Starting /dee2/code/volunteer_pipeline.sh SRR21853510 current disk space = 1550577188864 free memory = 1599496776 SRR21853510 SRAfilesize 36d66d469a4573d0c888eb6bcada024e SRR21853510.sra SRR21853510.sra file validated SRR21853510 is single end SRR21853510 is conventional basespace SRR21853510 read1 length is 79-101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR21853510_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 79-101 %GC 46 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.265 37.0 37.0 37.0 37.0 37.0 2 34.891 37.0 37.0 37.0 25.0 37.0 3 35.5835 37.0 37.0 37.0 37.0 37.0 4 35.628 37.0 37.0 37.0 37.0 37.0 5 35.849 37.0 37.0 37.0 37.0 37.0 6 35.816 37.0 37.0 37.0 37.0 37.0 7 35.606 37.0 37.0 37.0 37.0 37.0 8 35.7365 37.0 37.0 37.0 37.0 37.0 9 35.748 37.0 37.0 37.0 37.0 37.0 10-11 35.9955 37.0 37.0 37.0 37.0 37.0 12-13 35.7525 37.0 37.0 37.0 37.0 37.0 14-15 35.852000000000004 37.0 37.0 37.0 37.0 37.0 16-17 35.86 37.0 37.0 37.0 37.0 37.0 18-19 35.83275 37.0 37.0 37.0 37.0 37.0 20-21 35.84225 37.0 37.0 37.0 37.0 37.0 22-23 35.686 37.0 37.0 37.0 37.0 37.0 24-25 35.7405 37.0 37.0 37.0 37.0 37.0 26-27 35.74875 37.0 37.0 37.0 37.0 37.0 28-29 35.6115 37.0 37.0 37.0 37.0 37.0 30-31 35.62 37.0 37.0 37.0 37.0 37.0 32-33 35.61175 37.0 37.0 37.0 37.0 37.0 34-35 35.6625 37.0 37.0 37.0 37.0 37.0 36-37 35.55775 37.0 37.0 37.0 37.0 37.0 38-39 35.54675 37.0 37.0 37.0 37.0 37.0 40-41 35.58725 37.0 37.0 37.0 37.0 37.0 42-43 35.56825 37.0 37.0 37.0 37.0 37.0 44-45 35.51625 37.0 37.0 37.0 37.0 37.0 46-47 35.3785 37.0 37.0 37.0 37.0 37.0 48-49 35.53425 37.0 37.0 37.0 37.0 37.0 50-51 35.553250000000006 37.0 37.0 37.0 37.0 37.0 52-53 35.523250000000004 37.0 37.0 37.0 37.0 37.0 54-55 35.485749999999996 37.0 37.0 37.0 37.0 37.0 56-57 35.71275 37.0 37.0 37.0 37.0 37.0 58-59 35.5385 37.0 37.0 37.0 37.0 37.0 60-61 35.5205 37.0 37.0 37.0 37.0 37.0 62-63 35.44 37.0 37.0 37.0 37.0 37.0 64-65 35.48675 37.0 37.0 37.0 37.0 37.0 66-67 35.37475 37.0 37.0 37.0 37.0 37.0 68-69 35.312 37.0 37.0 37.0 31.0 37.0 70-71 35.426500000000004 37.0 37.0 37.0 37.0 37.0 72-73 35.37875 37.0 37.0 37.0 37.0 37.0 74-75 35.385000000000005 37.0 37.0 37.0 37.0 37.0 76-77 35.338750000000005 37.0 37.0 37.0 37.0 37.0 78-79 35.232 37.0 37.0 37.0 31.0 37.0 80-81 35.300325081270316 37.0 37.0 37.0 31.0 37.0 82-83 35.309577394348594 37.0 37.0 37.0 37.0 37.0 84-85 35.264132066033014 37.0 37.0 37.0 31.0 37.0 86-87 35.307730798098575 37.0 37.0 37.0 25.0 37.0 88-89 35.253253253253256 37.0 37.0 37.0 31.0 37.0 90-91 35.237487487487485 37.0 37.0 37.0 25.0 37.0 92-93 35.28308641641141 37.0 37.0 37.0 31.0 37.0 94-95 35.131947921882826 37.0 37.0 37.0 25.0 37.0 96-97 35.229557811490054 37.0 37.0 37.0 31.0 37.0 98-99 35.15054395286597 37.0 37.0 37.0 25.0 37.0 100-101 35.090292441615134 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100-101 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 1.0 22 0.0 23 2.0 24 8.0 25 11.0 26 11.0 27 25.0 28 31.0 29 63.0 30 59.0 31 98.0 32 156.0 33 192.0 34 276.0 35 500.0 36 2185.0 37 382.