Starting /dee2/code/volunteer_pipeline.sh SRR21853514 current disk space = 1550578565120 free memory = 1595494112 SRR21853514 SRAfilesize 53ef4f23227766a4e27d9977f0fdb4ba SRR21853514.sra SRR21853514.sra file validated SRR21853514 is single end SRR21853514 is conventional basespace SRR21853514 read1 length is 96-101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR21853514_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 96-101 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.3525 37.0 37.0 37.0 37.0 37.0 2 34.7935 37.0 37.0 37.0 25.0 37.0 3 35.5035 37.0 37.0 37.0 37.0 37.0 4 35.7145 37.0 37.0 37.0 37.0 37.0 5 35.74 37.0 37.0 37.0 37.0 37.0 6 35.9555 37.0 37.0 37.0 37.0 37.0 7 35.6725 37.0 37.0 37.0 37.0 37.0 8 35.965 37.0 37.0 37.0 37.0 37.0 9 35.772 37.0 37.0 37.0 37.0 37.0 10-11 35.9805 37.0 37.0 37.0 37.0 37.0 12-13 35.76725 37.0 37.0 37.0 37.0 37.0 14-15 35.88775 37.0 37.0 37.0 37.0 37.0 16-17 35.863 37.0 37.0 37.0 37.0 37.0 18-19 35.85325 37.0 37.0 37.0 37.0 37.0 20-21 35.781499999999994 37.0 37.0 37.0 37.0 37.0 22-23 35.759 37.0 37.0 37.0 37.0 37.0 24-25 35.7175 37.0 37.0 37.0 37.0 37.0 26-27 35.64149999999999 37.0 37.0 37.0 37.0 37.0 28-29 35.65 37.0 37.0 37.0 37.0 37.0 30-31 35.6185 37.0 37.0 37.0 37.0 37.0 32-33 35.596000000000004 37.0 37.0 37.0 37.0 37.0 34-35 35.576499999999996 37.0 37.0 37.0 37.0 37.0 36-37 35.5835 37.0 37.0 37.0 37.0 37.0 38-39 35.59375 37.0 37.0 37.0 37.0 37.0 40-41 35.53275 37.0 37.0 37.0 37.0 37.0 42-43 35.55175 37.0 37.0 37.0 37.0 37.0 44-45 35.5255 37.0 37.0 37.0 37.0 37.0 46-47 35.607 37.0 37.0 37.0 37.0 37.0 48-49 35.588750000000005 37.0 37.0 37.0 37.0 37.0 50-51 35.4985 37.0 37.0 37.0 37.0 37.0 52-53 35.4845 37.0 37.0 37.0 37.0 37.0 54-55 35.494 37.0 37.0 37.0 37.0 37.0 56-57 35.535 37.0 37.0 37.0 37.0 37.0 58-59 35.45425 37.0 37.0 37.0 37.0 37.0 60-61 35.43925 37.0 37.0 37.0 37.0 37.0 62-63 35.45099999999999 37.0 37.0 37.0 37.0 37.0 64-65 35.454 37.0 37.0 37.0 37.0 37.0 66-67 35.36425 37.0 37.0 37.0 37.0 37.0 68-69 35.39075 37.0 37.0 37.0 37.0 37.0 70-71 35.359750000000005 37.0 37.0 37.0 37.0 37.0 72-73 35.43725 37.0 37.0 37.0 37.0 37.0 74-75 35.460499999999996 37.0 37.0 37.0 37.0 37.0 76-77 35.387249999999995 37.0 37.0 37.0 31.0 37.0 78-79 35.3925 37.0 37.0 37.0 37.0 37.0 80-81 35.2825 37.0 37.0 37.0 31.0 37.0 82-83 35.28725 37.0 37.0 37.0 31.0 37.0 84-85 35.258250000000004 37.0 37.0 37.0 31.0 37.0 86-87 35.313 37.0 37.0 37.0 37.0 37.0 88-89 35.454 37.0 37.0 37.0 37.0 37.0 90-91 35.301 37.0 37.0 37.0 31.0 37.0 92-93 35.23675 37.0 37.0 37.0 31.0 37.0 94-95 35.318 37.0 37.0 37.0 37.0 37.0 96-97 35.283830665332665 37.0 37.0 37.0 31.0 37.0 98-99 35.29843431903511 37.0 37.0 37.0 31.0 37.0 100-101 35.15697579332742 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100-101 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 19 2.0 20 0.0 21 0.0 22 2.0 23 1.0 24 1.0 25 15.0 26 10.0 27 22.0 28 32.0 29 49.0 30 85.0 31 88.0 32 128.0 33 206.0 34 266.0 35 579.0 36 2122.0 37 392.