Starting /dee2/code/volunteer_pipeline.sh SRR21853508 current disk space = 1550556057600 free memory = 1599519876 SRR21853508 SRAfilesize 1a565a8541464d3fb42e2ba36a9ca853 SRR21853508.sra SRR21853508.sra file validated SRR21853508 is single end SRR21853508 is conventional basespace SRR21853508 read1 length is 82-101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR21853508_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 82-101 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.15 37.0 37.0 37.0 25.0 37.0 2 34.45625 37.0 37.0 37.0 25.0 37.0 3 35.553 37.0 37.0 37.0 37.0 37.0 4 35.4825 37.0 37.0 37.0 37.0 37.0 5 35.609 37.0 37.0 37.0 37.0 37.0 6 35.6925 37.0 37.0 37.0 37.0 37.0 7 35.5125 37.0 37.0 37.0 37.0 37.0 8 35.778 37.0 37.0 37.0 37.0 37.0 9 35.747 37.0 37.0 37.0 37.0 37.0 10-11 35.79225 37.0 37.0 37.0 37.0 37.0 12-13 35.73725 37.0 37.0 37.0 37.0 37.0 14-15 35.719 37.0 37.0 37.0 37.0 37.0 16-17 35.7765 37.0 37.0 37.0 37.0 37.0 18-19 35.67875 37.0 37.0 37.0 37.0 37.0 20-21 35.7035 37.0 37.0 37.0 37.0 37.0 22-23 35.622749999999996 37.0 37.0 37.0 37.0 37.0 24-25 35.71525 37.0 37.0 37.0 37.0 37.0 26-27 35.4985 37.0 37.0 37.0 37.0 37.0 28-29 35.488749999999996 37.0 37.0 37.0 37.0 37.0 30-31 35.61225 37.0 37.0 37.0 37.0 37.0 32-33 35.47475 37.0 37.0 37.0 37.0 37.0 34-35 35.48925 37.0 37.0 37.0 37.0 37.0 36-37 35.441500000000005 37.0 37.0 37.0 37.0 37.0 38-39 35.41675 37.0 37.0 37.0 37.0 37.0 40-41 35.52675 37.0 37.0 37.0 37.0 37.0 42-43 35.51875 37.0 37.0 37.0 37.0 37.0 44-45 35.431 37.0 37.0 37.0 37.0 37.0 46-47 35.38875 37.0 37.0 37.0 37.0 37.0 48-49 35.459 37.0 37.0 37.0 37.0 37.0 50-51 35.535250000000005 37.0 37.0 37.0 37.0 37.0 52-53 35.423249999999996 37.0 37.0 37.0 37.0 37.0 54-55 35.380250000000004 37.0 37.0 37.0 37.0 37.0 56-57 35.47324999999999 37.0 37.0 37.0 37.0 37.0 58-59 35.4705 37.0 37.0 37.0 37.0 37.0 60-61 35.4655 37.0 37.0 37.0 37.0 37.0 62-63 35.417 37.0 37.0 37.0 37.0 37.0 64-65 35.33 37.0 37.0 37.0 37.0 37.0 66-67 35.29675 37.0 37.0 37.0 31.0 37.0 68-69 35.22725 37.0 37.0 37.0 25.0 37.0 70-71 35.34025 37.0 37.0 37.0 31.0 37.0 72-73 35.3575 37.0 37.0 37.0 37.0 37.0 74-75 35.337999999999994 37.0 37.0 37.0 37.0 37.0 76-77 35.314750000000004 37.0 37.0 37.0 37.0 37.0 78-79 35.317499999999995 37.0 37.0 37.0 31.0 37.0 80-81 35.33925 37.0 37.0 37.0 31.0 37.0 82-83 35.312572536268135 37.0 37.0 37.0 37.0 37.0 84-85 35.16933466733367 37.0 37.0 37.0 25.0 37.0 86-87 35.28314157078539 37.0 37.0 37.0 37.0 37.0 88-89 35.2863931965983 37.0 37.0 37.0 31.0 37.0 90-91 35.22586293146573 37.0 37.0 37.0 31.0 37.0 92-93 35.18488866649987 37.0 37.0 37.0 25.0 37.0 94-95 35.1341286244964 37.0 37.0 37.0 25.0 37.0 96-97 35.18554155659419 37.0 37.0 37.0 25.0 37.0 98-99 35.12977040035869 37.0 37.0 37.0 25.0 37.0 100-101 35.145455630122456 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100-101 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 2.0 21 0.0 22 2.0 23 3.0 24 6.0 25 12.0 26 14.0 27 28.0 28 37.0 29 52.0 30 76.0 31 108.0 32 140.0 33 208.0 34 287.0 35 573.0 36 2091.0 37 361.