Starting /dee2/code/volunteer_pipeline.sh SRR21853505 current disk space = 1550591037440 free memory = 1598929232 SRR21853505 SRAfilesize f49b929cd1622f87cd71abdd3d83d412 SRR21853505.sra SRR21853505.sra file validated SRR21853505 is single end SRR21853505 is conventional basespace SRR21853505 read1 length is 91-101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR21853505_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 91-101 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 34.88 37.0 37.0 37.0 25.0 37.0 2 34.76825 37.0 37.0 37.0 25.0 37.0 3 35.3 37.0 37.0 37.0 37.0 37.0 4 35.4515 37.0 37.0 37.0 37.0 37.0 5 35.635 37.0 37.0 37.0 37.0 37.0 6 35.7555 37.0 37.0 37.0 37.0 37.0 7 35.4635 37.0 37.0 37.0 37.0 37.0 8 35.6865 37.0 37.0 37.0 37.0 37.0 9 35.78 37.0 37.0 37.0 37.0 37.0 10-11 35.66675 37.0 37.0 37.0 37.0 37.0 12-13 35.788250000000005 37.0 37.0 37.0 37.0 37.0 14-15 35.78775 37.0 37.0 37.0 37.0 37.0 16-17 35.872 37.0 37.0 37.0 37.0 37.0 18-19 35.672 37.0 37.0 37.0 37.0 37.0 20-21 35.709999999999994 37.0 37.0 37.0 37.0 37.0 22-23 35.7295 37.0 37.0 37.0 37.0 37.0 24-25 35.60825 37.0 37.0 37.0 37.0 37.0 26-27 35.5775 37.0 37.0 37.0 37.0 37.0 28-29 35.52775 37.0 37.0 37.0 37.0 37.0 30-31 35.542249999999996 37.0 37.0 37.0 37.0 37.0 32-33 35.5295 37.0 37.0 37.0 37.0 37.0 34-35 35.42775 37.0 37.0 37.0 37.0 37.0 36-37 35.44525 37.0 37.0 37.0 37.0 37.0 38-39 35.34475 37.0 37.0 37.0 37.0 37.0 40-41 35.50375 37.0 37.0 37.0 37.0 37.0 42-43 35.45725 37.0 37.0 37.0 37.0 37.0 44-45 35.44725 37.0 37.0 37.0 37.0 37.0 46-47 35.305 37.0 37.0 37.0 31.0 37.0 48-49 35.3995 37.0 37.0 37.0 37.0 37.0 50-51 35.4355 37.0 37.0 37.0 37.0 37.0 52-53 35.46775 37.0 37.0 37.0 37.0 37.0 54-55 35.303 37.0 37.0 37.0 31.0 37.0 56-57 35.3805 37.0 37.0 37.0 37.0 37.0 58-59 35.31225 37.0 37.0 37.0 37.0 37.0 60-61 35.33 37.0 37.0 37.0 31.0 37.0 62-63 35.288250000000005 37.0 37.0 37.0 31.0 37.0 64-65 35.37475 37.0 37.0 37.0 37.0 37.0 66-67 35.1435 37.0 37.0 37.0 25.0 37.0 68-69 35.116249999999994 37.0 37.0 37.0 25.0 37.0 70-71 35.242999999999995 37.0 37.0 37.0 25.0 37.0 72-73 35.25975 37.0 37.0 37.0 31.0 37.0 74-75 35.27725 37.0 37.0 37.0 31.0 37.0 76-77 35.15025 37.0 37.0 37.0 25.0 37.0 78-79 35.164249999999996 37.0 37.0 37.0 31.0 37.0 80-81 35.20525 37.0 37.0 37.0 25.0 37.0 82-83 35.260000000000005 37.0 37.0 37.0 31.0 37.0 84-85 35.1015 37.0 37.0 37.0 25.0 37.0 86-87 35.255250000000004 37.0 37.0 37.0 31.0 37.0 88-89 35.193 37.0 37.0 37.0 25.0 37.0 90-91 35.08325 37.0 37.0 37.0 25.0 37.0 92-93 34.97498749374687 37.0 37.0 37.0 25.0 37.0 94-95 35.06128064032016 37.0 37.0 37.0 25.0 37.0 96-97 34.99397370192357 37.0 37.0 37.0 25.0 37.0 98-99 35.06264974731472 37.0 37.0 37.0 25.0 37.0 100-101 35.05809991761081 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100-101 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 1.0 22 0.0 23 2.0 24 5.0 25 13.0 26 15.0 27 24.0 28 45.0 29 69.0 30 86.0 31 111.0 32 153.0 33 185.0 34 284.0 35 610.0 36 2041.0 37 356.