Starting /dee2/code/volunteer_pipeline.sh SRR21853513 current disk space = 1550596403200 free memory = 1415253812 SRR21853513 SRAfilesize 1af7fe8941617b61049245d781f5dedf SRR21853513.sra SRR21853513.sra file validated SRR21853513 is single end SRR21853513 is conventional basespace SRR21853513 read1 length is 43-101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR21853513_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 43-101 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.409 37.0 37.0 37.0 37.0 37.0 2 34.6315 37.0 37.0 37.0 25.0 37.0 3 35.5535 37.0 37.0 37.0 37.0 37.0 4 35.679 37.0 37.0 37.0 37.0 37.0 5 35.6955 37.0 37.0 37.0 37.0 37.0 6 35.7425 37.0 37.0 37.0 37.0 37.0 7 35.596 37.0 37.0 37.0 37.0 37.0 8 35.77 37.0 37.0 37.0 37.0 37.0 9 35.9075 37.0 37.0 37.0 37.0 37.0 10-11 35.989000000000004 37.0 37.0 37.0 37.0 37.0 12-13 35.77475 37.0 37.0 37.0 37.0 37.0 14-15 35.759 37.0 37.0 37.0 37.0 37.0 16-17 35.832750000000004 37.0 37.0 37.0 37.0 37.0 18-19 35.81725 37.0 37.0 37.0 37.0 37.0 20-21 35.802 37.0 37.0 37.0 37.0 37.0 22-23 35.835750000000004 37.0 37.0 37.0 37.0 37.0 24-25 35.7225 37.0 37.0 37.0 37.0 37.0 26-27 35.623000000000005 37.0 37.0 37.0 37.0 37.0 28-29 35.658 37.0 37.0 37.0 37.0 37.0 30-31 35.61625 37.0 37.0 37.0 37.0 37.0 32-33 35.565 37.0 37.0 37.0 37.0 37.0 34-35 35.6185 37.0 37.0 37.0 37.0 37.0 36-37 35.594 37.0 37.0 37.0 37.0 37.0 38-39 35.498000000000005 37.0 37.0 37.0 37.0 37.0 40-41 35.479 37.0 37.0 37.0 37.0 37.0 42-43 35.59725 37.0 37.0 37.0 37.0 37.0 44-45 35.58722503287153 37.0 37.0 37.0 37.0 37.0 46-47 35.50325162581291 37.0 37.0 37.0 37.0 37.0 48-49 35.50125062531265 37.0 37.0 37.0 37.0 37.0 50-51 35.42971485742871 37.0 37.0 37.0 37.0 37.0 52-53 35.54227113556779 37.0 37.0 37.0 37.0 37.0 54-55 35.41670835417709 37.0 37.0 37.0 37.0 37.0 56-57 35.488994497248626 37.0 37.0 37.0 37.0 37.0 58-59 35.37177883412559 37.0 37.0 37.0 37.0 37.0 60-61 35.39004253189893 37.0 37.0 37.0 37.0 37.0 62-63 35.44958719039279 37.0 37.0 37.0 31.0 37.0 64-65 35.33550162621967 37.0 37.0 37.0 31.0 37.0 66-67 35.38153615211408 37.0 37.0 37.0 37.0 37.0 68-69 35.31398548911684 37.0 37.0 37.0 31.0 37.0 70-71 35.345258944208155 37.0 37.0 37.0 31.0 37.0 72-73 35.30673004753565 37.0 37.0 37.0 31.0 37.0 74-75 35.25569176882662 37.0 37.0 37.0 31.0 37.0 76-77 35.2424318238679 37.0 37.0 37.0 25.0 37.0 78-79 35.29450384835674 37.0 37.0 37.0 31.0 37.0 80-81 35.26758448060075 37.0 37.0 37.0 31.0 37.0 82-83 35.303417078057635 37.0 37.0 37.0 37.0 37.0 84-85 35.27345168767427 37.0 37.0 37.0 31.0 37.0 86-87 35.3320811419985 37.0 37.0 37.0 37.0 37.0 88-89 35.17808714097366 37.0 37.0 37.0 25.0 37.0 90-91 35.181112224448896 37.0 37.0 37.0 25.0 37.0 92-93 35.12725450901804 37.0 37.0 37.0 25.0 37.0 94-95 35.08291583166333 37.0 37.0 37.0 25.0 37.0 96-97 35.186794157903954 37.0 37.0 37.0 25.0 37.0 98-99 35.08024450363588 37.0 37.0 37.0 25.0 37.0 100-101 34.93770843152015 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100-101 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 2.0 23 3.0 24 4.0 25 6.0 26 17.0 27 16.0 28 42.0 29 45.0 30 74.0 31 108.0 32 151.0 33 177.0 34 308.0 35 602.0 36 2124.0 37 321.