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 22.575 16.3 14.224999999999998 46.9 2 20.56881665820213 22.14321990858304 39.512442864398174 17.775520568816656 3 21.475 27.800000000000004 26.0 24.725 4 22.975 31.075000000000003 21.175 24.775 5 25.724999999999998 34.1 22.375 17.8 6 20.775 36.175000000000004 23.175 19.875 7 18.05 17.349999999999998 43.075 21.525 8 20.025000000000002 23.549999999999997 29.45 26.974999999999998 9 19.925 22.125 32.35 25.6 10-11 23.1 30.675 22.175 24.05 12-13 22.225 25.6125 27.474999999999998 24.6875 14-15 22.75 25.7125 27.1125 24.425 16-17 23.1 28.1125 25.324999999999996 23.4625 18-19 23.775 26.2875 26.0625 23.875 20-21 23.150000000000002 27.6 25.7375 23.5125 22-23 23.724999999999998 27.6875 25.8625 22.725 24-25 22.975 27.725 25.7625 23.5375 26-27 21.675 27.762500000000003 28.1625 22.400000000000002 28-29 23.2875 26.987499999999997 26.575 23.150000000000002 30-31 22.3125 27.3875 27.187499999999996 23.1125 32-33 21.85 28.125 26.4625 23.5625 34-35 22.7625 28.012500000000003 25.8125 23.4125 36-37 22.55 27.212500000000002 26.525 23.7125 38-39 23.3125 26.787499999999998 27.474999999999998 22.425 40-41 22.237499999999997 28.025 26.4625 23.275000000000002 42-43 22.787499999999998 27.1375 26.575 23.5 44-45 22.5 27.474999999999998 26.387500000000003 23.6375 46-47 22.3375 27.05 27.8375 22.775000000000002 48-49 21.875 27.900000000000002 27.187499999999996 23.0375 50-51 21.8125 28.95 26.6625 22.575 52-53 22.675 27.6 26.5 23.225 54-55 22.650000000000002 26.437500000000004 27.187499999999996 23.724999999999998 56-57 22.5875 27.3 27.474999999999998 22.6375 58-59 22.725 27.375 26.875 23.025000000000002 60-61 23.225 28.5875 25.1875 23.0 62-63 22.675 27.287499999999998 26.3625 23.674999999999997 64-65 22.5 27.0625 27.775 22.662499999999998 66-67 23.625 27.0 26.9125 22.4625 68-69 23.474999999999998 27.425 26.2875 22.8125 70-71 23.1 26.424999999999997 27.0625 23.4125 72-73 22.7125 26.887499999999996 28.075 22.325 74-75 23.3375 26.937499999999996 26.575 23.150000000000002 76-77 23.225 26.8 26.937499999999996 23.0375 78-79 22.9375 26.8 27.462500000000002 22.8 80-81 22.793198299574893 26.76919229807452 27.406851712928233 23.030757689422355 82-83 23.080770192548137 26.71917979494874 26.994248562140534 23.20580145036259 84-85 22.723861930965484 26.538269134567283 27.41370685342671 23.32416208104052 86-87 22.692019014260694 26.932699524643482 26.882661996497376 23.492619464598448 88-89 23.1981981981982 27.177177177177175 26.776776776776778 22.84784784784785 90-91 22.047047047047048 28.766266266266268 26.976976976976978 22.20970970970971 92-93 23.67959949937422 27.37171464330413 26.29536921151439 22.65331664580726 94-95 22.934401602403607 26.43965948923385 26.639959939909865 23.985978968452677 96-97 22.612183504637752 27.412885434946098 27.337678616194534 22.63725244422161 98-99 22.859327217125383 26.006625891946992 28.402140672782878 22.73190621814475 100-101 23.911630929174787 12.849252761533464 33.91812865497076 29.32098765432099 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 6.0 1 4.0 2 3.5 3 4.5 4 2.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.5 10 1.0 11 0.5 12 0.5 13 0.5 14 0.0 15 0.5 16 0.5 17 0.0 18 1.5 19 1.5 20 1.0 21 2.5 22 4.5 23 4.5 24 3.5 25 4.0 26 6.0 27 6.0 28 9.0 29 12.0 30 13.5 31 16.5 32 26.0 33 41.5 34 44.0 35 61.5 36 76.5 37 85.5 38 107.0 39 134.0 40 167.0 41 188.0 42 199.0 43 211.5 44 220.5 45 219.0 46 225.5 47 222.5 48 207.5 49 191.5 50 170.5 51 143.0 52 125.5 53 114.5 54 102.0 55 92.5 56 72.5 57 60.0 58 59.5 59 45.5 60 33.5 61 34.0 62 29.5 63 30.0 64 24.5 65 20.5 66 18.0 67 14.5 68 16.0 69 14.0 70 11.0 71 8.0 72 6.0 73 3.5 74 4.5 75 4.5 76 3.0 77 3.0 78 2.5 79 1.5 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 1.55 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 79 1.0 80 0.0 81 0.0 82 0.0 83 1.0 84 0.0 85 1.0 86 0.0 87 1.0 88 0.0 89 0.0 90 0.0 91 0.0 92 2.0 93 0.0 94 0.0 95 1.0 96 8.0 97 20.0 98 82.0 99 288.0 100 1034.0 101 2561.