Starting /dee2/code/volunteer_pipeline.sh SRR21853512 current disk space = 1550591729664 free memory = 1600000884 SRR21853512 SRAfilesize b2ae8241b9f5b0936afb52a8a52d0bd5 SRR21853512.sra SRR21853512.sra file validated SRR21853512 is single end SRR21853512 is conventional basespace SRR21853512 read1 length is 40-101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR21853512_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 40-101 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.369 37.0 37.0 37.0 37.0 37.0 2 34.59725 37.0 37.0 37.0 25.0 37.0 3 35.5405 37.0 37.0 37.0 37.0 37.0 4 35.7665 37.0 37.0 37.0 37.0 37.0 5 35.9805 37.0 37.0 37.0 37.0 37.0 6 35.955 37.0 37.0 37.0 37.0 37.0 7 35.7315 37.0 37.0 37.0 37.0 37.0 8 36.0265 37.0 37.0 37.0 37.0 37.0 9 35.9395 37.0 37.0 37.0 37.0 37.0 10-11 35.99575 37.0 37.0 37.0 37.0 37.0 12-13 35.96625 37.0 37.0 37.0 37.0 37.0 14-15 36.101749999999996 37.0 37.0 37.0 37.0 37.0 16-17 35.95825 37.0 37.0 37.0 37.0 37.0 18-19 35.9805 37.0 37.0 37.0 37.0 37.0 20-21 35.90425 37.0 37.0 37.0 37.0 37.0 22-23 35.933 37.0 37.0 37.0 37.0 37.0 24-25 35.912499999999994 37.0 37.0 37.0 37.0 37.0 26-27 35.7935 37.0 37.0 37.0 37.0 37.0 28-29 35.86225 37.0 37.0 37.0 37.0 37.0 30-31 35.846999999999994 37.0 37.0 37.0 37.0 37.0 32-33 35.8685 37.0 37.0 37.0 37.0 37.0 34-35 35.77475 37.0 37.0 37.0 37.0 37.0 36-37 35.74875 37.0 37.0 37.0 37.0 37.0 38-39 35.67275 37.0 37.0 37.0 37.0 37.0 40-41 35.73759533633408 37.0 37.0 37.0 37.0 37.0 42-43 35.75718929732433 37.0 37.0 37.0 37.0 37.0 44-45 35.757439359839964 37.0 37.0 37.0 37.0 37.0 46-47 35.74418604651163 37.0 37.0 37.0 37.0 37.0 48-49 35.62756378189094 37.0 37.0 37.0 37.0 37.0 50-51 35.72211105552776 37.0 37.0 37.0 37.0 37.0 52-53 35.71410705352676 37.0 37.0 37.0 37.0 37.0 54-55 35.65732866433217 37.0 37.0 37.0 37.0 37.0 56-57 35.59954977488744 37.0 37.0 37.0 37.0 37.0 58-59 35.62797097823368 37.0 37.0 37.0 37.0 37.0 60-61 35.67525644233175 37.0 37.0 37.0 37.0 37.0 62-63 35.600700525394046 37.0 37.0 37.0 37.0 37.0 64-65 35.640730547910934 37.0 37.0 37.0 37.0 37.0 66-67 35.63372529397048 37.0 37.0 37.0 37.0 37.0 68-69 35.669169169169166 37.0 37.0 37.0 37.0 37.0 70-71 35.58487731597396 37.0 37.0 37.0 37.0 37.0 72-73 35.561720712331024 37.0 37.0 37.0 37.0 37.0 74-75 35.547094188376754 37.0 37.0 37.0 37.0 37.0 76-77 35.53181362725451 37.0 37.0 37.0 37.0 37.0 78-79 35.58975292102622 37.0 37.0 37.0 37.0 37.0 80-81 35.574190713261274 37.0 37.0 37.0 37.0 37.0 82-83 35.558034595136625 37.0 37.0 37.0 37.0 37.0 84-85 35.52674984310684 37.0 37.0 37.0 37.0 37.0 86-87 35.46992948821768 37.0 37.0 37.0 37.0 37.0 88-89 35.54122803346052 37.0 37.0 37.0 37.0 37.0 90-91 35.587111283990225 37.0 37.0 37.0 37.0 37.0 92-93 35.59361381094402 37.0 37.0 37.0 37.0 37.0 94-95 35.51728399196997 37.0 37.0 37.0 37.0 37.0 96-97 35.489541283247675 37.0 37.0 37.0 37.0 37.0 98-99 35.541779850195 37.0 37.0 37.0 37.0 37.0 100-101 35.39334056063187 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100-101 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 1.0 21 1.0 22 1.0 23 0.0 24 5.0 25 4.0 26 15.0 27 26.0 28 30.0 29 40.0 30 51.0 31 91.0 32 99.0 33 169.0 34 254.0 35 486.0 36 2218.0 37 509.