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 28.025 13.200000000000001 18.275 40.5 2 24.25249169435216 20.546894965499618 32.07257858420649 23.12803475594173 3 26.400000000000002 23.925 23.65 26.025 4 27.825 30.575000000000003 17.974999999999998 23.625 5 27.175 30.675 21.6 20.549999999999997 6 21.175 33.2 21.325 24.3 7 20.8 16.025 38.125 25.05 8 21.575 21.25 26.775 30.4 9 22.35 22.725 28.875 26.05 10-11 25.974999999999998 27.625 20.65 25.75 12-13 24.1875 22.4625 26.825 26.525 14-15 24.325 25.137500000000003 25.650000000000002 24.887500000000003 16-17 24.375 25.2125 24.8125 25.6 18-19 24.3875 25.55 24.7875 25.275 20-21 25.025 24.9 24.6 25.474999999999998 22-23 23.6125 24.712500000000002 25.337500000000002 26.337500000000002 24-25 23.875 25.424999999999997 25.025 25.674999999999997 26-27 24.6125 25.662499999999998 24.2875 25.4375 28-29 24.8125 25.4 24.587500000000002 25.2 30-31 23.400000000000002 25.887500000000003 24.9375 25.775 32-33 23.849999999999998 24.9375 24.8625 26.35 34-35 24.0625 25.35 24.525 26.0625 36-37 24.9375 25.0375 25.162499999999998 24.8625 38-39 24.3 26.1125 24.887500000000003 24.7 40-41 24.6875 24.5375 25.05 25.724999999999998 42-43 24.825 25.25 24.5625 25.362499999999997 44-45 25.5625 25.112499999999997 24.5625 24.762500000000003 46-47 24.462500000000002 26.200000000000003 24.0375 25.3 48-49 23.75 24.712500000000002 26.0625 25.474999999999998 50-51 24.9875 24.05 24.637500000000003 26.325 52-53 24.837500000000002 25.074999999999996 24.275 25.8125 54-55 25.15 25.2625 24.2875 25.3 56-57 24.6125 25.0125 24.8125 25.5625 58-59 25.162499999999998 25.4875 24.375 24.975 60-61 25.2625 25.2125 24.0625 25.4625 62-63 24.575 25.3125 24.9875 25.124999999999996 64-65 25.137500000000003 25.724999999999998 23.5625 25.575 66-67 24.775 25.424999999999997 24.7875 25.0125 68-69 24.887500000000003 24.575 25.4625 25.074999999999996 70-71 25.05 24.5375 25.412499999999998 25.0 72-73 24.5625 25.275 24.5375 25.624999999999996 74-75 24.4125 25.825 24.875 24.887500000000003 76-77 25.525 24.6625 24.462500000000002 25.35 78-79 24.7 24.8625 24.525 25.912499999999998 80-81 24.9 25.8125 23.3625 25.924999999999997 82-83 24.568642160540136 25.056264066016503 24.731182795698924 25.64391097774444 84-85 24.61230615307654 25.087543771885944 25.050025012506254 25.250125062531264 86-87 25.6128064032016 25.11255627813907 25.26263131565783 24.012006003001503 88-89 24.54977488744372 25.68784392196098 24.16208104052026 25.60030015007504 90-91 26.300650325162582 24.23711855927964 24.287143571785894 25.175087543771884 92-93 24.73104828621466 24.78108581436077 26.54490868151113 23.942957217913435 94-95 25.634930564243714 24.083573126485675 24.371324909295634 25.910171399974978 96-97 24.380165289256198 25.444527923866765 24.91860756323566 25.25669922364137 98-99 23.839206207861597 25.162193105202903 25.42933469024297 25.56926599669253 100-101 26.629570747217805 11.78060413354531 31.160572337042925 30.42925278219396 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.5 3 0.5 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.5 19 0.5 20 0.0 21 0.0 22 0.5 23 0.5 24 0.5 25 1.0 26 2.0 27 2.5 28 2.5 29 3.5 30 5.0 31 9.5 32 13.0 33 18.5 34 27.0 35 27.5 36 29.0 37 45.0 38 71.5 39 90.0 40 115.0 41 143.5 42 155.5 43 164.5 44 185.0 45 187.0 46 168.0 47 167.0 48 185.0 49 182.5 50 169.0 51 160.0 52 142.0 53 139.0 54 128.0 55 124.5 56 138.5 57 129.0 58 99.0 59 77.5 60 70.0 61 61.5 62 62.0 63 65.5 64 64.0 65 62.5 66 53.5 67 40.5 68 33.0 69 36.5 70 39.0 71 29.0 72 19.0 73 17.5 74 15.5 75 9.5 76 7.0 77 4.5 78 0.5 79 2.0 80 2.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.5 89 0.5 90 0.5 91 0.5 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 2.175 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 82 2.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 1.0 92 0.0 93 0.0 94 1.0 95 0.0 96 6.0 97 23.0 98 73.0 99 281.0 100 936.0 101 2677.