Starting /dee2/code/volunteer_pipeline.sh SRR21853509 current disk space = 1550582910976 free memory = 1599127004 SRR21853509 SRAfilesize 4ebc103cad13b91809b699ce93f97d10 SRR21853509.sra SRR21853509.sra file validated SRR21853509 is single end SRR21853509 is conventional basespace SRR21853509 read1 length is 61-101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR21853509_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 61-101 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.598 37.0 37.0 37.0 37.0 37.0 2 35.951 37.0 37.0 37.0 37.0 37.0 3 35.857 37.0 37.0 37.0 37.0 37.0 4 35.9805 37.0 37.0 37.0 37.0 37.0 5 36.0455 37.0 37.0 37.0 37.0 37.0 6 36.1305 37.0 37.0 37.0 37.0 37.0 7 35.9735 37.0 37.0 37.0 37.0 37.0 8 36.1155 37.0 37.0 37.0 37.0 37.0 9 35.948 37.0 37.0 37.0 37.0 37.0 10-11 36.04075 37.0 37.0 37.0 37.0 37.0 12-13 36.00975 37.0 37.0 37.0 37.0 37.0 14-15 36.04025 37.0 37.0 37.0 37.0 37.0 16-17 35.944500000000005 37.0 37.0 37.0 37.0 37.0 18-19 35.935249999999996 37.0 37.0 37.0 37.0 37.0 20-21 36.019 37.0 37.0 37.0 37.0 37.0 22-23 36.026250000000005 37.0 37.0 37.0 37.0 37.0 24-25 35.9385 37.0 37.0 37.0 37.0 37.0 26-27 35.8305 37.0 37.0 37.0 37.0 37.0 28-29 35.795500000000004 37.0 37.0 37.0 37.0 37.0 30-31 35.869 37.0 37.0 37.0 37.0 37.0 32-33 35.78475 37.0 37.0 37.0 37.0 37.0 34-35 35.8755 37.0 37.0 37.0 37.0 37.0 36-37 35.8745 37.0 37.0 37.0 37.0 37.0 38-39 35.858000000000004 37.0 37.0 37.0 37.0 37.0 40-41 35.78775 37.0 37.0 37.0 37.0 37.0 42-43 35.68075 37.0 37.0 37.0 37.0 37.0 44-45 35.768249999999995 37.0 37.0 37.0 37.0 37.0 46-47 35.767250000000004 37.0 37.0 37.0 37.0 37.0 48-49 35.67975 37.0 37.0 37.0 37.0 37.0 50-51 35.70375 37.0 37.0 37.0 37.0 37.0 52-53 35.7345 37.0 37.0 37.0 37.0 37.0 54-55 35.81175 37.0 37.0 37.0 37.0 37.0 56-57 35.789500000000004 37.0 37.0 37.0 37.0 37.0 58-59 35.70975 37.0 37.0 37.0 37.0 37.0 60-61 35.7395 37.0 37.0 37.0 37.0 37.0 62-63 35.76319079769942 37.0 37.0 37.0 37.0 37.0 64-65 35.66366591647912 37.0 37.0 37.0 37.0 37.0 66-67 35.680170042510625 37.0 37.0 37.0 37.0 37.0 68-69 35.66516629157289 37.0 37.0 37.0 37.0 37.0 70-71 35.75118779694924 37.0 37.0 37.0 37.0 37.0 72-73 35.740685171292824 37.0 37.0 37.0 37.0 37.0 74-75 35.574393598399595 37.0 37.0 37.0 37.0 37.0 76-77 35.58272246901145 37.0 37.0 37.0 37.0 37.0 78-79 35.56603301650826 37.0 37.0 37.0 37.0 37.0 80-81 35.555777888944476 37.0 37.0 37.0 37.0 37.0 82-83 35.67392392392392 37.0 37.0 37.0 37.0 37.0 84-85 35.62937937937938 37.0 37.0 37.0 37.0 37.0 86-87 35.569569569569566 37.0 37.0 37.0 37.0 37.0 88-89 35.47353655282316 37.0 37.0 37.0 37.0 37.0 90-91 35.558448060075094 37.0 37.0 37.0 37.0 37.0 92-93 35.584230287859825 37.0 37.0 37.0 37.0 37.0 94-95 35.656570713391744 37.0 37.0 37.0 37.0 37.0 96-97 35.543403665458044 37.0 37.0 37.0 37.0 37.0 98-99 35.49245239035698 37.0 37.0 37.0 37.0 37.0 100-101 35.43113154273061 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 2101 1 0.0 2101 2 0.0 2101 3 0.0 2101 4 0.0 2101 5 0.0 2101 6 0.0 2101 7 0.0 2101 8 0.0 2101 9 0.0 2101 10-11 0.0 2101 12-13 0.0 2101 14-15 0.0 2101 16-17 0.0 2101 18-19 0.0 2101 20-21 0.0 2101 22-23 