Starting /dee2/code/volunteer_pipeline.sh SRR21853507 current disk space = 1550521094144 free memory = 1361998248 SRR21853507 SRAfilesize 0b4a6430dfa335c7bf3e0e94ea0418a3 SRR21853507.sra SRR21853507.sra file validated SRR21853507 is single end SRR21853507 is conventional basespace SRR21853507 read1 length is 83-101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR21853507_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 83-101 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.0775 37.0 37.0 37.0 25.0 37.0 2 34.582 37.0 37.0 37.0 25.0 37.0 3 35.4965 37.0 37.0 37.0 37.0 37.0 4 35.604 37.0 37.0 37.0 37.0 37.0 5 35.729 37.0 37.0 37.0 37.0 37.0 6 35.68 37.0 37.0 37.0 37.0 37.0 7 35.65 37.0 37.0 37.0 37.0 37.0 8 35.8875 37.0 37.0 37.0 37.0 37.0 9 35.672 37.0 37.0 37.0 37.0 37.0 10-11 35.912 37.0 37.0 37.0 37.0 37.0 12-13 35.7715 37.0 37.0 37.0 37.0 37.0 14-15 35.88875 37.0 37.0 37.0 37.0 37.0 16-17 35.78325 37.0 37.0 37.0 37.0 37.0 18-19 35.73575 37.0 37.0 37.0 37.0 37.0 20-21 35.667500000000004 37.0 37.0 37.0 37.0 37.0 22-23 35.72125 37.0 37.0 37.0 37.0 37.0 24-25 35.698 37.0 37.0 37.0 37.0 37.0 26-27 35.57875 37.0 37.0 37.0 37.0 37.0 28-29 35.59225 37.0 37.0 37.0 37.0 37.0 30-31 35.58225 37.0 37.0 37.0 37.0 37.0 32-33 35.52825 37.0 37.0 37.0 37.0 37.0 34-35 35.45925 37.0 37.0 37.0 37.0 37.0 36-37 35.54775 37.0 37.0 37.0 37.0 37.0 38-39 35.31325 37.0 37.0 37.0 37.0 37.0 40-41 35.467749999999995 37.0 37.0 37.0 37.0 37.0 42-43 35.55375 37.0 37.0 37.0 37.0 37.0 44-45 35.43425 37.0 37.0 37.0 37.0 37.0 46-47 35.53075 37.0 37.0 37.0 37.0 37.0 48-49 35.46125 37.0 37.0 37.0 37.0 37.0 50-51 35.49025 37.0 37.0 37.0 37.0 37.0 52-53 35.548249999999996 37.0 37.0 37.0 37.0 37.0 54-55 35.334 37.0 37.0 37.0 37.0 37.0 56-57 35.5405 37.0 37.0 37.0 37.0 37.0 58-59 35.533 37.0 37.0 37.0 37.0 37.0 60-61 35.382999999999996 37.0 37.0 37.0 37.0 37.0 62-63 35.411500000000004 37.0 37.0 37.0 37.0 37.0 64-65 35.4165 37.0 37.0 37.0 37.0 37.0 66-67 35.32425 37.0 37.0 37.0 37.0 37.0 68-69 35.302 37.0 37.0 37.0 37.0 37.0 70-71 35.289 37.0 37.0 37.0 31.0 37.0 72-73 35.353750000000005 37.0 37.0 37.0 37.0 37.0 74-75 35.2465 37.0 37.0 37.0 25.0 37.0 76-77 35.325 37.0 37.0 37.0 37.0 37.0 78-79 35.2625 37.0 37.0 37.0 31.0 37.0 80-81 35.35275 37.0 37.0 37.0 37.0 37.0 82-83 35.27125 37.0 37.0 37.0 31.0 37.0 84-85 35.114778694673674 37.0 37.0 37.0 25.0 37.0 86-87 35.33265509271989 37.0 37.0 37.0 37.0 37.0 88-89 35.266950212659495 37.0 37.0 37.0 31.0 37.0 90-91 35.14736052039029 37.0 37.0 37.0 25.0 37.0 92-93 35.280460345258945 37.0 37.0 37.0 31.0 37.0 94-95 35.26494871153365 37.0 37.0 37.0 31.0 37.0 96-97 35.22393819681632 37.0 37.0 37.0 31.0 37.0 98-99 35.278527535934074 37.0 37.0 37.0 31.0 37.0 100-101 35.0199709331158 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100-101 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 2.0 23 3.0 24 11.0 25 11.0 26 13.0 27 17.0 28 51.0 29 59.0 30 73.0 31 116.0 32 131.0 33 185.0 34 284.0 35 526.0 36 2097.0 37 421.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 28.325 14.149999999999999 17.575 39.95 2 24.80877103518613 19.96430392656808 31.03008669046405 24.196838347781743 3 25.4 25.275 23.275000000000002 26.05 4 26.924999999999997 29.675 18.7 24.7 5 28.15 30.85 19.85 21.15 6 21.975 33.675 20.325 24.025 7 20.45 15.7 39.025 24.825 8 23.05 21.75 24.275 30.925000000000004 9 21.925 21.325 28.125 28.625 10-11 24.837500000000002 28.6375 20.5875 25.937500000000004 12-13 24.15 22.900000000000002 25.75 27.200000000000003 14-15 23.9 24.925 25.362499999999997 25.8125 16-17 25.15 24.325 24.9 25.624999999999996 