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.95 #Duplication Level Percentage of deduplicated Percentage of total 1 93.19526627218934 86.625 2 6.374394835933297 11.85 3 0.34965034965034963 0.975 4 0.026896180742334585 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.026896180742334585 0.2 9 0.0 0.0 >10 0.026896180742334585 0.25 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT 10 0.25 No Hit AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA 8 0.2 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 676620 spots for SRR21853510.sra Written 676620 spots for SRR21853510.sra Read 676620 spots for SRR21853510.sra Written 676620 spots for SRR21853510.sra Read 676620 spots for SRR21853510.sra Written 676620 spots for SRR21853510.sra Read 676620 spots for SRR21853510.sra Written 676620 spots for SRR21853510.sra Read 676620 spots for SRR21853510.sra Written 676620 spots for SRR21853510.sra Read 676620 spots for SRR21853510.sra Written 676620 spots for SRR21853510.sra Read 676620 spots for SRR21853510.sra Written 676620 spots for SRR21853510.sra Read 676620 spots for SRR21853510.sra Written 676620 spots for SRR21853510.sra Read 676620 spots for SRR21853510.sra Written 676620 spots for SRR21853510.sra Read 676634 spots for SRR21853510.sra Written 676634 spots for SRR21853510.sra Read 676620 spots for SRR21853510.sra Written 676620 spots for SRR21853510.sra Read 676620 spots for SRR21853510.sra Written 676620 spots for SRR21853510.sra Read 676620 spots for SRR21853510.sra Written 676620 spots for SRR21853510.sra Read 676620 spots for SRR21853510.sra Written 676620 spots for SRR21853510.sra Read 676620 spots for SRR21853510.sra Written 676620 spots for SRR21853510.sra Read 676620 spots for SRR21853510.sra Written 676620 spots for SRR21853510.sra Read 676620 spots for SRR21853510.sra Written 676620 spots for SRR21853510.sra Read 676620 spots for SRR21853510.sra Written 676620 spots for SRR21853510.sra Read 676620 spots for SRR21853510.sra Written 676620 spots for SRR21853510.sra Read 676620 spots for SRR21853510.sra Written 676620 spots for SRR21853510.sra SRR ids: ['SRR21853510.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_1q22_xkq SRR21853510.sra spots: 13532414 blocks: [[1, 676620], [676621, 1353240], [1353241, 2029860], [2029861, 2706480], [2706481, 3383100], [3383101, 4059720], [4059721, 4736340], [4736341, 5412960], [5412961, 6089580], [6089581, 6766200], [6766201, 7442820], [7442821, 8119440], [8119441, 8796060], [8796061, 9472680], [9472681, 10149300], [10149301, 10825920], [10825921, 11502540], [11502541, 12179160], [12179161, 12855780], [12855781, 13532414]] SRR21853510 file size 3640698 SRR21853510 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR21853510 SRR21853510_1.fastq Input file: SRR21853510_1.fastq trimmed: SRR21853510-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Fri Dec 6 16:37:18 2024 >> started Fri Dec 6 16:37:32 2024 >> done (13.400s) 13532414 reads processed; of these: 24 ( 0.00%) short reads filtered out after trimming by size control 22005 ( 0.16%) empty reads filtered out after trimming by size control 13510385 (99.84%) reads available; of these: 175 ( 0.00%) trimmed reads available after processing 13510210 (100.00%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 19 1 0.00% 20 2 0.00% 21 0 0.00% 22 0 0.00% 23 2 0.00% 24 0 0.00% 25 3 0.00% 26 1 0.00% 27 3 0.00% 28 0 0.00% 29 4 0.00% 30 2 0.00% 31 3 0.00% 32 1 0.00% 33 1 0.00% 34 2 0.00% 35 62 0.00% 36 52 0.00% 37 57 0.00% 