0.0 2101 24-25 0.0 2101 26-27 0.0 2101 28-29 0.0 2101 30-31 0.0 2101 32-33 0.0 2101 34-35 0.0 2101 36-37 0.0 2101 38-39 0.0 2101 40-41 0.0 2101 42-43 0.0 2101 44-45 0.0 2101 46-47 0.0 2101 48-49 0.0 2101 50-51 0.0 2101 52-53 0.0 2101 54-55 0.0 2101 56-57 0.0 2101 58-59 0.0 2101 60-61 0.0 2101 62-63 0.0 2101 64-65 0.0 2101 66-67 0.0 2101 68-69 0.0 2101 70-71 0.0 2101 72-73 0.0 2101 74-75 0.0 2101 76-77 0.0 2101 78-79 0.0 2101 80-81 0.0 2101 82-83 0.0 2101 84-85 0.0 2101 86-87 0.0 2101 88-89 0.0 2101 90-91 0.0 2101 92-93 0.0 2101 94-95 0.0 2101 96-97 0.0 2101 98-99 0.0 2101 100-101 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 18 1.0 19 1.0 20 0.0 21 0.0 22 1.0 23 5.0 24 6.0 25 12.0 26 8.0 27 28.0 28 32.0 29 55.0 30 41.0 31 66.0 32 103.0 33 161.0 34 190.0 35 421.0 36 2266.0 37 603.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 22.775000000000002 16.575 13.525 47.125 2 19.2 21.975 40.35 18.475 3 21.325 26.200000000000003 26.224999999999998 26.25 4 23.7 30.85 21.625 23.825 5 24.2 34.325 22.45 19.025 6 19.275000000000002 36.575 24.125 20.025000000000002 7 18.275 18.025 41.699999999999996 22.0 8 20.599999999999998 23.200000000000003 29.25 26.950000000000003 9 19.900000000000002 23.549999999999997 30.825000000000003 25.724999999999998 10-11 24.587500000000002 30.75 22.0 22.662499999999998 12-13 21.1375 25.2 28.65 25.0125 14-15 22.325 26.875 28.237499999999997 22.5625 16-17 23.3875 26.5125 26.637499999999996 23.4625 18-19 22.287499999999998 27.2625 27.6125 22.8375 20-21 23.075000000000003 26.325 26.987499999999997 23.6125 22-23 22.4875 26.9125 27.8875 22.7125 24-25 22.525000000000002 27.1625 27.3625 22.95 26-27 22.3 27.487499999999997 27.875 22.3375 28-29 22.412499999999998 26.787499999999998 27.537499999999998 23.2625 30-31 22.6125 26.724999999999998 26.937499999999996 23.724999999999998 32-33 22.7 28.1625 27.037499999999998 22.1 34-35 23.075000000000003 27.05 26.424999999999997 23.45 36-37 22.287499999999998 28.237499999999997 26.3 23.175 38-39 21.8875 27.675 27.275 23.1625 40-41 23.2875 27.400000000000002 26.5 22.8125 42-43 21.462500000000002 27.500000000000004 27.650000000000002 23.3875 44-45 22.7625 28.1 26.924999999999997 22.2125 46-47 23.200000000000003 27.4125 26.450000000000003 22.9375 48-49 21.8 27.575 27.05 23.575 50-51 23.325000000000003 27.725 26.9125 22.037499999999998 52-53 22.4875 28.1125 27.3 22.1 54-55 22.3875 28.599999999999998 26.387500000000003 22.625 56-57 22.1375 27.9375 26.787499999999998 23.1375 58-59 22.5 28.025 27.675 21.8 60-61 22.275 27.925 27.1125 22.6875 62-63 22.893223305826456 26.6816704176044 27.44436109027257 22.980745186296573 64-65 22.53063265816454 27.131782945736433 27.00675168792198 23.330832708177045 66-67 22.55563890972743 26.806701675418854 27.644411102775695 22.99324831207802 68-69 21.780445111277817 27.79444861215304 27.306826706676667 23.118279569892472 70-71 22.380595148787197 28.244561140285075 27.144286071517882 22.230557639409852 72-73 22.643160790197552 27.094273568392097 28.19454863715929 22.06801700425106 74-75 23.093273318329583 27.66941735433858 26.756689172293076 22.48062015503876 76-77 22.908590721520568 