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 29.025000000000002 15.299999999999999 17.0 38.675 2 24.603580562659847 19.974424552429667 32.48081841432225 22.941176470588236 3 25.2 21.9 25.1 27.800000000000004 4 27.250000000000004 27.375 19.15 26.224999999999998 5 27.025 30.575000000000003 22.2 20.200000000000003 6 22.5 32.4 21.425 23.674999999999997 7 20.075000000000003 18.15 38.65 23.125 8 21.75 22.5 27.55 28.199999999999996 9 21.575 20.625 29.25 28.549999999999997 10-11 25.85 29.562500000000004 21.5 23.0875 12-13 23.5875 23.525 26.55 26.337500000000002 14-15 24.0 26.087500000000002 25.025 24.887500000000003 16-17 23.4875 26.05 25.474999999999998 24.9875 18-19 23.474999999999998 25.45 26.0375 25.0375 20-21 24.9 25.974999999999998 25.112499999999997 24.0125 22-23 23.962500000000002 25.687500000000004 25.974999999999998 24.375 24-25 23.3625 26.137500000000003 25.6125 24.887500000000003 26-27 23.7375 25.9625 25.7 24.6 28-29 24.462500000000002 24.587500000000002 25.75 25.2 30-31 23.9 25.45 26.224999999999998 24.425 32-33 23.925 25.95 25.6 24.525 34-35 23.775 25.912499999999998 25.35 24.962500000000002 36-37 24.1375 26.237500000000004 25.7625 23.8625 38-39 23.6125 26.700000000000003 25.900000000000002 23.7875 40-41 25.087500000000002 24.775 25.8625 24.275 42-43 23.474999999999998 25.974999999999998 25.6 24.95 44-45 23.396273602600974 26.12229586094785 25.597098912092036 24.884331624359135 46-47 24.674837418709355 25.63781890945473 24.83741870935468 24.84992496248124 48-49 23.461730865432717 24.92496248124062 26.275637818909452 25.337668834417208 50-51 23.974487243621812 26.163081540770385 25.56278139069535 24.299649824912457 52-53 24.787393696848426 26.025512756378188 25.550275137568786 23.6368184092046 54-55 23.536768384192097 25.72536268134067 25.400200100050025 25.337668834417208 56-57 25.80040020010005 25.312656328164078 24.72486243121561 24.16208104052026 58-59 23.805354015511636 25.594195646735052 25.2064048036027 25.39404553415061 60-61 23.617713284963724 25.456592444333246 25.569176882662 25.356517388041034 62-63 23.817863397548162 25.444083062296723 25.94445834375782 24.7935951963973 64-65 23.78033525143858 26.98273705278959 25.006254691018263 24.230673004753562 66-67 23.367525644233176 25.969477107830873 25.94445834375782 24.718538904178132 68-69 24.36827620715537 26.307230422817113 25.181386039529645 24.143107330497873 70-71 24.355766825118838 25.39404553415061 25.293970477858394 24.956217162872154 72-73 24.36827620715537 25.494120590442833 25.794345759319487 24.34325744308231 74-75 24.430823117338004 25.819364523392547 25.956967725794343 23.792844633475106 76-77 24.906179634726044 25.569176882662 25.193895421566175 24.330748061045785 78-79 24.74665332165645 25.960215188289755 25.084448892781186 24.208682597272613 80-81 24.105131414267834 25.994993742177723 25.64455569461827 24.25531914893617 82-83 24.008011015145826 26.94955563900363 24.471147828263863 24.571285517586684 84-85 24.17678727932891 26.76849881056717 24.301990734944283 24.752723175159634 86-87 24.292511895817682 26.095667417981467 24.66816929626847 24.94365138993238 88-89 24.558547276142768 26.0738885410144 24.72135253600501 24.64621164683782 90-91 24.549098196392784 25.876753507014026 24.799599198396795 24.774549098196395 92-93 24.9624248496994 25.776553106212425 24.812124248496996 24.448897795591183 94-95 24.123246492985974 25.726452905811627 25.926853707414832 24.223446893787575 96-97 23.86862228908111 26.36329447160587 25.473235552212607 24.29484768710041 98-99 23.669467787114844 24.75171886936593 26.763432645785585 24.815380697733637 100-101 25.86512151939482 12.007081924995976 32.3193304361822 29.808466119427006 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 5.0 1 2.5 2 0.5 3 1.5 4 1.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.5 10 0.5 11 0.5 12 1.0 13 0.5 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.5 20 0.5 21 0.0 22 0.0 23 0.5 24 1.0 25 1.5 26 3.5 27 4.5 28 4.0 29 5.0 30 8.5 31 10.0 32 16.0 33 29.5 34 37.0 35 40.5 36 51.5 37 67.5 38 93.0 39 114.5 40 125.0 41 137.0 42 160.0 43 184.0 44 198.5 45 216.0 46 216.5 47 207.5 48 196.5 49 166.5 50 142.5 51 139.5 52 124.0 53 117.5 54 118.0 55 110.0 56 93.5 57 79.5 58 83.0 59 73.5 60 60.0 61 51.5 62 54.0 63 53.0 64 44.5 65 38.5 66 41.5 67 42.5 68 37.5 69 36.0 70 35.5 71 31.0 72 21.5 73 15.0 74 12.0 75 12.0 76 8.0 77 4.5 78 4.0 79 6.0 80 4.0 81 1.0 82 2.0 83 1.0 84 0.5 85 0.5 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 2.25 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 42-43 1.0 44-45 1.