Starting /dee2/code/volunteer_pipeline.sh SRR21853511 current disk space = 1550617423872 free memory = 1599029516 SRR21853511 SRAfilesize 411a7508272316b70927e4c0032deee4 SRR21853511.sra SRR21853511.sra file validated SRR21853511 is single end SRR21853511 is conventional basespace SRR21853511 read1 length is 55-101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR21853511_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 55-101 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.083 37.0 37.0 37.0 25.0 37.0 2 34.523 37.0 37.0 37.0 25.0 37.0 3 35.58 37.0 37.0 37.0 37.0 37.0 4 35.587 37.0 37.0 37.0 37.0 37.0 5 35.8405 37.0 37.0 37.0 37.0 37.0 6 35.8025 37.0 37.0 37.0 37.0 37.0 7 35.6815 37.0 37.0 37.0 37.0 37.0 8 35.916 37.0 37.0 37.0 37.0 37.0 9 35.86 37.0 37.0 37.0 37.0 37.0 10-11 35.94 37.0 37.0 37.0 37.0 37.0 12-13 35.807 37.0 37.0 37.0 37.0 37.0 14-15 35.83475 37.0 37.0 37.0 37.0 37.0 16-17 35.81375 37.0 37.0 37.0 37.0 37.0 18-19 35.83925 37.0 37.0 37.0 37.0 37.0 20-21 35.75975 37.0 37.0 37.0 37.0 37.0 22-23 35.7505 37.0 37.0 37.0 37.0 37.0 24-25 35.83225 37.0 37.0 37.0 37.0 37.0 26-27 35.801 37.0 37.0 37.0 37.0 37.0 28-29 35.77275 37.0 37.0 37.0 37.0 37.0 30-31 35.628 37.0 37.0 37.0 37.0 37.0 32-33 35.615750000000006 37.0 37.0 37.0 37.0 37.0 34-35 35.69175 37.0 37.0 37.0 37.0 37.0 36-37 35.561 37.0 37.0 37.0 37.0 37.0 38-39 35.577749999999995 37.0 37.0 37.0 37.0 37.0 40-41 35.71025 37.0 37.0 37.0 37.0 37.0 42-43 35.64725 37.0 37.0 37.0 37.0 37.0 44-45 35.610749999999996 37.0 37.0 37.0 37.0 37.0 46-47 35.65325 37.0 37.0 37.0 37.0 37.0 48-49 35.5985 37.0 37.0 37.0 37.0 37.0 50-51 35.586749999999995 37.0 37.0 37.0 37.0 37.0 52-53 35.60850000000001 37.0 37.0 37.0 37.0 37.0 54-55 35.57225 37.0 37.0 37.0 37.0 37.0 56-57 35.53413353338334 37.0 37.0 37.0 37.0 37.0 58-59 35.63690922730683 37.0 37.0 37.0 37.0 37.0 60-61 35.53351675837919 37.0 37.0 37.0 37.0 37.0 62-63 35.49874937468734 37.0 37.0 37.0 37.0 37.0 64-65 35.57228614307154 37.0 37.0 37.0 37.0 37.0 66-67 35.427070302727046 37.0 37.0 37.0 37.0 37.0 68-69 35.45308981736302 37.0 37.0 37.0 37.0 37.0 70-71 35.513635226419815 37.0 37.0 37.0 37.0 37.0 72-73 35.40555416562422 37.0 37.0 37.0 37.0 37.0 74-75 35.47210407805854 37.0 37.0 37.0 37.0 37.0 76-77 35.36105319730539 37.0 37.0 37.0 31.0 37.0 78-79 35.43743743743744 37.0 37.0 37.0 37.0 37.0 80-81 35.4342928660826 37.0 37.0 37.0 37.0 37.0 82-83 35.45443164747121 37.0 37.0 37.0 37.0 37.0 84-85 35.3908872324264 37.0 37.0 37.0 37.0 37.0 86-87 35.351791530944624 37.0 37.0 37.0 37.0 37.0 88-89 35.35051563565099 37.0 37.0 37.0 37.0 37.0 90-91 35.33054310913679 37.0 37.0 37.0 31.0 37.0 92-93 35.310491967871485 37.0 37.0 37.0 31.0 37.0 94-95 35.35547090445639 37.0 37.0 37.0 37.0 37.0 96-97 35.25939733725137 37.0 37.0 37.0 31.0 37.0 98-99 35.32949514652408 37.0 37.0 37.0 37.0 37.0 100-101 35.12879460895976 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100-101 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 1.0 23 1.0 24 6.0 25 8.0 26 15.0 27 23.0 28 29.0 29 60.0 30 89.0 31 110.0 32 109.0 33 163.0 34 239.0 35 509.0 36 2208.0 37 430.