18-19 24.5375 24.8 24.2625 26.400000000000002 20-21 24.712500000000002 25.224999999999998 25.324999999999996 24.7375 22-23 23.974999999999998 24.462500000000002 25.974999999999998 25.587500000000002 24-25 25.55 24.9375 24.5125 25.0 26-27 24.587500000000002 24.6625 24.4375 26.3125 28-29 23.9375 25.7375 24.8625 25.4625 30-31 25.2375 25.2 23.925 25.637500000000003 32-33 24.1875 26.0625 24.1375 25.6125 34-35 24.8 25.55 24.925 24.725 36-37 23.8125 25.2125 25.324999999999996 25.650000000000002 38-39 24.2875 25.337500000000002 24.224999999999998 26.150000000000002 40-41 24.099999999999998 25.087500000000002 25.2625 25.55 42-43 24.224999999999998 25.137500000000003 25.6125 25.025 44-45 24.925 25.0 24.1625 25.912499999999998 46-47 25.275 25.35 24.575 24.8 48-49 23.674999999999997 25.7 24.875 25.75 50-51 23.7625 25.025 25.674999999999997 25.5375 52-53 24.212500000000002 24.6875 25.224999999999998 25.874999999999996 54-55 24.725 24.6875 25.074999999999996 25.5125 56-57 23.7625 25.6 24.5625 26.075 58-59 25.3125 25.35 23.8875 25.45 60-61 24.425 25.2125 25.2 25.162499999999998 62-63 24.7375 25.15 24.625 25.4875 64-65 25.55 24.3625 25.2375 24.85 66-67 24.4125 26.087500000000002 24.5625 24.9375 68-69 25.15 25.837500000000002 24.1125 24.9 70-71 25.5375 23.5375 25.0 25.924999999999997 72-73 24.9125 25.575 24.2625 25.25 74-75 24.887500000000003 24.762500000000003 25.137500000000003 25.2125 76-77 24.575 24.2 24.9375 26.2875 78-79 25.362499999999997 24.975 24.4125 25.25 80-81 25.112499999999997 24.825 24.7875 25.275 82-83 25.137500000000003 24.0375 25.474999999999998 25.35 84-85 25.081270317579396 24.756189047261813 24.76869217304326 25.393848462115532 86-87 25.437718859429715 25.087543771885944 25.312656328164078 24.16208104052026 88-89 25.056292219164373 25.068801601200903 24.468351263447584 25.40655491618714 90-91 24.906179634726044 23.617713284963724 26.244683512634477 25.23142356767576 92-93 24.7935951963973 24.193144858643983 25.781836377282964 25.23142356767576 94-95 26.044533400050035 24.993745308981737 24.54340755566675 24.418313735301474 96-97 25.19408965689958 25.131480090157776 25.344352617079892 24.33007763586276 98-99 25.644608154451927 23.269401752826113 25.809729455099706 25.276260637622254 100-101 25.959723096286975 10.79295154185022 31.356198867212083 31.891126494650724 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.5 16 0.5 17 0.0 18 0.0 19 1.0 20 1.5 21 0.5 22 1.0 23 1.0 24 0.0 25 0.5 26 1.5 27 2.5 28 3.0 29 8.0 30 12.5 31 16.0 32 19.0 33 22.5 34 27.0 35 31.5 36 49.5 37 62.0 38 66.5 39 85.0 40 101.0 41 117.0 42 152.5 43 172.5 44 185.0 45 192.5 46 200.0 47 210.0 48 184.0 49 165.0 50 144.5 51 114.5 52 113.0 53 120.0 54 123.0 55 115.0 56 98.0 57 91.0 58 83.0 59 87.0 60 82.5 61 73.5 62 71.5 63 73.0 64 67.0 65 53.5 66 49.5 67 41.5 68 50.0 69 52.0 70 41.0 71 35.5 72 32.5 73 25.0 74 17.5 75 15.5 76 14.0 77 10.0 78 5.0 79 3.5 80 2.5 81 1.0 82 1.5 83 1.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 1.95 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 83 1.0 84 0.0 85 0.0 86 2.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 8.0 97 15.0 98 75.0 99 253.0 100 936.0 101 2710.