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 1.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 2.0 80-81 0.0 82-83 1.0 84-85 1.0 86-87 0.0 88-89 1.0 90-91 0.0 92-93 0.0 94-95 1.0 96-97 23.0 98-99 340.0 100-101 3628.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.375 #Duplication Level Percentage of deduplicated Percentage of total 1 93.36010709504686 87.175 2 6.265060240963856 11.700000000000001 3 0.321285140562249 0.8999999999999999 4 0.02677376171352075 0.1 5 0.02677376171352075 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1205210 spots for SRR21853513.sra Written 1205210 spots for SRR21853513.sra Read 1205210 spots for SRR21853513.sra Written 1205210 spots for SRR21853513.sra Read 1205210 spots for SRR21853513.sra Written 1205210 spots for SRR21853513.sra Read 1205210 spots for SRR21853513.sra Written 1205210 spots for SRR21853513.sra Read 1205210 spots for SRR21853513.sra Written 1205210 spots for SRR21853513.sra Read 1205210 spots for SRR21853513.sra Written 1205210 spots for SRR21853513.sra Read 1205210 spots for SRR21853513.sra Written 1205210 spots for SRR21853513.sra Read 1205210 spots for SRR21853513.sra Written 1205210 spots for SRR21853513.sra Read 1205210 spots for SRR21853513.sra Written 1205210 spots for SRR21853513.sra Read 1205210 spots for SRR21853513.sra Written 1205210 spots for SRR21853513.sra Read 1205228 spots for SRR21853513.sra Written 1205228 spots for SRR21853513.sra Read 1205210 spots for SRR21853513.sra Written 1205210 spots for SRR21853513.sra Read 1205210 spots for SRR21853513.sra Written 1205210 spots for SRR21853513.sra Read 1205210 spots for SRR21853513.sra Written 1205210 spots for SRR21853513.sra Read 1205210 spots for SRR21853513.sra Written 1205210 spots for SRR21853513.sra Read 1205210 spots for SRR21853513.sra Written 1205210 spots for SRR21853513.sra Read 1205210 spots for SRR21853513.sra Written 1205210 spots for SRR21853513.sra Read 1205210 spots for SRR21853513.sra Written 1205210 spots for SRR21853513.sra Read 1205210 spots for SRR21853513.sra Written 1205210 spots for SRR21853513.sra Read 1205210 spots for SRR21853513.sra Written 1205210 spots for SRR21853513.sra SRR ids: ['SRR21853513.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_d7fanl1x SRR21853513.sra spots: 24104218 blocks: [[1, 1205210], [1205211, 2410420], [2410421, 3615630], [3615631, 4820840], [4820841, 6026050], [6026051, 7231260], [7231261, 8436470], [8436471, 9641680], [9641681, 10846890], [10846891, 12052100], [12052101, 13257310], [13257311, 14462520], [14462521, 15667730], [15667731, 16872940], [16872941, 18078150], [18078151, 19283360], [19283361, 20488570], [20488571, 21693780], [21693781, 22898990], [22898991, 24104218]] SRR21853513 file size 6492817 SRR21853513 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR21853513 SRR21853513_1.fastq Input file: SRR21853513_1.fastq trimmed: SRR21853513-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Fri Dec 6 16:44:17 2024 >> started Fri Dec 6 16:44:29 2024 >> done (12.349s) 24104218 reads processed; of these: 29 ( 0.00%) short reads filtered out after trimming by size control 48063 ( 0.20%) empty reads filtered out after trimming by size control 24056126 (99.80%) reads available; of these: 548 ( 0.00%) trimmed reads available after processing 24055578 (100.00%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 1 0.00% 20 4 0.00% 21 5 0.00% 22 8 0.00% 23 6 0.00% 24 