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 24.15 13.875000000000002 16.900000000000002 45.074999999999996 2 23.44190818158502 19.902539112592972 30.597589125416775 26.05796358040523 3 27.700000000000003 20.4 20.95 30.95 4 28.249999999999996 25.025 18.35 28.375 5 27.675 28.749999999999996 22.3 21.275 6 24.025 33.6 20.075000000000003 22.3 7 20.075000000000003 20.225 37.25 22.45 8 23.025000000000002 23.7 27.450000000000003 25.825 9 22.900000000000002 20.4 29.95 26.75 10-11 25.1 29.312500000000004 21.925 23.6625 12-13 23.400000000000002 24.8625 26.437500000000004 25.3 14-15 23.7375 24.95 26.6125 24.7 16-17 24.3125 25.3 25.587500000000002 24.8 18-19 23.1625 26.137500000000003 26.1 24.6 20-21 23.925 27.025 24.825 24.224999999999998 22-23 24.3125 25.474999999999998 25.374999999999996 24.837500000000002 24-25 23.474999999999998 26.174999999999997 25.525 24.825 26-27 24.75 25.95 25.174999999999997 24.125 28-29 23.974999999999998 25.9875 24.9875 25.05 30-31 24.375 26.7625 24.625 24.2375 32-33 24.825 25.9625 24.462500000000002 24.75 34-35 24.962500000000002 25.55 25.387500000000003 24.099999999999998 36-37 24.349999999999998 25.025 25.9625 24.6625 38-39 23.3375 26.375 25.7375 24.55 40-41 24.37804725590699 24.85310663832979 26.22827853481685 24.54056757094637 42-43 23.730932733183295 26.44411102775694 25.55638909727432 24.268567141785446 44-45 23.355838959739934 26.11902975743936 25.731432858214554 24.793698424606152 46-47 24.781195298824706 26.581645411352838 24.8062015503876 23.830957739434858 48-49 23.349174587293646 25.775387693846923 26.225612806403202 24.64982491245623 50-51 24.7623811905953 25.625312656328163 25.18759379689845 24.424712356178087 52-53 24.037018509254626 25.737868934467233 25.975487743871934 24.249624812406203 54-55 24.224612306153077 26.600800400200097 25.42521260630315 23.74937468734367 56-57 24.499749874937468 26.350675337668832 25.137568784392194 24.012006003001503 58-59 23.867900925694272 25.293970477858394 25.481611208406306 25.356517388041034 60-61 24.25569176882662 24.931198398799097 26.257192894671004 24.55591693770328 62-63 23.817863397548162 26.394796097072803 25.606705028771582 24.180635476607456 64-65 24.44333249937453 25.819364523392547 26.26970227670753 23.46760070052539 66-67 24.20565424068051 25.143857893420062 26.319739804853644 24.330748061045785 68-69 24.16166166166166 25.68818818818819 25.788288288288285 24.36186186186186 70-71 23.773159739609415 26.4271407110666 26.264396594892336 23.535302954431646 72-73 22.752316553969447 26.496368645128975 26.033057851239672 24.718256949661907 74-75 23.634769539078157 26.164829659318638 25.475951903807616 24.724448897795593 76-77 24.02304609218437 25.738977955911825 25.475951903807616 24.762024048096194 78-79 24.32669422522861 25.9050482274834 25.829888513090317 23.93836903419767 80-81 24.987468671679196 25.81453634085213 25.526315789473685 23.671679197994987 82-83 23.790423665078965 26.15943845575332 25.24442216094259 24.80571571822512 84-85 23.338349636318036 26.109857035364936 26.761976423375973 23.78981690494106 86-87 24.074306514371784 26.208108447345303 25.46755365884273 24.25003137944019 88-89 23.944723618090453 26.595477386934675 25.23869346733668 24.22110552763819 90-91 24.471565173628587 25.93105183694011 25.72974333165576 23.86763965777554 92-93 24.149231157045627 26.052432568691707 25.71212503150996 24.086211242752707 94-95 24.12225309421571 25.95352361707502 25.915635261429653 24.008588027279615 96-97 24.201318458417852 26.711460446247465 26.001521298174442 23.085699797160245 98-99 25.204518893650175 24.75003246331645 25.47721075185041 24.568237891182964 100-101 25.92531394580304 12.475214805023132 31.82419035029742 29.775280898876407 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 1.0 18 1.0 19 0.0 20 0.5 21 0.5 22 0.0 23 0.5 24 2.0 25 2.5 26 3.0 27 4.5 28 3.5 29 4.0 30 11.0 31 17.0 32 17.5 33 18.0 34 31.0 35 44.5 36 57.0 37 66.5 38 80.5 39 105.5 40 129.0 41 152.0 42 160.0 43 175.0 44 202.0 45 220.0 46 212.0 47 192.0 48 194.0 49 182.0 50 159.0 51 161.0 52 149.0 53 119.5 54 119.5 55 123.0 56 100.5 57 75.5 58 67.0 59 67.5 60 62.5 61 53.0 62 57.5 63 57.5 64 46.5 65 47.5 66 43.0 67 42.0 68 33.5 69 21.0 70 25.5 71 26.0 72 18.0 73 11.5 74 9.0 75 7.5 76 9.0 77 6.0 78 1.0 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 2.5250000000000004 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 40-41 1.0 42-43 0.0 44-45 0.0 46-47 1.