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 27.825 13.175 17.25 41.75 2 25.80563308804872 19.893428063943162 30.652118751585895 23.648820096422227 3 27.05 22.775000000000002 22.725 27.450000000000003 4 27.325 29.75 18.3 24.625 5 25.674999999999997 31.275 21.8 21.25 6 22.55 31.900000000000002 21.2 24.349999999999998 7 19.925 16.375 38.3 25.4 8 22.650000000000002 21.075 25.324999999999996 30.95 9 22.225 21.55 27.500000000000004 28.725 10-11 26.55 26.987499999999997 20.175 26.2875 12-13 24.025 21.349999999999998 27.237499999999997 27.3875 14-15 24.675 24.099999999999998 25.0375 26.187500000000004 16-17 25.724999999999998 24.5375 23.0375 26.700000000000003 18-19 24.7 23.775 25.025 26.5 20-21 25.3 24.525 24.962500000000002 25.2125 22-23 25.35 24.375 23.75 26.525 24-25 24.887500000000003 24.637500000000003 23.9 26.575 26-27 25.3 24.1875 23.925 26.5875 28-29 24.85 24.775 24.55 25.825 30-31 24.375 24.525 25.162499999999998 25.937500000000004 32-33 24.6125 24.325 25.0 26.0625 34-35 23.8375 24.425 24.349999999999998 27.3875 36-37 24.2875 24.75 24.8125 26.150000000000002 38-39 25.5625 24.6875 23.575 26.174999999999997 40-41 25.2625 25.424999999999997 24.125 25.1875 42-43 24.85 25.5125 24.2375 25.4 44-45 24.4125 24.075 24.3 27.212500000000002 46-47 24.75 25.374999999999996 23.6375 26.237500000000004 48-49 24.95 24.2 24.6875 26.1625 50-51 25.2625 24.349999999999998 24.075 26.3125 52-53 24.7875 24.1625 24.6625 26.387500000000003 54-55 24.337500000000002 24.45 25.1 26.1125 56-57 25.25 24.65 23.9125 26.187500000000004 58-59 24.925 25.424999999999997 24.325 25.324999999999996 60-61 24.9875 24.15 25.137500000000003 25.724999999999998 62-63 25.95 24.637500000000003 23.65 25.7625 64-65 24.95 24.425 24.525 26.1 66-67 25.662499999999998 24.125 23.9125 26.3 68-69 24.6625 25.4875 23.5875 26.2625 70-71 24.45 25.1875 23.775 26.5875 72-73 24.5625 24.55 25.0375 25.85 74-75 25.837500000000002 24.65 23.275000000000002 26.237500000000004 76-77 25.7375 24.4875 24.625 25.15 78-79 24.725 25.5625 23.3875 26.325 80-81 24.625 26.025 23.0375 26.3125 82-83 25.8625 24.875 23.8375 25.424999999999997 84-85 25.974999999999998 24.087500000000002 23.974999999999998 25.9625 86-87 25.4625 24.425 23.6625 26.450000000000003 88-89 25.7625 24.762500000000003 23.849999999999998 25.624999999999996 90-91 25.637500000000003 24.7 24.087500000000002 25.575 92-93 25.48774387193597 24.88744372186093 23.88694347173587 25.737868934467233 94-95 25.45022511255628 24.362181090545274 24.23711855927964 25.950475237618807 96-97 25.012512512512515 23.573573573573572 24.78728728728729 26.626626626626624 98-99 25.05053057099545 23.47145022738757 25.101061141990904 26.37695805962607 100-101 26.95761777217583 10.319836143059714 30.691665353710412 32.03088073105404 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.5 3 0.5 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 1.5 24 2.0 25 3.0 26 3.5 27 3.0 28 6.0 29 6.0 30 7.5 31 10.5 32 11.0 33 18.5 34 21.0 35 24.0 36 36.0 37 53.5 38 65.0 39 78.5 40 101.0 41 121.0 42 153.5 43 171.0 44 182.5 45 188.5 46 175.5 47 167.0 48 155.5 49 158.5 50 154.0 51 139.5 52 124.0 53 110.5 54 101.0 55 96.0 56 109.0 57 110.5 58 104.0 59 91.0 60 74.0 61 74.0 62 78.0 63 65.5 64 57.0 65 66.5 66 65.5 67 61.0 68 59.0 69 56.5 70 52.5 71 44.0 72 38.5 73 38.5 74 31.5 75 17.0 76 12.0 77 10.5 78 8.0 79 7.5 80 8.0 81 5.0 82 1.5 83 0.5 84 0.5 85 0.0 86 0.0 87 0.0 88 0.5 89 0.5 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 1.4749999999999999 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 91 2.0 92 0.0 93 0.0 94 0.0 95 0.0 96 4.0 97 11.0 98 50.0 99 285.0 100 949.0 101 2699.