38 63 0.00% 39 49 0.00% 40 66 0.00% 41 68 0.00% 42 67 0.00% 43 70 0.00% 44 76 0.00% 45 74 0.00% 46 70 0.00% 47 80 0.00% 48 95 0.00% 49 87 0.00% 50 98 0.00% 51 100 0.00% 52 104 0.00% 53 98 0.00% 54 91 0.00% 55 100 0.00% 56 137 0.00% 57 112 0.00% 58 121 0.00% 59 142 0.00% 60 142 0.00% 61 149 0.00% 62 180 0.00% 63 191 0.00% 64 189 0.00% 65 190 0.00% 66 186 0.00% 67 185 0.00% 68 265 0.00% 69 192 0.00% 70 226 0.00% 71 258 0.00% 72 249 0.00% 73 307 0.00% 74 258 0.00% 75 286 0.00% 76 300 0.00% 77 363 0.00% 78 403 0.00% 79 367 0.00% 80 460 0.00% 81 465 0.00% 82 513 0.00% 83 584 0.00% 84 555 0.00% 85 610 0.00% 86 637 0.00% 87 680 0.01% 88 772 0.01% 89 844 0.01% 90 993 0.01% 91 1597 0.01% 92 1180 0.01% 93 1360 0.01% 94 1645 0.01% 95 3630 0.03% 96 19218 0.14% 97 76215 0.56% 98 277997 2.06% 99 917648 6.79% 100 3440480 25.47% 101 8755252 64.80% 13510385 reads passed initial QC criterion=sequence-density sequence-density=0.09 sequence-density-rank=1 fanout-score=1.99 fanout-score-rank=23 prefix-density=0.09 prefix-fanout=2.0 sequence=CCGTCAATTCCTTT criterion=fanout-score sequence-density=0.03 sequence-density-rank=8 fanout-score=70.66 fanout-score-rank=1 prefix-density=0.19 prefix-fanout=12.9 sequence=CGCCGCCGCCGC Started job on | Dec 06 16:38:01 Started mapping on | Dec 06 16:38:01 Finished on | Dec 06 16:38:46 Mapping speed, Million of reads per hour | 1080.83 Number of input reads | 13510385 Average input read length | 100 UNIQUE READS: Uniquely mapped reads number | 11760900 Uniquely mapped reads % | 87.05% Average mapped length | 100.23 Number of splices: Total | 4636429 Number of splices: Annotated (sjdb) | 4395057 Number of splices: GT/AG | 4576399 Number of splices: GC/AG | 53317 Number of splices: AT/AC | 3096 Number of splices: Non-canonical | 3617 Mismatch rate per base, % | 0.26% Deletion rate per base | 0.00% Deletion average length | 1.51 Insertion rate per base | 0.00% Insertion average length | 1.43 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 372487 % of reads mapped to multiple loci | 2.76% Number of reads mapped to too many loci | 246688 % of reads mapped to too many loci | 1.83% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 8.12% % of reads unmapped: other | 0.25% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1376998 1376998 1376998 N_multimapping 372487 372487 372487 N_noFeature 826559 6241248 6198177 N_ambiguous 175523 14082 14658 UnstrandedReadsAssigned:10758818 PositiveStrandReadsAssigned:5505570 NegativeStrandReadsAssigned:5548065 Dataset is classified unstranded MeadianReadLen=101 20thPercentileLength=100 echo kmer=95 SRR21853510 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR21853510-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,510,385 reads, 11,169,781 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,125 rounds 52973 SRR21853510.ke.tsv 35125 SRR21853510.se.tsv 88098 total ==> SRR21853510.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 0 0 PNS24247 1044 945 56.6996 10.5605 PNS24249 1928 1829 40.8039 3.92667 PNS24246 1044 945 56.6996 10.5605 PNS24248 1044 945 56.6996 10.5605 PNS24244 1471 1372 79.0973 10.1471 PNS24243 293 194 36 32.6616 KQK14069 1603 1504 2103.21 246.134 KQK14071 474 375 496.859 233.205 ==> SRR21853510.se.tsv <== BRADI_1g14170v3 3391 BRADI_1g53295v3 123 BRADI_1g59795v3 587 BRADI_1g07683v3 0 BRADI_1g00485v3 56 BRADI_1g20270v3 117 BRADI_1g74790v3 98 BRADI_1g09890v3 0 BRADI_1g77505v3 186 BRADI_1g48960v3 0 SRR21853510 completed mapping pipeline successfully