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 23.425 14.000000000000002 18.425 44.15 2 25.35677879714577 20.23445463812436 30.045871559633024 24.362895005096842 3 26.974999999999998 21.175 22.025 29.825000000000003 4 27.825 25.575 17.325 29.275000000000002 5 29.225 29.5 21.8 19.475 6 23.05 33.7 20.25 23.0 7 20.150000000000002 19.525000000000002 37.425000000000004 22.900000000000002 8 20.349999999999998 23.674999999999997 28.050000000000004 27.925 9 21.9 22.75 29.275000000000002 26.075 10-11 26.375 28.6875 21.675 23.2625 12-13 22.112499999999997 25.5 26.224999999999998 26.1625 14-15 24.075 24.887500000000003 25.4375 25.6 16-17 24.85 25.137500000000003 24.5375 25.474999999999998 18-19 23.9375 25.362499999999997 26.3 24.4 20-21 24.9375 25.25 25.2125 24.6 22-23 24.025 25.825 25.05 25.1 24-25 24.725 26.025 24.7875 24.462500000000002 26-27 24.0125 26.775 24.0625 25.15 28-29 24.3625 25.8625 24.637500000000003 25.137500000000003 30-31 23.5875 26.125 24.725 25.5625 32-33 24.675 25.887500000000003 25.324999999999996 24.1125 34-35 23.849999999999998 26.325 24.65 25.174999999999997 36-37 24.2625 26.187500000000004 25.087500000000002 24.462500000000002 38-39 24.875 25.7 25.724999999999998 23.7 40-41 23.7 27.1375 24.837500000000002 24.325 42-43 23.7125 25.687500000000004 25.174999999999997 25.424999999999997 44-45 24.25 25.575 24.825 25.35 46-47 24.75 25.775 25.5125 23.962500000000002 48-49 24.1375 25.2375 25.7625 24.8625 50-51 24.25 25.724999999999998 25.387500000000003 24.637500000000003 52-53 24.1625 26.150000000000002 24.8625 24.825 54-55 23.65 26.087500000000002 25.6125 24.65 56-57 24.69367341835459 25.243810952738183 25.618904726181547 24.44361090272568 58-59 24.131032758189548 25.506376594148538 25.431357839459867 24.93123280820205 60-61 23.19909954977489 26.425712856428213 25.137568784392194 25.237618809404704 62-63 24.212106053026513 25.57528764382191 26.038019009504755 24.174587293646823 64-65 24.949974987493746 25.72536268134067 24.487243621810904 24.83741870935468 66-67 24.31823867900926 26.044533400050035 25.293970477858394 24.34325744308231 68-69 23.992994746059544 25.41906429822367 25.369026770077557 25.21891418563923 70-71 23.8804103077308 26.069552164123095 24.83112334250688 25.21891418563923 72-73 23.855391543657746 26.169627220415308 25.64423317488116 24.330748061045785 74-75 24.143107330497873 25.519139354515886 26.932699524643482 23.405053790342755 76-77 24.846740898286 24.934317527836857 24.97185036907294 25.247091204804207 78-79 24.46196196196196 25.513013013013015 25.63813813813814 24.386886886886888 80-81 24.367959949937422 25.869837296620773 25.619524405506883 24.14267834793492 82-83 24.56184276414622 25.801201802704053 25.237856785177765 24.399098647971957 84-85 24.452234881682735 25.41630148992112 25.96719669462877 24.164266933767372 86-87 24.392382861438236 25.457278877474316 25.695314457529438 24.455023803558003 88-89 25.02193807195688 24.633320797292217 24.996865989720447 25.347875141030464 90-91 24.601880877742946 25.630094043887148 26.11912225705329 23.648902821316614 92-93 25.08785140562249 25.07530120481928 25.08785140562249 24.748995983935743 94-95 24.87762018325593 25.79389983682691 25.530312539224298 23.798167440692858 96-97 24.968585071626038 26.187484292535814 24.981151042975622 23.86277959286253 98-99 25.28691660290742 25.01912777352716 25.822494261667945 23.871461361897474 100-101 26.547962784728906 11.276868784087263 31.29611806223933 30.8790503689445 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 2.0 21 2.0 22 1.5 23 1.0 24 1.5 25 2.0 26 4.0 27 5.5 28 6.0 29 10.0 30 12.5 31 18.5 32 21.0 33 18.5 34 24.5 35 38.5 36 51.5 37 64.5 38 85.0 39 110.5 40 132.5 41 151.0 42 167.0 43 189.5 44 199.5 45 194.5 46 196.0 47 189.0 48 181.0 49 169.0 50 149.0 51 142.5 52 141.5 53 122.0 54 105.0 55 99.5 56 87.0 57 82.5 58 74.5 59 68.0 60 71.0 61 55.0 62 53.5 63 54.5 64 49.5 65 56.5 66 50.5 67 41.0 68 37.5 69 41.5 70 36.5 71 21.0 72 20.5 73 19.5 74 17.5 75 14.5 76 9.5 77 10.5 78 9.5 79 6.0 80 2.0 81 3.0 82 2.