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 29.549999999999997 14.499999999999998 17.974999999999998 37.974999999999994 2 24.669042769857434 19.577393075356415 33.146639511201634 22.606924643584524 3 27.500000000000004 23.724999999999998 23.65 25.124999999999996 4 26.650000000000002 29.825000000000003 19.55 23.974999999999998 5 26.674999999999997 30.8 21.75 20.775 6 22.400000000000002 33.875 21.275 22.45 7 20.0 16.650000000000002 40.25 23.1 8 22.75 21.375 25.55 30.325000000000003 9 22.575 20.474999999999998 28.625 28.325 10-11 25.75 28.225 20.1375 25.887500000000003 12-13 22.112499999999997 23.4625 27.1125 27.3125 14-15 23.4625 24.8 25.650000000000002 26.087500000000002 16-17 24.587500000000002 24.975 24.5625 25.874999999999996 18-19 24.775 25.637500000000003 25.1 24.4875 20-21 24.25 25.25 25.0375 25.4625 22-23 24.275 25.7625 24.875 25.087500000000002 24-25 24.8625 24.8625 24.8 25.474999999999998 26-27 23.4875 25.7 25.387500000000003 25.424999999999997 28-29 25.0375 25.5125 24.175 25.275 30-31 23.7125 25.7 24.7 25.887500000000003 32-33 23.400000000000002 26.825 24.6125 25.162499999999998 34-35 24.7375 24.975 24.5125 25.775 36-37 24.6125 25.7 25.224999999999998 24.462500000000002 38-39 24.837500000000002 25.074999999999996 24.7375 25.35 40-41 24.2875 25.95 24.962500000000002 24.8 42-43 23.775 25.1875 25.7375 25.3 44-45 23.8875 25.587500000000002 25.25 25.275 46-47 24.8625 24.275 25.424999999999997 25.4375 48-49 24.337500000000002 24.462500000000002 26.437500000000004 24.762500000000003 50-51 24.975 25.1875 24.775 25.0625 52-53 24.587500000000002 25.224999999999998 24.6 25.587500000000002 54-55 24.462500000000002 25.5125 25.2 24.825 56-57 24.4 25.8 24.7 25.1 58-59 24.125 25.4875 25.324999999999996 25.0625 60-61 23.9875 24.9 25.2375 25.874999999999996 62-63 23.95 25.324999999999996 25.0625 25.662499999999998 64-65 24.6625 25.4875 24.337500000000002 25.5125 66-67 23.5875 26.674999999999997 25.724999999999998 24.0125 68-69 24.462500000000002 25.5 25.2375 24.8 70-71 25.4625 24.95 24.2 25.387500000000003 72-73 24.8625 25.5 25.162499999999998 24.474999999999998 74-75 25.4375 24.6625 24.45 25.45 76-77 25.5 25.412499999999998 24.224999999999998 24.8625 78-79 24.925 25.55 24.25 25.275 80-81 24.4125 25.0 25.874999999999996 24.712500000000002 82-83 24.5625 24.85 25.35 25.2375 84-85 23.825 26.025 24.9875 25.162499999999998 86-87 24.762500000000003 25.387500000000003 24.575 25.275 88-89 24.962500000000002 24.55 26.0375 24.45 90-91 24.224999999999998 25.337500000000002 25.4625 24.975 92-93 24.625 25.25 25.362499999999997 24.762500000000003 94-95 25.587500000000002 24.0125 24.762500000000003 25.637500000000003 96-97 24.23105776444111 24.656164041010253 26.03150787696924 25.081270317579396 98-99 25.431472081218274 24.873096446700508 25.101522842639596 24.593908629441625 100-101 26.167636420820884 11.29108350369555 31.026891020600722 31.51438905488284 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.5 9 1.0 10 0.5 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.5 18 1.0 19 0.5 20 0.5 21 0.5 22 0.0 23 0.0 24 0.5 25 1.5 26 4.0 27 4.0 28 1.5 29 5.5 30 11.5 31 17.0 32 18.0 33 16.5 34 20.5 35 34.0 36 50.5 37 58.0 38 76.0 39 100.5 40 112.0 41 132.5 42 155.5 43 167.5 44 181.5 45 200.5 46 216.0 47 211.0 