37.0 37.0 37.0 25.0 37.0 98-99 35.08429582129577 37.0 37.0 37.0 25.0 37.0 100-101 35.04376153855509 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100-101 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 1.0 21 1.0 22 2.0 23 6.0 24 5.0 25 14.0 26 12.0 27 36.0 28 29.0 29 72.0 30 53.0 31 122.0 32 163.0 33 196.0 34 309.0 35 591.0 36 2043.0 37 345.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 29.275000000000002 12.825000000000001 18.525 39.375 2 25.696908261530666 20.349721236695387 30.68930562595033 23.26406487582362 3 26.950000000000003 24.2 23.225 25.624999999999996 4 27.800000000000004 29.025000000000002 19.625 23.549999999999997 5 27.275 29.225 22.05 21.45 6 22.625 32.05 22.2 23.125 7 19.75 16.125 39.85 24.275 8 22.325 22.7 25.55 29.425 9 22.225 22.5 26.950000000000003 28.325 10-11 25.424999999999997 28.487499999999997 20.3 25.7875 12-13 23.3125 22.3375 26.625 27.725 14-15 24.625 23.7125 26.087500000000002 25.575 16-17 23.974999999999998 24.5 25.6125 25.912499999999998 18-19 25.025 24.775 24.075 26.125 20-21 23.75 24.8 24.975 26.474999999999998 22-23 24.4125 25.124999999999996 24.4125 26.05 24-25 24.7 24.575 24.425 26.3 26-27 24.65 25.1875 24.0 26.1625 28-29 24.762500000000003 24.7 24.7375 25.8 30-31 24.525 24.65 24.975 25.85 32-33 25.162499999999998 24.4875 25.087500000000002 25.2625 34-35 24.462500000000002 24.4875 25.2375 25.8125 36-37 24.775 24.8 24.95 25.474999999999998 38-39 25.275 24.762500000000003 24.5 25.4625 40-41 24.925 25.55 23.962500000000002 25.5625 42-43 24.725 24.6 24.9125 25.7625 44-45 24.962500000000002 24.3 24.4375 26.3 46-47 25.05 24.2625 24.525 26.1625 48-49 24.3625 25.412499999999998 23.9 26.325 50-51 24.425 24.125 25.3125 26.137500000000003 52-53 25.525 24.4 24.1375 25.937500000000004 54-55 25.362499999999997 24.875 24.7875 24.975 56-57 25.4625 25.2875 24.15 25.1 58-59 25.112499999999997 24.975 23.6375 26.275 60-61 25.087500000000002 24.575 24.462500000000002 25.874999999999996 62-63 25.203150393799223 25.028128516064506 24.253031628953618 25.51568946118265 64-65 24.643660915228807 24.99374843710928 23.818454613653415 26.544136034008503 66-67 25.109416031011627 24.896836313617605 24.371639364761783 25.62210829060898 68-69 25.012506253126567 25.07503751875938 23.649324662331164 26.263131565782892 70-71 24.88744372186093 24.73736868434217 24.374687343671837 26.000500250125064 72-73 24.79989994997499 24.79989994997499 24.112056028014006 26.28814407203602 74-75 25.737868934467233 23.836918459229615 24.312156078039017 26.113056528264135 76-77 25.76288144072036 24.987493746873437 24.012006003001503 25.237618809404704 78-79 25.794345759319487 24.706029522141606 23.405053790342755 26.09457092819615 80-81 25.65674255691769 24.668501376032022 23.792844633475106 25.881911433575183 82-83 24.78108581436077 24.655991993995496 25.04378283712785 25.519139354515886 84-85 25.181386039529645 24.54340755566675 24.655991993995496 25.619214410808105 86-87 25.369026770077557 23.967975981986488 25.068801601200903 25.594195646735052 88-89 25.39404553415061 24.330748061045785 25.156367275456592 25.11883912934701 90-91 25.538038038038035 23.998998998999 24.8998998998999 25.563063063063062 92-93 25.863363363363362 24.436936936936938 24.324324324324326 25.375375375375377 94-95 25.513013013013015 24.06156156156156 24.21171171171171 26.213713713713716 96-97 24.336504757135703 25.150225338007008 25.187781672508763 25.325488232348526 98-99 25.2701156730647 22.943943053260455 25.3336723020211 26.45226897165374 100-101 27.694016822726553 10.776067290906205 30.344389779400093 31.18552610696715 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.5 24 1.0 25 1.0 26 1.0 27 3.0 28 5.5 29 7.5 30 8.5 31 9.5 32 13.0 33 18.0 34 26.5 35 38.0 36 52.0 37 66.5 38 75.0 39 86.5 40 100.5 41 116.5 42 136.0 43 147.5 44 168.0 45 190.5 46 189.0 47 183.5 48 170.5 49 144.5 50 144.0 51 143.5 52 138.0 53 134.5 54 117.0 55 118.0 56 112.0 57 98.5 58 91.0 59 86.0 60 83.5 61 73.0 62 62.5 63 57.0 64 59.5 65 69.0 66 63.5 67 49.5 68 46.0 69 39.0 70 37.5 71 36.5 72 33.0 73 32.5 74 30.0 75 25.0 76 18.5 77 14.0 78 13.0 79 10.5 80 4.5 81 0.5 82 1.0 83 1.5 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 1.35 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 62 1.0 63 0.0 64 0.0 65 0.0 66 1.0 67 0.0 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 1.