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 1.9 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 55 1.0 56 0.0 57 0.0 58 0.0 59 1.0 60 0.0 61 0.0 62 0.0 63 0.0 64 0.0 65 1.0 66 0.0 67 0.0 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 1.0 77 0.0 78 0.0 79 1.0 80 0.0 81 1.0 82 0.0 83 0.0 84 1.0 85 2.0 86 0.0 87 2.0 88 1.0 89 0.0 90 1.0 91 3.0 92 0.0 93 0.0 94 1.0 95 2.0 96 4.0 97 18.0 98 76.0 99 283.0 100 966.0 101 2634.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.22500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 93.18852239206221 86.875 2 6.516492357200322 12.15 3 0.2145347278090641 0.6 4 0.053633681952266025 0.2 5 0.0 0.0 6 0.0 0.0 7 0.026816840976133013 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACTCCGCGAAATCTCGTAT 7 0.17500000000000002 TruSeq Adapter, Index 6 (97% over 36bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1229387 spots for SRR21853511.sra Written 1229387 spots for SRR21853511.sra Read 1229387 spots for SRR21853511.sra Written 1229387 spots for SRR21853511.sra Read 1229387 spots for SRR21853511.sra Written 1229387 spots for SRR21853511.sra Read 1229387 spots for SRR21853511.sra Written 1229387 spots for SRR21853511.sra Read 1229387 spots for SRR21853511.sra Written 1229387 spots for SRR21853511.sra Read 1229387 spots for SRR21853511.sra Written 1229387 spots for SRR21853511.sra Read 1229387 spots for SRR21853511.sra Written 1229387 spots for SRR21853511.sra Read 1229387 spots for SRR21853511.sra Written 1229387 spots for SRR21853511.sra Read 1229387 spots for SRR21853511.sra Written 1229387 spots for SRR21853511.sra Read 1229387 spots for SRR21853511.sra Written 1229387 spots for SRR21853511.sra Read 1229387 spots for SRR21853511.sra Written 1229387 spots for SRR21853511.sra Read 1229387 spots for SRR21853511.sra Written 1229387 spots for SRR21853511.sra Read 1229387 spots for SRR21853511.sra Written 1229387 spots for SRR21853511.sra Read 1229387 spots for SRR21853511.sra Written 1229387 spots for SRR21853511.sra Read 1229387 spots for SRR21853511.sra Written 1229387 spots for SRR21853511.sra Read 1229387 spots for SRR21853511.sra Written 1229387 spots for SRR21853511.sra Read 1229387 spots for SRR21853511.sra Written 1229387 spots for SRR21853511.sra Read 1229399 spots for SRR21853511.sra Written 1229399 spots for SRR21853511.sra Read 1229387 spots for SRR21853511.sra Written 1229387 spots for SRR21853511.sra Read 1229387 spots for SRR21853511.sra Written 1229387 spots for SRR21853511.sra SRR ids: ['SRR21853511.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_sca5tlz2 SRR21853511.sra spots: 24587752 blocks: [[1, 1229387], [1229388, 2458774], [2458775, 3688161], [3688162, 4917548], [4917549, 6146935], [6146936, 7376322], [7376323, 8605709], [8605710, 9835096], [9835097, 11064483], [11064484, 12293870], [12293871, 13523257], [13523258, 14752644], [14752645, 15982031], [15982032, 17211418], [17211419, 18440805], [18440806, 19670192], [19670193, 20899579], [20899580, 22128966], [22128967, 23358353], [23358354, 24587752]] SRR21853511 file size 6624053 SRR21853511 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR21853511 SRR21853511_1.fastq Input file: SRR21853511_1.fastq trimmed: SRR21853511-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Fri Dec 6 16:42:31 2024 >> started Fri Dec 6 16:42:44 2024 >> done (12.714s) 24587752 reads processed; of these: 10 ( 0.00%) short reads filtered out after trimming by size control 40602 ( 0.17%) empty reads filtered out after trimming by size control 24547140 (99.83%) reads available; of these: 472 ( 0.00%) trimmed reads available after processing 24546668 (100.00%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 0 0.00% 20 3 0.00% 21 4 0.00% 22 0 0.00% 23 2 0.00% 24 1 0.00% 25 3 0.00% 26 5 0.00% 27 3 0.00% 28 2 0.00% 29 7 0.00% 30 6 