48 191.0 49 172.0 50 150.5 51 143.5 52 127.5 53 108.5 54 114.0 55 104.5 56 96.0 57 95.0 58 85.5 59 82.0 60 85.0 61 73.0 62 58.0 63 60.0 64 55.0 65 46.5 66 43.0 67 46.5 68 45.5 69 40.0 70 35.0 71 28.5 72 26.5 73 19.5 74 17.5 75 17.0 76 10.5 77 4.0 78 4.5 79 7.0 80 4.5 81 1.0 82 0.5 83 0.5 84 0.5 85 0.5 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 1.7999999999999998 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 96 2.0 97 25.0 98 66.0 99 276.0 100 903.0 101 2728.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.575 #Duplication Level Percentage of deduplicated Percentage of total 1 92.57358898190657 85.7 2 6.886308398595734 12.75 3 0.5130974885228193 1.425 4 0.0 0.0 5 0.027005130974885227 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACTCCGCGAAATCTCGTAT 5 0.125 TruSeq Adapter, Index 6 (97% over 36bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0125 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 936276 spots for SRR21853514.sra Written 936276 spots for SRR21853514.sra Read 936276 spots for SRR21853514.sra Written 936276 spots for SRR21853514.sra Read 936276 spots for SRR21853514.sra Written 936276 spots for SRR21853514.sra Read 936276 spots for SRR21853514.sra Written 936276 spots for SRR21853514.sra Read 936276 spots for SRR21853514.sra Written 936276 spots for SRR21853514.sra Read 936276 spots for SRR21853514.sra Written 936276 spots for SRR21853514.sra Read 936276 spots for SRR21853514.sra Written 936276 spots for SRR21853514.sra Read 936276 spots for SRR21853514.sra Written 936276 spots for SRR21853514.sra Read 936276 spots for SRR21853514.sra Written 936276 spots for SRR21853514.sra Read 936276 spots for SRR21853514.sra Written 936276 spots for SRR21853514.sra Read 936276 spots for SRR21853514.sra Written 936276 spots for SRR21853514.sra Read 936276 spots for SRR21853514.sra Written 936276 spots for SRR21853514.sra Read 936276 spots for SRR21853514.sra Written 936276 spots for SRR21853514.sra Read 936276 spots for SRR21853514.sra Written 936276 spots for SRR21853514.sra Read 936276 spots for SRR21853514.sra Written 936276 spots for SRR21853514.sra Read 936276 spots for SRR21853514.sra Written 936276 spots for SRR21853514.sra Read 936276 spots for SRR21853514.sra Written 936276 spots for SRR21853514.sra Read 936276 spots for SRR21853514.sra Written 936276 spots for SRR21853514.sra Read 936293 spots for SRR21853514.sra Written 936293 spots for SRR21853514.sra Read 936276 spots for SRR21853514.sra Written 936276 spots for SRR21853514.sra SRR ids: ['SRR21853514.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_yj8d7g28 SRR21853514.sra spots: 18725537 blocks: [[1, 936276], [936277, 1872552], [1872553, 2808828], [2808829, 3745104], [3745105, 4681380], [4681381, 5617656], [5617657, 6553932], [6553933, 7490208], [7490209, 8426484], [8426485, 9362760], [9362761, 10299036], [10299037, 11235312], [11235313, 12171588], [12171589, 13107864], [13107865, 14044140], [14044141, 14980416], [14980417, 15916692], [15916693, 16852968], [16852969, 17789244], [17789245, 18725537]] SRR21853514 file size 5043912 SRR21853514 