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 1.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 1.0 96 2.0 97 22.0 98 75.0 99 274.0 100 943.0 101 2679.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.35 #Duplication Level Percentage of deduplicated Percentage of total 1 93.2244242099625 87.02499999999999 2 6.480985538296732 12.1 3 0.2678093197643278 0.75 4 0.0 0.0 5 0.02678093197643278 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACTCTCGCGCATCGCGTAT 5 0.125 TruSeq Adapter, Index 8 (97% over 36bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 812714 spots for SRR21853504.sra Written 812714 spots for SRR21853504.sra Read 812714 spots for SRR21853504.sra Written 812714 spots for SRR21853504.sra Read 812714 spots for SRR21853504.sra Written 812714 spots for SRR21853504.sra Read 812714 spots for SRR21853504.sra Written 812714 spots for SRR21853504.sra Read 812714 spots for SRR21853504.sra Written 812714 spots for SRR21853504.sra Read 812714 spots for SRR21853504.sra Written 812714 spots for SRR21853504.sra Read 812714 spots for SRR21853504.sra Written 812714 spots for SRR21853504.sra Read 812714 spots for SRR21853504.sra Written 812714 spots for SRR21853504.sra Read 812714 spots for SRR21853504.sra Written 812714 spots for SRR21853504.sra Read 812714 spots for SRR21853504.sra Written 812714 spots for SRR21853504.sra Read 812714 spots for SRR21853504.sra Written 812714 spots for SRR21853504.sra Read 812714 spots for SRR21853504.sra Written 812714 spots for SRR21853504.sra Read 812714 spots for SRR21853504.sra Written 812714 spots for SRR21853504.sra Read 812728 spots for SRR21853504.sra Written 812728 spots for SRR21853504.sra Read 812714 spots for SRR21853504.sra Written 812714 spots for SRR21853504.sra Read 812714 spots for SRR21853504.sra Written 812714 spots for SRR21853504.sra Read 812714 spots for SRR21853504.sra Written 812714 spots for SRR21853504.sra Read 812714 spots for SRR21853504.sra Written 812714 spots for SRR21853504.sra Read 812714 spots for SRR21853504.sra Written 812714 spots for SRR21853504.sra Read 812714 spots for SRR21853504.sra Written 812714 spots for SRR21853504.sra SRR ids: ['SRR21853504.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_3h5mxl38 SRR21853504.sra spots: 16254294 blocks: [[1, 812714], [812715, 1625428], [1625429, 2438142], [2438143, 3250856], [3250857, 4063570], [4063571, 4876284], [4876285, 5688998], [5688999, 6501712], [6501713, 7314426], [7314427, 8127140], [8127141, 8939854], [8939855, 9752568], [9752569, 10565282], [10565283, 11377996], [11377997, 12190710], [12190711, 13003424], [13003425, 13816138], [13816139, 14628852], [14628853, 15441566], [15441567, 16254294]] SRR21853504 file size 4377072 SRR21853504 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR21853504 SRR21853504_1.fastq Input file: SRR21853504_1.fastq trimmed: SRR21853504-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Fri Dec 6 16:29:43 2024 >> started Fri Dec 6 16:29:52 2024 >> done (8.925s) 16254294 reads processed; of these: 16 ( 0.00%) short reads filtered out after trimming by size control 29907 ( 0.18%) empty reads filtered out after trimming by size control 16224371 (99.82%) reads available; of these: 390 ( 0.00%) trimmed reads available after processing 