5 0.00% 25 6 0.00% 26 6 0.00% 27 5 0.00% 28 5 0.00% 29 3 0.00% 30 4 0.00% 31 9 0.00% 32 7 0.00% 33 6 0.00% 34 8 0.00% 35 178 0.00% 36 159 0.00% 37 183 0.00% 38 167 0.00% 39 190 0.00% 40 209 0.00% 41 199 0.00% 42 186 0.00% 43 224 0.00% 44 234 0.00% 45 245 0.00% 46 237 0.00% 47 281 0.00% 48 259 0.00% 49 278 0.00% 50 287 0.00% 51 300 0.00% 52 353 0.00% 53 355 0.00% 54 354 0.00% 55 375 0.00% 56 368 0.00% 57 418 0.00% 58 436 0.00% 59 491 0.00% 60 591 0.00% 61 754 0.00% 62 640 0.00% 63 572 0.00% 64 634 0.00% 65 635 0.00% 66 698 0.00% 67 660 0.00% 68 763 0.00% 69 815 0.00% 70 919 0.00% 71 1010 0.00% 72 1054 0.00% 73 1060 0.00% 74 1108 0.00% 75 1100 0.00% 76 1132 0.00% 77 1222 0.01% 78 1376 0.01% 79 1300 0.01% 80 1507 0.01% 81 1709 0.01% 82 1791 0.01% 83 2033 0.01% 84 2080 0.01% 85 1981 0.01% 86 2120 0.01% 87 2337 0.01% 88 2393 0.01% 89 2539 0.01% 90 2815 0.01% 91 3504 0.01% 92 3137 0.01% 93 3512 0.01% 94 4443 0.02% 95 8340 0.03% 96 36280 0.15% 97 126312 0.53% 98 475632 1.98% 99 1644044 6.83% 100 5777278 24.02% 101 15925238 66.20% 24056126 reads passed initial QC criterion=sequence-density sequence-density=0.11 sequence-density-rank=1 fanout-score=3.03 fanout-score-rank=15 prefix-density=0.16 prefix-fanout=2.1 sequence=CCTTTCCAGGGCCTCAAGTCCACCGCCGG criterion=fanout-score sequence-density=0.06 sequence-density-rank=17 fanout-score=190.21 fanout-score-rank=1 prefix-density=0.49 prefix-fanout=23.1 sequence=CGCCGCCGCCGC Started job on | Dec 06 16:44:52 Started mapping on | Dec 06 16:44:52 Finished on | Dec 06 16:45:18 Mapping speed, Million of reads per hour | 3330.85 Number of input reads | 24056126 Average input read length | 100 UNIQUE READS: Uniquely mapped reads number | 23136783 Uniquely mapped reads % | 96.18% Average mapped length | 100.19 Number of splices: Total | 8732662 Number of splices: Annotated (sjdb) | 8261046 Number of splices: GT/AG | 8601038 Number of splices: GC/AG | 117910 Number of splices: AT/AC | 5065 Number of splices: Non-canonical | 8649 Mismatch rate per base, % | 0.28% Deletion rate per base | 0.00% Deletion average length | 1.76 Insertion rate per base | 0.00% Insertion average length | 1.50 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 464110 % of reads mapped to multiple loci | 1.93% Number of reads mapped to too many loci | 188241 % of reads mapped to too many loci | 0.78% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.00% % of reads unmapped: other | 0.11% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 455233 455233 455233 N_multimapping 464110 464110 464110 N_noFeature 1316049 11914038 12223079 N_ambiguous 369235 27255 28593 UnstrandedReadsAssigned:21451499 PositiveStrandReadsAssigned:11195490 NegativeStrandReadsAssigned:10885111 Dataset is classified unstranded MeadianReadLen=101 20thPercentileLength=100 echo kmer=95 SRR21853513 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR21853513-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 24,056,126 reads, 22,070,054 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,161 rounds 52973 SRR21853513.ke.tsv 35125 SRR21853513.se.tsv 88098 total ==> SRR21853513.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 0 0 PNS24247 1044 945 126.218 11.248 PNS24249 1928 1829 126.272 5.81404 PNS24246 1044 945 126.218 11.248 PNS24248 1044 945 126.218 11.248 PNS24244 1471 1372 75.0734 4.60804 PNS24243 293 194 68 29.5183 KQK14069 1603 1504 9994.55 559.628 KQK14071 474 375 2339.13 525.3 ==> SRR21853513.se.tsv <== BRADI_1g14170v3 13947 BRADI_1g53295v3 277 BRADI_1g59795v3 614 BRADI_1g07683v3 0 BRADI_1g00485v3 118 BRADI_1g20270v3 1377 BRADI_1g74790v3 205 BRADI_1g09890v3 1 BRADI_1g77505v3 394 BRADI_1g48960v3 0 SRR21853513 completed mapping pipeline successfully