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.15 #Duplication Level Percentage of deduplicated Percentage of total 1 93.12936124530327 86.75 2 6.4143853998926454 11.95 3 0.4294149221685454 1.2 4 0.026838432635534086 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 893152 spots for SRR21853505.sra Written 893152 spots for SRR21853505.sra Read 893152 spots for SRR21853505.sra Written 893152 spots for SRR21853505.sra Read 893152 spots for SRR21853505.sra Written 893152 spots for SRR21853505.sra Read 893152 spots for SRR21853505.sra Written 893152 spots for SRR21853505.sra Read 893167 spots for SRR21853505.sra Written 893167 spots for SRR21853505.sra Read 893152 spots for SRR21853505.sra Written 893152 spots for SRR21853505.sra Read 893152 spots for SRR21853505.sra Written 893152 spots for SRR21853505.sra Read 893152 spots for SRR21853505.sra Written 893152 spots for SRR21853505.sra Read 893152 spots for SRR21853505.sra Written 893152 spots for SRR21853505.sra Read 893152 spots for SRR21853505.sra Written 893152 spots for SRR21853505.sra Read 893152 spots for SRR21853505.sra Written 893152 spots for SRR21853505.sra Read 893152 spots for SRR21853505.sra Written 893152 spots for SRR21853505.sra Read 893152 spots for SRR21853505.sra Written 893152 spots for SRR21853505.sra Read 893152 spots for SRR21853505.sra Written 893152 spots for SRR21853505.sra Read 893152 spots for SRR21853505.sra Written 893152 spots for SRR21853505.sra Read 893152 spots for SRR21853505.sra Written 893152 spots for SRR21853505.sra Read 893152 spots for SRR21853505.sra Written 893152 spots for SRR21853505.sra Read 893152 spots for SRR21853505.sra Written 893152 spots for SRR21853505.sra Read 893152 spots for SRR21853505.sra Written 893152 spots for SRR21853505.sra Read 893152 spots for SRR21853505.sra Written 893152 spots for SRR21853505.sra SRR ids: ['SRR21853505.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_zgx2uucn SRR21853505.sra spots: 17863055 blocks: [[1, 893152], [893153, 1786304], [1786305, 2679456], [2679457, 3572608], [3572609, 4465760], [4465761, 5358912], [5358913, 6252064], [6252065, 7145216], [7145217, 8038368], [8038369, 8931520], [8931521, 9824672], [9824673, 10717824], [10717825, 11610976], [11610977, 12504128], [12504129, 13397280], [13397281, 14290432], [14290433, 15183584], [15183585, 16076736], [16076737, 16969888], [16969889, 17863055]] SRR21853505 file size 4811260 SRR21853505 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR21853505 SRR21853505_1.fastq Input file: SRR21853505_1.fastq trimmed: SRR21853505-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Fri Dec 6 16:31:05 2024 >> started Fri Dec 6 16:31:14 2024 >> done (9.012s) 17863055 reads processed; of these: 21 ( 0.00%) short reads filtered out after trimming by size control 29713 ( 0.17%) empty reads filtered out after trimming by size control 17833321 (99.83%) reads available; of these: 383 ( 0.00%) trimmed reads available after processing 17832938 (100.00%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 1 0.00% 20 1 0.00% 21 2 0.00% 22 5 0.00% 23 4 0.00% 24 6 0.00% 25 5 0.00% 26 2 0.00% 27 3 0.00% 28 4 0.00% 29 7 0.00% 30 5 0.00% 31 3 0.00% 32 4 0.00% 33 4 0.00% 34 4 0.00% 35 76 0.00% 36 88 0.00% 37 107 0.00% 38 108 0.00% 39 81 0.00% 40 107 0.00% 41 103 0.00% 42 102 0.00% 43 88 0.00% 44 110 0.00% 45 106 0.00% 46 116 0.00% 47 109 0.00% 48 107 0.00% 49 101 0.00% 50 133 0.00% 51 116 