0.00% 31 10 0.00% 32 10 0.00% 33 9 0.00% 34 6 0.00% 35 75 0.00% 36 74 0.00% 37 104 0.00% 38 87 0.00% 39 103 0.00% 40 95 0.00% 41 106 0.00% 42 106 0.00% 43 108 0.00% 44 92 0.00% 45 117 0.00% 46 126 0.00% 47 155 0.00% 48 169 0.00% 49 192 0.00% 50 151 0.00% 51 186 0.00% 52 182 0.00% 53 189 0.00% 54 206 0.00% 55 175 0.00% 56 212 0.00% 57 262 0.00% 58 260 0.00% 59 312 0.00% 60 345 0.00% 61 460 0.00% 62 410 0.00% 63 403 0.00% 64 421 0.00% 65 441 0.00% 66 446 0.00% 67 498 0.00% 68 601 0.00% 69 672 0.00% 70 744 0.00% 71 837 0.00% 72 862 0.00% 73 912 0.00% 74 978 0.00% 75 1115 0.00% 76 1110 0.00% 77 1224 0.00% 78 1356 0.01% 79 1532 0.01% 80 1751 0.01% 81 1869 0.01% 82 2099 0.01% 83 2407 0.01% 84 2492 0.01% 85 2687 0.01% 86 2899 0.01% 87 3217 0.01% 88 3477 0.01% 89 3925 0.02% 90 4427 0.02% 91 5415 0.02% 92 5232 0.02% 93 5878 0.02% 94 7284 0.03% 95 11837 0.05% 96 40948 0.17% 97 132607 0.54% 98 490936 2.00% 99 1662004 6.77% 100 5840015 23.79% 101 16294450 66.38% 24547140 reads passed initial QC criterion=sequence-density sequence-density=0.07 sequence-density-rank=1 fanout-score=179.64 fanout-score-rank=14 prefix-density=0.54 prefix-fanout=22.4 sequence=CGCCGCCGCCGC criterion=fanout-score sequence-density=0.04 sequence-density-rank=25 fanout-score=321.54 fanout-score-rank=1 prefix-density=0.54 prefix-fanout=22.4 sequence=CGCCGCCGCCGA Started job on | Dec 06 16:43:32 Started mapping on | Dec 06 16:43:34 Finished on | Dec 06 16:44:17 Mapping speed, Million of reads per hour | 2055.11 Number of input reads | 24547140 Average input read length | 92 UNIQUE READS: Uniquely mapped reads number | 21866527 Uniquely mapped reads % | 89.08% Average mapped length | 92.25 Number of splices: Total | 7381691 Number of splices: Annotated (sjdb) | 6978593 Number of splices: GT/AG | 7281951 Number of splices: GC/AG | 86311 Number of splices: AT/AC | 4636 Number of splices: Non-canonical | 8793 Mismatch rate per base, % | 0.29% Deletion rate per base | 0.00% Deletion average length | 1.76 Insertion rate per base | 0.00% Insertion average length | 1.69 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 314969 % of reads mapped to multiple loci | 1.28% Number of reads mapped to too many loci | 157651 % of reads mapped to too many loci | 0.64% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 8.92% % of reads unmapped: other | 0.08% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2365644 2365644 2365644 N_multimapping 314969 314969 314969 N_noFeature 1179143 11246868 11484545 N_ambiguous 361749 25199 24594 UnstrandedReadsAssigned:20325635 PositiveStrandReadsAssigned:10594460 NegativeStrandReadsAssigned:10357388 Dataset is classified unstranded MeadianReadLen=93 20thPercentileLength=92 echo kmer=87 SRR21853511 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR21853511-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 24,547,140 reads, 20,831,985 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,257 rounds 52973 SRR21853511.ke.tsv 35125 SRR21853511.se.tsv 88098 total ==> SRR21853511.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 2.07043e-08 2.07192e-09 PNS24247 1044 945 112.646 9.98445 PNS24249 1928 1829 194.181 8.89267 PNS24246 1044 945 112.646 9.98445 PNS24248 1044 945 112.646 9.98445 PNS24244 1471 1372 148.88 9.08912 PNS24243 293 194 47 20.2925 KQK14069 1603 1504 11709.5 652.125 KQK14071 474 375 4276.63 955.234 ==> SRR21853511.se.tsv <== BRADI_1g14170v3 18766 BRADI_1g53295v3 193 BRADI_1g59795v3 778 BRADI_1g07683v3 0 BRADI_1g00485v3 64 BRADI_1g20270v3 255 BRADI_1g74790v3 378 BRADI_1g09890v3 0 BRADI_1g77505v3 457 BRADI_1g48960v3 0 SRR21853511 completed mapping pipeline successfully