16223981 (100.00%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 1 0.00% 20 1 0.00% 21 1 0.00% 22 1 0.00% 23 4 0.00% 24 3 0.00% 25 3 0.00% 26 5 0.00% 27 3 0.00% 28 5 0.00% 29 4 0.00% 30 3 0.00% 31 7 0.00% 32 7 0.00% 33 4 0.00% 34 4 0.00% 35 72 0.00% 36 83 0.00% 37 69 0.00% 38 61 0.00% 39 73 0.00% 40 83 0.00% 41 69 0.00% 42 57 0.00% 43 70 0.00% 44 64 0.00% 45 83 0.00% 46 75 0.00% 47 81 0.00% 48 75 0.00% 49 78 0.00% 50 84 0.00% 51 112 0.00% 52 97 0.00% 53 114 0.00% 54 113 0.00% 55 108 0.00% 56 115 0.00% 57 118 0.00% 58 128 0.00% 59 105 0.00% 60 105 0.00% 61 135 0.00% 62 125 0.00% 63 122 0.00% 64 140 0.00% 65 120 0.00% 66 142 0.00% 67 133 0.00% 68 144 0.00% 69 144 0.00% 70 144 0.00% 71 141 0.00% 72 154 0.00% 73 155 0.00% 74 163 0.00% 75 159 0.00% 76 159 0.00% 77 185 0.00% 78 195 0.00% 79 227 0.00% 80 178 0.00% 81 226 0.00% 82 222 0.00% 83 213 0.00% 84 210 0.00% 85 255 0.00% 86 263 0.00% 87 236 0.00% 88 302 0.00% 89 304 0.00% 90 403 0.00% 91 1201 0.01% 92 465 0.00% 93 619 0.00% 94 1127 0.01% 95 3648 0.02% 96 20744 0.13% 97 76665 0.47% 98 294232 1.81% 99 1091337 6.73% 100 3720857 22.93% 101 11005427 67.83% 16224371 reads passed initial QC criterion=sequence-density sequence-density=0.30 sequence-density-rank=1 fanout-score=2.35 fanout-score-rank=15 prefix-density=0.32 prefix-fanout=2.2 sequence=GGTGGTGCATGGC criterion=fanout-score sequence-density=0.04 sequence-density-rank=28 fanout-score=10.89 fanout-score-rank=1 prefix-density=0.15 prefix-fanout=2.9 sequence=ATCAGTGAGCTGCTGTTTAGGCCTTGCCGGACTCCTC Started job on | Dec 06 16:30:22 Started mapping on | Dec 06 16:30:22 Finished on | Dec 06 16:30:45 Mapping speed, Million of reads per hour | 2539.47 Number of input reads | 16224371 Average input read length | 100 UNIQUE READS: Uniquely mapped reads number | 14004625 Uniquely mapped reads % | 86.32% Average mapped length | 100.21 Number of splices: Total | 4873987 Number of splices: Annotated (sjdb) | 4602534 Number of splices: GT/AG | 4799912 Number of splices: GC/AG | 63031 Number of splices: AT/AC | 2669 Number of splices: Non-canonical | 8375 Mismatch rate per base, % | 0.42% Deletion rate per base | 0.01% Deletion average length | 2.27 Insertion rate per base | 0.01% Insertion average length | 2.04 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 982976 % of reads mapped to multiple loci | 6.06% Number of reads mapped to too many loci | 881966 % of reads mapped to too many loci | 5.44% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.40% % of reads unmapped: other | 0.78% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1236770 1236770 1236770 N_multimapping 982976 982976 982976 N_noFeature 742676 7274414 7287399 N_ambiguous 216162 15618 16351 UnstrandedReadsAssigned:13045787 PositiveStrandReadsAssigned:6714593 NegativeStrandReadsAssigned:6700875 Dataset is classified unstranded MeadianReadLen=101 20thPercentileLength=100 echo kmer=95 SRR21853504 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR21853504-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,224,371 reads, 13,630,228 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,208 rounds 52973 SRR21853504.ke.tsv 35125 SRR21853504.se.tsv 88098 total ==> SRR21853504.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 0 0 PNS24247 1044 945 69.1287 9.35285 PNS24249 1928 1829 193.301 13.5126 PNS24246 1044 945 69.1287 9.35285 PNS24248 1044 945 69.1287 9.35285 PNS24244 1471 1372 30.3129 2.82482 PNS24243 293 194 5 3.29523 KQK14069 1603 1504 9714.96 825.868 KQK14071 474 375 1445.52 492.845 ==> SRR21853504.se.tsv <== BRADI_1g14170v3 12323 BRADI_1g53295v3 119 BRADI_1g59795v3 294 BRADI_1g07683v3 0 BRADI_1g00485v3 63 BRADI_1g20270v3 911 BRADI_1g74790v3 160 BRADI_1g09890v3 1 BRADI_1g77505v3 223 BRADI_1g48960v3 0 SRR21853504 completed mapping pipeline successfully