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 1.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 1.0 68-69 2.0 70-71 0.0 72-73 2.0 74-75 0.0 76-77 0.0 78-79 1.0 80-81 2.0 82-83 1.0 84-85 3.0 86-87 4.0 88-89 4.0 90-91 8.0 92-93 6.0 94-95 14.0 96-97 43.0 98-99 384.0 100-101 3522.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.175 #Duplication Level Percentage of deduplicated Percentage of total 1 93.31902334317145 86.95 2 6.063858331097397 11.3 3 0.5902870941776227 1.6500000000000001 4 0.026831231553528307 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0125 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1555340 spots for SRR21853512.sra Written 1555340 spots for SRR21853512.sra Read 1555340 spots for SRR21853512.sra Written 1555340 spots for SRR21853512.sra Read 1555340 spots for SRR21853512.sra Written 1555340 spots for SRR21853512.sra Read 1555340 spots for SRR21853512.sra Written 1555340 spots for SRR21853512.sra Read 1555340 spots for SRR21853512.sra Written 1555340 spots for SRR21853512.sra Read 1555340 spots for SRR21853512.sra Written 1555340 spots for SRR21853512.sra Read 1555340 spots for SRR21853512.sra Written 1555340 spots for SRR21853512.sra Read 1555340 spots for SRR21853512.sra Written 1555340 spots for SRR21853512.sra Read 1555340 spots for SRR21853512.sra Written 1555340 spots for SRR21853512.sra Read 1555340 spots for SRR21853512.sra Written 1555340 spots for SRR21853512.sra Read 1555340 spots for SRR21853512.sra Written 1555340 spots for SRR21853512.sra Read 1555340 spots for SRR21853512.sra Written 1555340 spots for SRR21853512.sra Read 1555340 spots for SRR21853512.sra Written 1555340 spots for SRR21853512.sra Read 1555340 spots for SRR21853512.sra Written 1555340 spots for SRR21853512.sra Read 1555340 spots for SRR21853512.sra Written 1555340 spots for SRR21853512.sra Read 1555340 spots for SRR21853512.sra Written 1555340 spots for SRR21853512.sra Read 1555340 spots for SRR21853512.sra Written 1555340 spots for SRR21853512.sra Read 1555340 spots for SRR21853512.sra Written 1555340 spots for SRR21853512.sra Read 1555348 spots for SRR21853512.sra Written 1555348 spots for SRR21853512.sra Read 1555340 spots for SRR21853512.sra Written 1555340 spots for SRR21853512.sra SRR ids: ['SRR21853512.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_nz_uqv_e SRR21853512.sra spots: 31106808 blocks: [[1, 1555340], [1555341, 3110680], [3110681, 4666020], [4666021, 6221360], [6221361, 7776700], [7776701, 9332040], [9332041, 10887380], [10887381, 12442720], [12442721, 13998060], [13998061, 15553400], [15553401, 17108740], [17108741, 18664080], [18664081, 20219420], [20219421, 21774760], [21774761, 23330100], [23330101, 24885440], [24885441, 26440780], [26440781, 27996120], [27996121, 29551460], [29551461, 31106808]] SRR21853512 file size 8373036 SRR21853512 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR21853512 SRR21853512_1.fastq Input file: SRR21853512_1.fastq trimmed: SRR21853512-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Fri Dec 6 16:43:22 2024 >> started Fri Dec 6 16:43:38 2024 >> done (15.589s) 31106808 reads processed; of these: 6 ( 0.00%) short reads filtered out after trimming by size control 28198 ( 0.09%) empty reads filtered out after trimming by size control 31078604 (99.91%) reads available; of these: 412 ( 0.00%) trimmed reads available after processing 31078192 (100.00%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 1 0.00% 20 0 0.00% 21 0 0.00% 22 2 0.00% 23 2 0.00% 24 3 0.00% 25 2 0.00% 26 1 0.00% 27 3 