27.49781167937977 26.910091284231584 22.683506314868076 78-79 21.823411705852926 27.388694347173587 27.37618809404702 23.411705852926463 80-81 22.773886943471737 28.114057028514257 27.088544272136065 22.02351175587794 82-83 22.51001001001001 27.47747747747748 27.414914914914917 22.597597597597595 84-85 22.7977977977978 28.07807807807808 27.064564564564563 22.05955955955956 86-87 22.384884884884883 27.540040040040044 28.053053053053052 22.02202202202202 88-89 23.038418220498063 27.906394694030784 26.792641721937176 22.262545363533974 90-91 22.690863579474343 28.11013767209011 26.270337922403 22.92866082603254 92-93 22.92866082603254 26.958698372966204 28.185231539424283 21.927409261576972 94-95 21.314142678347935 27.77221526908636 27.146433041301627 23.76720901126408 96-97 21.842105263157897 27.055137844611526 27.556390977443606 23.546365914786968 98-99 23.727735368956743 26.221374045801525 27.608142493638677 22.442748091603054 100-101 22.91599613775346 13.356935951078212 34.872867718056 28.854200193112327 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 15.0 1 8.5 2 1.5 3 1.5 4 1.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 1.0 20 2.5 21 3.0 22 2.0 23 2.0 24 6.0 25 9.5 26 8.0 27 11.0 28 18.5 29 19.0 30 23.5 31 27.5 32 24.5 33 32.0 34 47.0 35 60.5 36 71.5 37 91.0 38 111.5 39 140.5 40 170.5 41 188.0 42 199.0 43 212.0 44 235.0 45 239.5 46 240.0 47 220.5 48 200.5 49 186.5 50 159.5 51 147.5 52 123.5 53 114.0 54 104.0 55 77.5 56 66.5 57 58.0 58 48.0 59 33.5 60 30.0 61 28.0 62 24.0 63 25.5 64 28.5 65 25.0 66 14.5 67 12.0 68 10.5 69 11.5 70 9.0 71 6.5 72 5.5 73 2.0 74 4.5 75 5.5 76 2.0 77 0.5 78 1.5 79 2.0 80 1.0 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 61 1.0 62 0.0 63 0.0 64 0.0 65 0.0 66 0.0 67 0.0 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 1.0 77 0.0 78 0.0 79 0.0 80 0.0 81 2.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 1.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 1.0 96 8.0 97 16.0 98 80.0 99 267.0 100 1032.0 101 2591.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.225 #Duplication Level Percentage of deduplicated Percentage of total 1 92.54540525887775 85.35000000000001 2 6.858227161832476 12.65 3 0.5150447275684468 1.425 4 0.02710761724044456 0.1 5 0.0 0.0 6 0.0 0.0 7 0.02710761724044456 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.02710761724044456 0.3 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA 12 0.3 No Hit TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT 7 0.17500000000000002 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 299227 spots for SRR21853509.sra Written 299227 spots for SRR21853509.sra Read 299227 spots for SRR21853509.sra Written 299227 spots for SRR21853509.sra Read 299227 spots for SRR21853509.sra Written 299227 spots for SRR21853509.sra Read 299227 spots for SRR21853509.sra Written 299227 spots for SRR21853509.sra Read 299227 spots for SRR21853509.sra Written 299227 spots for SRR21853509.sra Read 299227 spots for SRR21853509.sra Written 299227 spots for SRR21853509.sra Read 299227 spots for SRR21853509.sra Written 299227 spots for SRR21853509.sra Read 299227 spots