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.22500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 93.34942343791901 87.02499999999999 2 6.14105658353446 11.450000000000001 3 0.45588629659426116 1.275 4 0.0 0.0 5 0.053633681952266025 0.25 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACTCTCGCGCATCTCGTAT 5 0.125 TruSeq Adapter, Index 8 (97% over 36bp) GATCGGAAGAGCACACGTCTGAACTCCAGTCACTCTCGCGCATCGCGTAT 5 0.125 TruSeq Adapter, Index 8 (97% over 36bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 958490 spots for SRR21853507.sra Written 958490 spots for SRR21853507.sra Read 958490 spots for SRR21853507.sra Written 958490 spots for SRR21853507.sra Read 958490 spots for SRR21853507.sra Written 958490 spots for SRR21853507.sra Read 958490 spots for SRR21853507.sra Written 958490 spots for SRR21853507.sra Read 958490 spots for SRR21853507.sra Written 958490 spots for SRR21853507.sra Read 958490 spots for SRR21853507.sra Written 958490 spots for SRR21853507.sra Read 958502 spots for SRR21853507.sra Written 958502 spots for SRR21853507.sra Read 958490 spots for SRR21853507.sra Written 958490 spots for SRR21853507.sra Read 958490 spots for SRR21853507.sra Written 958490 spots for SRR21853507.sra Read 958490 spots for SRR21853507.sra Written 958490 spots for SRR21853507.sra Read 958490 spots for SRR21853507.sra Written 958490 spots for SRR21853507.sra Read 958490 spots for SRR21853507.sra Written 958490 spots for SRR21853507.sra Read 958490 spots for SRR21853507.sra Written 958490 spots for SRR21853507.sra Read 958490 spots for SRR21853507.sra Written 958490 spots for SRR21853507.sra Read 958490 spots for SRR21853507.sra Written 958490 spots for SRR21853507.sra Read 958490 spots for SRR21853507.sra Written 958490 spots for SRR21853507.sra Read 958490 spots for SRR21853507.sra Written 958490 spots for SRR21853507.sra Read 958490 spots for SRR21853507.sra Written 958490 spots for SRR21853507.sra Read 958490 spots for SRR21853507.sra Written 958490 spots for SRR21853507.sra Read 958490 spots for SRR21853507.sra Written 958490 spots for SRR21853507.sra SRR ids: ['SRR21853507.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_nxl_snq3 SRR21853507.sra spots: 19169812 blocks: [[1, 958490], [958491, 1916980], [1916981, 2875470], [2875471, 3833960], [3833961, 4792450], [4792451, 5750940], [5750941, 6709430], [6709431, 7667920], [7667921, 8626410], [8626411, 9584900], [9584901, 10543390], [10543391, 11501880], [11501881, 12460370], [12460371, 13418860], [13418861, 14377350], [14377351, 15335840], [15335841, 16294330], [16294331, 17252820], [17252821, 18211310], [18211311, 19169812]] SRR21853507 file size 5163485 SRR21853507 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR21853507 SRR21853507_1.fastq Input file: SRR21853507_1.fastq trimmed: SRR21853507-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Fri Dec 6 16:35:03 2024 >> started Fri Dec 6 16:35:13 2024 >> done (10.023s) 19169812 reads processed; of these: 12 ( 0.00%) short reads filtered out after trimming by size control 64687 ( 0.34%) empty reads filtered out after trimming by size control 19105113 (99.66%) reads available; of these: 282 ( 0.00%) trimmed reads available after processing 19104831 (100.00%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 19 2 0.00% 20 4 0.00% 21 3 0.00% 22 3 0.00% 23 2 0.00% 24 6 0.00% 25 2 0.00% 26 5 0.00% 27 1 0.00% 28 3 0.00% 29 3 0.00% 30 4 0.00% 31 5 0.00% 32 5 0.00% 33 4 0.00% 34 5 0.00% 35 85 0.00% 36 75 0.00% 37 70 0.00% 38 89 0.00% 39 78 0.00% 40 79 0.00% 41 85 0.00% 42 90 0.00% 43 85 0.00% 44 92 0.00% 45 108 0.00% 46 102 0.00% 47 103 0.00% 48 102 0.00% 49 94 0.00% 50 120 0.00% 51 122 0.00% 52 153 0.00% 53 131 0.00% 54 124 0.00% 55 140 0.00% 56 133 0.00% 57 98 0.00% 58 173 0.00% 59 126 0.00% 60 193 0.00% 61 175 0.00% 62 188 0.00% 63 211 0.00% 64 164 0.00% 65 202 0.00% 66 197 0.00% 67 198 0.00% 68 257 0.00% 69 244 0.00% 70 235 0.00% 71 253 0.00% 72 266 0.00% 73 289 0.00% 74 323 0.00% 75 278 0.00% 76 248 0.00% 77 341 