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.07499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 92.26174314417594 84.95 2 6.950855281020907 12.8 3 0.7059462394786858 1.95 4 0.08145533532446375 0.3 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1212969 spots for SRR21853508.sra Written 1212969 spots for SRR21853508.sra Read 1212969 spots for SRR21853508.sra Written 1212969 spots for SRR21853508.sra Read 1212969 spots for SRR21853508.sra Written 1212969 spots for SRR21853508.sra Read 1212969 spots for SRR21853508.sra Written 1212969 spots for SRR21853508.sra Read 1212969 spots for SRR21853508.sra Written 1212969 spots for SRR21853508.sra Read 1212969 spots for SRR21853508.sra Written 1212969 spots for SRR21853508.sra Read 1212969 spots for SRR21853508.sra Written 1212969 spots for SRR21853508.sra Read 1212969 spots for SRR21853508.sra Written 1212969 spots for SRR21853508.sra Read 1212969 spots for SRR21853508.sra Written 1212969 spots for SRR21853508.sra Read 1212969 spots for SRR21853508.sra Written 1212969 spots for SRR21853508.sra Read 1212969 spots for SRR21853508.sra Written 1212969 spots for SRR21853508.sra Read 1212969 spots for SRR21853508.sra Written 1212969 spots for SRR21853508.sra Read 1212969 spots for SRR21853508.sra Written 1212969 spots for SRR21853508.sra Read 1212986 spots for SRR21853508.sra Written 1212986 spots for SRR21853508.sra Read 1212969 spots for SRR21853508.sra Written 1212969 spots for SRR21853508.sra Read 1212969 spots for SRR21853508.sra Written 1212969 spots for SRR21853508.sra Read 1212969 spots for SRR21853508.sra Written 1212969 spots for SRR21853508.sra Read 1212969 spots for SRR21853508.sra Written 1212969 spots for SRR21853508.sra Read 1212969 spots for SRR21853508.sra Written 1212969 spots for SRR21853508.sra Read 1212969 spots for SRR21853508.sra Written 1212969 spots for SRR21853508.sra SRR ids: ['SRR21853508.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_sbm_bm3h SRR21853508.sra spots: 24259397 blocks: [[1, 1212969], [1212970, 2425938], [2425939, 3638907], [3638908, 4851876], [4851877, 6064845], [6064846, 7277814], [7277815, 8490783], [8490784, 9703752], [9703753, 10916721], [10916722, 12129690], [12129691, 13342659], [13342660, 14555628], [14555629, 15768597], [15768598, 16981566], [16981567, 18194535], [18194536, 19407504], [19407505, 20620473], [20620474, 21833442], [21833443, 23046411], [23046412, 24259397]] SRR21853508 file size 6536948 SRR21853508 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR21853508 SRR21853508_1.fastq Input file: SRR21853508_1.fastq trimmed: SRR21853508-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Fri Dec 6 16:37:16 2024 >> started Fri Dec 6 16:37:30 2024 >> done (13.474s) 24259397 reads processed; of these: 31 ( 0.00%) short reads filtered out after trimming by size control 34216 ( 0.14%) empty reads filtered out after trimming by size control 24225150 (99.86%) reads available; of these: 352 ( 0.00%) trimmed reads available after processing 24224798 (100.00%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 4 0.00% 20 5 0.00% 21 2 0.00% 22 4 0.00% 23 1 0.00% 24 4 0.00% 25 3 0.00% 26 4 0.00% 27 4 0.00% 28 3 0.00% 29 2 0.00% 30 1 0.00% 31 4 0.00% 32 2 0.00% 33 6 0.00% 34 5 0.00% 35 125 0.00% 36 112 0.00% 37 112 0.00% 38 113 0.00% 39 110 0.00% 40 129 0.00% 41 123 0.00% 42 114 0.00% 43 104 0.00% 44 122 0.00% 45 145 0.00% 46 142 0.00% 47 154 0.00% 48 122 0.00% 49 155 0.00% 50 121 0.00% 51 153 0.00% 52 157 0.00% 53 188 0.00% 54 183 0.00% 55 169 0.00% 56 182 0.00% 57 189 0.00% 58 205 0.00% 59 189 0.00% 60 274 0.00% 61 241 0.00% 62 251 0.00% 63 261 0.00% 64 226 0.00% 65 278 0.00% 66 274 0.00% 67 296 0.00% 68 306 0.00% 69 275 0.00% 70 289 0.00% 71 389 0.00% 72 359 0.00% 