for SRR21853509.sra Written 299227 spots for SRR21853509.sra Read 299227 spots for SRR21853509.sra Written 299227 spots for SRR21853509.sra Read 299227 spots for SRR21853509.sra Written 299227 spots for SRR21853509.sra Read 299227 spots for SRR21853509.sra Written 299227 spots for SRR21853509.sra Read 299227 spots for SRR21853509.sra Written 299227 spots for SRR21853509.sra Read 299227 spots for SRR21853509.sra Written 299227 spots for SRR21853509.sra Read 299227 spots for SRR21853509.sra Written 299227 spots for SRR21853509.sra Read 299227 spots for SRR21853509.sra Written 299227 spots for SRR21853509.sra Read 299227 spots for SRR21853509.sra Written 299227 spots for SRR21853509.sra Read 299227 spots for SRR21853509.sra Written 299227 spots for SRR21853509.sra Read 299227 spots for SRR21853509.sra Written 299227 spots for SRR21853509.sra Read 299227 spots for SRR21853509.sra Written 299227 spots for SRR21853509.sra Read 299240 spots for SRR21853509.sra Written 299240 spots for SRR21853509.sra SRR ids: ['SRR21853509.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_eygis3ex SRR21853509.sra spots: 5984553 blocks: [[1, 299227], [299228, 598454], [598455, 897681], [897682, 1196908], [1196909, 1496135], [1496136, 1795362], [1795363, 2094589], [2094590, 2393816], [2393817, 2693043], [2693044, 2992270], [2992271, 3291497], [3291498, 3590724], [3590725, 3889951], [3889952, 4189178], [4189179, 4488405], [4488406, 4787632], [4787633, 5086859], [5086860, 5386086], [5386087, 5685313], [5685314, 5984553]] SRR21853509 file size 1608137 SRR21853509 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR21853509 SRR21853509_1.fastq Input file: SRR21853509_1.fastq trimmed: SRR21853509-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Fri Dec 6 16:37:09 2024 >> started Fri Dec 6 16:37:12 2024 >> done (3.242s) 5984553 reads processed; of these: 0 ( 0.00%) short reads filtered out after trimming by size control 5601 ( 0.09%) empty reads filtered out after trimming by size control 5978952 (99.91%) reads available; of these: 200 ( 0.00%) trimmed reads available after processing 5978752 (100.00%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 25 1 0.00% 26 0 0.00% 27 2 0.00% 28 0 0.00% 29 1 0.00% 30 0 0.00% 31 4 0.00% 32 0 0.00% 33 9 0.00% 34 0 0.00% 35 18 0.00% 36 16 0.00% 37 15 0.00% 38 16 0.00% 39 17 0.00% 40 28 0.00% 41 17 0.00% 42 19 0.00% 43 25 0.00% 44 17 0.00% 45 14 0.00% 46 14 0.00% 47 18 0.00% 48 21 0.00% 49 19 0.00% 50 17 0.00% 51 21 0.00% 52 26 0.00% 53 22 0.00% 54 24 0.00% 55 29 0.00% 56 24 0.00% 57 24 0.00% 58 39 0.00% 59 27 0.00% 60 42 0.00% 61 35 0.00% 62 41 0.00% 63 47 0.00% 64 43 0.00% 65 31 0.00% 66 35 0.00% 67 42 0.00% 68 71 0.00% 69 43 0.00% 70 64 0.00% 71 61 0.00% 72 71 0.00% 73 52 0.00% 74 79 0.00% 75 70 0.00% 76 90 0.00% 77 81 0.00% 78 87 0.00% 79 110 0.00% 80 95 0.00% 81 127 0.00% 82 136 0.00% 83 136 0.00% 84 141 0.00% 85 165 0.00% 86 167 0.00% 87 176 0.00% 88 188 0.00% 89 194 0.00% 90 258 0.00% 91 534 0.01% 92 297 0.00% 93 361 0.01% 94 500 0.01% 95 1328 0.02% 96 8349 0.14% 97 33399 0.56% 98 123157 2.06% 99 404824 6.77% 100 1533288 25.64% 101 3869393 64.72% 