0.00% 78 366 0.00% 79 365 0.00% 80 416 0.00% 81 401 0.00% 82 525 0.00% 83 528 0.00% 84 523 0.00% 85 572 0.00% 86 586 0.00% 87 618 0.00% 88 657 0.00% 89 745 0.00% 90 870 0.00% 91 1753 0.01% 92 1037 0.01% 93 1195 0.01% 94 1901 0.01% 95 5012 0.03% 96 26635 0.14% 97 92172 0.48% 98 356168 1.86% 99 1306766 6.84% 100 4443677 23.26% 101 12854649 67.28% 19105113 reads passed initial QC criterion=sequence-density sequence-density=0.20 sequence-density-rank=1 fanout-score=2.01 fanout-score-rank=24 prefix-density=0.20 prefix-fanout=2.0 sequence=TACCTGCCCCCTCTCTCCGTGGAGTCTCTCCTGAAGCAGATCGAGTACCTGATCCGCTCCAAGTGGGTTCCTTGCCT criterion=fanout-score sequence-density=0.03 sequence-density-rank=28 fanout-score=12.60 fanout-score-rank=1 prefix-density=0.27 prefix-fanout=1.4 sequence=CTCCAAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGGAAGCCGGGTTACGGTGCCCAACTGCGCGCTAACCTAGAACCCACAAAGGGTGTTGGTCGATTAAGACAGCAGGACGGTGGTCATGGAAGTCGAAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATCAACTAGCCCCGAAAATGGATGGCGCTAAAGCGCGCGACCCACACCCGGCCATCTGGGCGAGCGCCATGCCCCGATGAGTAGGAGGGCGCGGCGGCCGCTGCAAAACCCGGGGCGCGAGCCCGGGCGGAGCGGCCGTCGGTGCAGATCTTGGTGGTAGTAGCAAATATTCAAATGAGAACTTTGAAGGCCGAAGAGGAGAAAGGTTCCATGTGAACGGCACTTGCACATGGGTAAGCCGATCCTAAGGGACGGGGTAACCCCGGCAGATAGCGCGATCACGCGTATCCCCCGAAAGGGAATCGGGTTAAGATTTCCCGAGCCGGGATG Started job on | Dec 06 16:35:36 Started mapping on | Dec 06 16:35:36 Finished on | Dec 06 16:36:04 Mapping speed, Million of reads per hour | 2456.37 Number of input reads | 19105113 Average input read length | 100 UNIQUE READS: Uniquely mapped reads number | 17339594 Uniquely mapped reads % | 90.76% Average mapped length | 100.18 Number of splices: Total | 6555046 Number of splices: Annotated (sjdb) | 6232662 Number of splices: GT/AG | 6464845 Number of splices: GC/AG | 77256 Number of splices: AT/AC | 3314 Number of splices: Non-canonical | 9631 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.01% Deletion average length | 2.17 Insertion rate per base | 0.01% Insertion average length | 1.94 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 785645 % of reads mapped to multiple loci | 4.11% Number of reads mapped to too many loci | 651888 % of reads mapped to too many loci | 3.41% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.29% % of reads unmapped: other | 0.43% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 979874 979874 979874 N_multimapping 785645 785645 785645 N_noFeature 729459 8920187 8910768 N_ambiguous 270580 16348 18415 UnstrandedReadsAssigned:16339555 PositiveStrandReadsAssigned:8403059 NegativeStrandReadsAssigned:8410411 Dataset is classified unstranded MeadianReadLen=101 20thPercentileLength=100 echo kmer=95 SRR21853507 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR21853507-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 19,105,113 reads, 16,959,847 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,218 rounds 52973 SRR21853507.ke.tsv 35125 SRR21853507.se.tsv 88098 total ==> SRR21853507.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 17.5469 2.1109 PNS24247 1044 945 64.7854 6.903 PNS24249 1928 1829 82.4446 4.5388 PNS24246 1044 945 64.7854 6.903 PNS24248 1044 945 64.7854 6.903 PNS24244 1471 1372 38.6523 2.8367 PNS24243 293 194 9 4.67125 KQK14069 1603 1504 1523.23 101.979 KQK14071 474 375 381.064 102.32 ==> SRR21853507.se.tsv <== BRADI_1g14170v3 2157 BRADI_1g53295v3 107 BRADI_1g59795v3 249 BRADI_1g07683v3 0 BRADI_1g00485v3 96 BRADI_1g20270v3 2111 BRADI_1g74790v3 106 BRADI_1g09890v3 3 BRADI_1g77505v3 232 BRADI_1g48960v3 0 SRR21853507 completed mapping pipeline successfully