73 378 0.00% 74 401 0.00% 75 392 0.00% 76 454 0.00% 77 435 0.00% 78 501 0.00% 79 533 0.00% 80 566 0.00% 81 651 0.00% 82 608 0.00% 83 684 0.00% 84 737 0.00% 85 795 0.00% 86 823 0.00% 87 863 0.00% 88 995 0.00% 89 1044 0.00% 90 1221 0.01% 91 2921 0.01% 92 1639 0.01% 93 1904 0.01% 94 2472 0.01% 95 6329 0.03% 96 33405 0.14% 97 116360 0.48% 98 451325 1.86% 99 1660739 6.86% 100 5674659 23.42% 101 16253923 67.10% 24225150 reads passed initial QC criterion=sequence-density sequence-density=0.27 sequence-density-rank=1 fanout-score=1.97 fanout-score-rank=30 prefix-density=0.26 prefix-fanout=2.0 sequence=CCGTCAATTCCTTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=42 fanout-score=30.59 fanout-score-rank=1 prefix-density=0.14 prefix-fanout=1.1 sequence=ATCCGCCGACAGCCGACGGGTTTGGGGCCGGGACCCCCGAGCCCAGTCCTCAGAGCCAATCCTTTTCCCGAAGTTACGGATCCGTTTTGCCGACTTCCCTTGCCTACATTGTTCCATTGGCCAGAGGCTGTTCACCTTGGAGACCTGATGCGGTTATGAGTACGACCGGGCGTGAACGGTACTCGGTCCTCCGGATTTTCATGGGCCGCCGGGGGCGCACCGGACACCGCGCGACGTGCGGTGCTCTTCCGGCCACTGGACCCTACCTCCGGCTGAACCGATTCCAGGGTTGGCAGGCCGTTAAGCAGAAAAGATAACTCTTCCCGAGGCCCCCGCCGGCGTCTCCGGACTTCCTAACGTCGCCGTCAACCGCCACATCCCGGCTCGGGAAATCTTAACCCGATTCCCTTTCGGGGGATACGCGTGATCGCGCTATCTGCCGGGGTTACCCCGTCCCTTAGGATCGGCTTACCCATGTGCAAGTGCCGTTCACATGGAACCTTTCTCCTCT Started job on | Dec 06 16:37:46 Started mapping on | Dec 06 16:37:46 Finished on | Dec 06 16:38:29 Mapping speed, Million of reads per hour | 2028.15 Number of input reads | 24225150 Average input read length | 100 UNIQUE READS: Uniquely mapped reads number | 20389751 Uniquely mapped reads % | 84.17% Average mapped length | 100.19 Number of splices: Total | 7876855 Number of splices: Annotated (sjdb) | 7495906 Number of splices: GT/AG | 7769066 Number of splices: GC/AG | 92431 Number of splices: AT/AC | 4260 Number of splices: Non-canonical | 11098 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.01% Deletion average length | 2.12 Insertion rate per base | 0.00% Insertion average length | 1.94 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1756841 % of reads mapped to multiple loci | 7.25% Number of reads mapped to too many loci | 1561364 % of reads mapped to too many loci | 6.45% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.32% % of reads unmapped: other | 0.81% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2078558 2078558 2078558 N_multimapping 1756841 1756841 1756841 N_noFeature 949390 10539647 10520966 N_ambiguous 317199 19263 22132 UnstrandedReadsAssigned:19123162 PositiveStrandReadsAssigned:9830841 NegativeStrandReadsAssigned:9846653 Dataset is classified unstranded MeadianReadLen=101 20thPercentileLength=100 echo kmer=95 SRR21853508 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR21853508-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 24,225,150 reads, 20,179,208 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,195 rounds 52973 SRR21853508.ke.tsv 35125 SRR21853508.se.tsv 88098 total ==> SRR21853508.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 0.0419318 0.0041366 PNS24247 1044 945 76.879 6.71741 PNS24249 1928 1829 52.0997 2.35205 PNS24246 1044 945 76.879 6.71741 PNS24248 1044 945 76.879 6.71741 PNS24244 1471 1372 39.2215 2.36046 PNS24243 293 194 6 2.55373 KQK14069 1603 1504 1042.94 57.2583 KQK14071 474 375 212.057 46.6926 ==> SRR21853508.se.tsv <== BRADI_1g14170v3 1399 BRADI_1g53295v3 157 BRADI_1g59795v3 300 BRADI_1g07683v3 0 BRADI_1g00485v3 77 BRADI_1g20270v3 2641 BRADI_1g74790v3 124 BRADI_1g09890v3 9 BRADI_1g77505v3 308 BRADI_1g48960v3 0 SRR21853508 completed mapping pipeline successfully