0.00% 28 5 0.00% 29 4 0.00% 30 5 0.00% 31 4 0.00% 32 2 0.00% 33 2 0.00% 34 2 0.00% 35 88 0.00% 36 92 0.00% 37 120 0.00% 38 110 0.00% 39 135 0.00% 40 154 0.00% 41 166 0.00% 42 192 0.00% 43 165 0.00% 44 195 0.00% 45 215 0.00% 46 218 0.00% 47 276 0.00% 48 328 0.00% 49 466 0.00% 50 568 0.00% 51 564 0.00% 52 562 0.00% 53 523 0.00% 54 483 0.00% 55 504 0.00% 56 666 0.00% 57 743 0.00% 58 1002 0.00% 59 1223 0.00% 60 1346 0.00% 61 1512 0.00% 62 1543 0.00% 63 1608 0.01% 64 1663 0.01% 65 1588 0.01% 66 1797 0.01% 67 2118 0.01% 68 2489 0.01% 69 2929 0.01% 70 3271 0.01% 71 3795 0.01% 72 4219 0.01% 73 4460 0.01% 74 5015 0.02% 75 5126 0.02% 76 5407 0.02% 77 5924 0.02% 78 6566 0.02% 79 7602 0.02% 80 8430 0.03% 81 9730 0.03% 82 10948 0.04% 83 12487 0.04% 84 13541 0.04% 85 14429 0.05% 86 15601 0.05% 87 16862 0.05% 88 18686 0.06% 89 20421 0.07% 90 23016 0.07% 91 26341 0.08% 92 28075 0.09% 93 31256 0.10% 94 35537 0.11% 95 43419 0.14% 96 82044 0.26% 97 210923 0.68% 98 672163 2.16% 99 2134658 6.87% 100 7402604 23.82% 101 20167658 64.89% 31078604 reads passed initial QC criterion=sequence-density sequence-density=0.14 sequence-density-rank=1 fanout-score=0.00 fanout-score-rank=40 prefix-density=0.00 prefix-fanout=1.0 sequence=AGTATGGCCCGGGGGATCCT criterion=fanout-score sequence-density=0.04 sequence-density-rank=21 fanout-score=308.64 fanout-score-rank=1 prefix-density=0.41 prefix-fanout=27.7 sequence=AGCAGCAGCAGG Started job on | Dec 06 16:43:57 Started mapping on | Dec 06 16:43:57 Finished on | Dec 06 16:45:10 Mapping speed, Million of reads per hour | 1532.64 Number of input reads | 31078604 Average input read length | 100 UNIQUE READS: Uniquely mapped reads number | 27943871 Uniquely mapped reads % | 89.91% Average mapped length | 100.04 Number of splices: Total | 10226838 Number of splices: Annotated (sjdb) | 9629545 Number of splices: GT/AG | 10096410 Number of splices: GC/AG | 116288 Number of splices: AT/AC | 6361 Number of splices: Non-canonical | 7779 Mismatch rate per base, % | 0.22% Deletion rate per base | 0.00% Deletion average length | 1.48 Insertion rate per base | 0.00% Insertion average length | 1.25 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 468605 % of reads mapped to multiple loci | 1.51% Number of reads mapped to too many loci | 251049 % of reads mapped to too many loci | 0.81% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 7.67% % of reads unmapped: other | 0.10% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2666128 2666128 2666128 N_multimapping 468605 468605 468605 N_noFeature 1442428 14323326 14617460 N_ambiguous 504501 31259 31316 UnstrandedReadsAssigned:25996942 PositiveStrandReadsAssigned:13589286 NegativeStrandReadsAssigned:13295095 Dataset is classified unstranded MeadianReadLen=101 20thPercentileLength=100 echo kmer=95 SRR21853512 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR21853512-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 31,078,604 reads, 26,738,923 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,350 rounds 52973 SRR21853512.ke.tsv 35125 SRR21853512.se.tsv 88098 total ==> SRR21853512.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 36.1559 2.75501 PNS24247 1044 945 125.737 8.48596 PNS24249 1928 1829 177.004 6.17218 PNS24246 1044 945 125.737 8.48596 PNS24248 1044 945 125.737 8.48596 PNS24244 1471 1372 294.628 13.6958 PNS24243 293 194 56 18.4101 KQK14069 1603 1504 16730.6 709.469 KQK14071 474 375 2202.19 374.536 ==> SRR21853512.se.tsv <== BRADI_1g14170v3 22286 BRADI_1g53295v3 346 BRADI_1g59795v3 1241 BRADI_1g07683v3 0 BRADI_1g00485v3 117 BRADI_1g20270v3 412 BRADI_1g74790v3 375 BRADI_1g09890v3 0 BRADI_1g77505v3 689 BRADI_1g48960v3 2 SRR21853512 completed mapping pipeline successfully