0.00% 52 139 0.00% 53 124 0.00% 54 126 0.00% 55 122 0.00% 56 122 0.00% 57 146 0.00% 58 171 0.00% 59 156 0.00% 60 155 0.00% 61 202 0.00% 62 161 0.00% 63 161 0.00% 64 193 0.00% 65 168 0.00% 66 179 0.00% 67 191 0.00% 68 205 0.00% 69 181 0.00% 70 219 0.00% 71 217 0.00% 72 190 0.00% 73 183 0.00% 74 220 0.00% 75 228 0.00% 76 253 0.00% 77 266 0.00% 78 234 0.00% 79 269 0.00% 80 301 0.00% 81 328 0.00% 82 307 0.00% 83 355 0.00% 84 361 0.00% 85 386 0.00% 86 390 0.00% 87 417 0.00% 88 458 0.00% 89 520 0.00% 90 595 0.00% 91 1349 0.01% 92 646 0.00% 93 741 0.00% 94 1374 0.01% 95 4502 0.03% 96 23651 0.13% 97 84005 0.47% 98 324009 1.82% 99 1196935 6.71% 100 4052630 22.73% 101 12132059 68.03% 17833321 reads passed initial QC criterion=sequence-density sequence-density=0.14 sequence-density-rank=1 fanout-score=2.16 fanout-score-rank=21 prefix-density=0.16 prefix-fanout=1.9 sequence=GCTCCTTTCCAGGG criterion=fanout-score sequence-density=0.09 sequence-density-rank=14 fanout-score=211.86 fanout-score-rank=1 prefix-density=0.76 prefix-fanout=24.1 sequence=CGCCGCCGCCGC Started job on | Dec 06 16:31:29 Started mapping on | Dec 06 16:31:30 Finished on | Dec 06 16:31:56 Mapping speed, Million of reads per hour | 2469.23 Number of input reads | 17833321 Average input read length | 100 UNIQUE READS: Uniquely mapped reads number | 16281112 Uniquely mapped reads % | 91.30% Average mapped length | 100.20 Number of splices: Total | 5595910 Number of splices: Annotated (sjdb) | 5285915 Number of splices: GT/AG | 5510093 Number of splices: GC/AG | 72460 Number of splices: AT/AC | 3067 Number of splices: Non-canonical | 10290 Mismatch rate per base, % | 0.39% Deletion rate per base | 0.01% Deletion average length | 2.32 Insertion rate per base | 0.01% Insertion average length | 2.02 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 674325 % of reads mapped to multiple loci | 3.78% Number of reads mapped to too many loci | 567729 % of reads mapped to too many loci | 3.18% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.30% % of reads unmapped: other | 0.44% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 877884 877884 877884 N_multimapping 674325 674325 674325 N_noFeature 775781 8354682 8482920 N_ambiguous 254240 17822 18611 UnstrandedReadsAssigned:15251091 PositiveStrandReadsAssigned:7908608 NegativeStrandReadsAssigned:7779581 Dataset is classified unstranded MeadianReadLen=101 20thPercentileLength=100 echo kmer=95 SRR21853505 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR21853505-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,833,321 reads, 15,773,066 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,069 rounds 52973 SRR21853505.ke.tsv 35125 SRR21853505.se.tsv 88098 total ==> SRR21853505.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 35.218 4.65553 PNS24247 1044 945 75.3796 8.82575 PNS24249 1928 1829 223.904 13.545 PNS24246 1044 945 75.3796 8.82575 PNS24248 1044 945 75.3796 8.82575 PNS24244 1471 1372 37.7392 3.04346 PNS24243 293 194 16 9.12532 KQK14069 1603 1504 11309.8 832.026 KQK14071 474 375 2010.63 593.239 ==> SRR21853505.se.tsv <== BRADI_1g14170v3 14478 BRADI_1g53295v3 110 BRADI_1g59795v3 339 BRADI_1g07683v3 0 BRADI_1g00485v3 65 BRADI_1g20270v3 996 BRADI_1g74790v3 215 BRADI_1g09890v3 3 BRADI_1g77505v3 242 BRADI_1g48960v3 0 SRR21853505 completed mapping pipeline successfully