5978952 reads passed initial QC criterion=sequence-density sequence-density=0.06 sequence-density-rank=1 fanout-score=2.59 fanout-score-rank=18 prefix-density=0.06 prefix-fanout=2.4 sequence=GTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTTAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGGACTTTGGGCCGGGTCGGCCGGTCCGCCTCACGGCGAGCACCGACCTACTCGACCCTTCAGCCGGCGATGCGCTCCTAGCCTTAATTGGCCGGGTCGTGCCTCCGGCATCGTTACTTTGAAGAAATTAGAGTGCTCAAAGCAAGCCATCGCTCTGGATACATTAGCATGGGATAACATCATAGGATTCCGGTCCTATTGTGTTGGCCTTCGGGATCGGAGTAATGATTAATAGGGACAGTCGGGGGCATTCGTATTTCATAGTCAGAGGTGAAATTCTTGGATTTATGAAAGACGAACAACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAAGAACGAAAGTTGGGGGCTCGAAGACGATCAGATACCGT criterion=fanout-score sequence-density=0.03 sequence-density-rank=11 fanout-score=118.34 fanout-score-rank=1 prefix-density=0.17 prefix-fanout=20.1 sequence=CATCATCATCAA Started job on | Dec 06 16:37:37 Started mapping on | Dec 06 16:37:37 Finished on | Dec 06 16:38:01 Mapping speed, Million of reads per hour | 896.84 Number of input reads | 5978952 Average input read length | 100 UNIQUE READS: Uniquely mapped reads number | 5208722 Uniquely mapped reads % | 87.12% Average mapped length | 100.26 Number of splices: Total | 2056547 Number of splices: Annotated (sjdb) | 1950726 Number of splices: GT/AG | 2030213 Number of splices: GC/AG | 23419 Number of splices: AT/AC | 1408 Number of splices: Non-canonical | 1507 Mismatch rate per base, % | 0.23% Deletion rate per base | 0.00% Deletion average length | 1.50 Insertion rate per base | 0.00% Insertion average length | 1.44 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 161030 % of reads mapped to multiple loci | 2.69% Number of reads mapped to too many loci | 98088 % of reads mapped to too many loci | 1.64% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 8.31% % of reads unmapped: other | 0.24% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 609200 609200 609200 N_multimapping 161030 161030 161030 N_noFeature 377684 2783976 2739178 N_ambiguous 75960 6324 6898 UnstrandedReadsAssigned:4755078 PositiveStrandReadsAssigned:2418422 NegativeStrandReadsAssigned:2462646 Dataset is classified unstranded MeadianReadLen=101 20thPercentileLength=100 echo kmer=95 SRR21853509 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR21853509-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 5,978,952 reads, 4,940,583 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,246 rounds 52973 SRR21853509.ke.tsv 35125 SRR21853509.se.tsv 88098 total ==> SRR21853509.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 0 0 PNS24247 1044 945 28.2491 12.103 PNS24249 1928 1829 16.4473 3.64085 PNS24246 1044 945 28.2491 12.103 PNS24248 1044 945 28.2491 12.103 PNS24244 1471 1372 12.8055 3.77888 PNS24243 293 194 12 25.0438 KQK14069 1603 1504 879.694 236.813 KQK14071 474 375 186.568 201.431 ==> SRR21853509.se.tsv <== BRADI_1g14170v3 1332 BRADI_1g53295v3 64 BRADI_1g59795v3 243 BRADI_1g07683v3 0 BRADI_1g00485v3 26 BRADI_1g20270v3 60 BRADI_1g74790v3 23 BRADI_1g09890v3 0 BRADI_1g77505v3 82 BRADI_1g48960v3 0 SRR21853509 completed mapping pipeline successfully