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR21853514 SRR21853514_1.fastq Input file: SRR21853514_1.fastq trimmed: SRR21853514-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Fri Dec 6 16:45:12 2024 >> started Fri Dec 6 16:45:22 2024 >> done (9.773s) 18725537 reads processed; of these: 10 ( 0.00%) short reads filtered out after trimming by size control 29806 ( 0.16%) empty reads filtered out after trimming by size control 18695721 (99.84%) reads available; of these: 277 ( 0.00%) trimmed reads available after processing 18695444 (100.00%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 20 2 0.00% 21 2 0.00% 22 0 0.00% 23 4 0.00% 24 2 0.00% 25 1 0.00% 26 1 0.00% 27 2 0.00% 28 4 0.00% 29 2 0.00% 30 5 0.00% 31 2 0.00% 32 5 0.00% 33 4 0.00% 34 3 0.00% 35 61 0.00% 36 63 0.00% 37 52 0.00% 38 71 0.00% 39 65 0.00% 40 58 0.00% 41 62 0.00% 42 87 0.00% 43 81 0.00% 44 70 0.00% 45 76 0.00% 46 93 0.00% 47 89 0.00% 48 85 0.00% 49 76 0.00% 50 64 0.00% 51 85 0.00% 52 80 0.00% 53 109 0.00% 54 91 0.00% 55 104 0.00% 56 99 0.00% 57 83 0.00% 58 84 0.00% 59 105 0.00% 60 105 0.00% 61 131 0.00% 62 118 0.00% 63 111 0.00% 64 118 0.00% 65 127 0.00% 66 112 0.00% 67 142 0.00% 68 161 0.00% 69 102 0.00% 70 134 0.00% 71 129 0.00% 72 116 0.00% 73 143 0.00% 74 141 0.00% 75 147 0.00% 76 141 0.00% 77 144 0.00% 78 144 0.00% 79 160 0.00% 80 192 0.00% 81 205 0.00% 82 198 0.00% 83 185 0.00% 84 253 0.00% 85 209 0.00% 86 255 0.00% 87 236 0.00% 88 275 0.00% 89 284 0.00% 90 400 0.00% 91 922 0.00% 92 402 0.00% 93 512 0.00% 94 1149 0.01% 95 4402 0.02% 96 25520 0.14% 97 93157 0.50% 98 355645 1.90% 99 1272795 6.81% 100 4395570 23.51% 101 12538297 67.07% 18695721 reads passed initial QC criterion=sequence-density sequence-density=0.11 sequence-density-rank=1 fanout-score=2.16 fanout-score-rank=25 prefix-density=0.12 prefix-fanout=1.9 sequence=GCTCCTTTCCAGGG criterion=fanout-score sequence-density=0.05 sequence-density-rank=23 fanout-score=202.99 fanout-score-rank=1 prefix-density=0.48 prefix-fanout=23.0 sequence=GCGGCGGCGGCC Started job on | Dec 06 16:45:40 Started mapping on | Dec 06 16:45:40 Finished on | Dec 06 16:46:08 Mapping speed, Million of reads per hour | 2403.74 Number of input reads | 18695721 Average input read length | 100 UNIQUE READS: Uniquely mapped reads number | 17692011 Uniquely mapped reads % | 94.63% Average mapped length | 100.25 Number of splices: Total | 6398082 Number of splices: Annotated (sjdb) | 6046905 Number of splices: GT/AG | 6299762 Number of splices: GC/AG | 88181 Number of splices: AT/AC | 3716 Number of splices: Non-canonical | 6423 Mismatch rate per base, % | 0.28% Deletion rate per base | 0.00% Deletion average length | 1.69 Insertion rate per base | 0.00% Insertion average length | 1.29 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 465292 % of reads mapped to multiple loci | 2.49% Number of reads mapped to too many loci | 312436 % of reads mapped to too many loci | 1.67% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.98% % of reads unmapped: other | 0.23% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 538418 538418 538418 N_multimapping 465292 465292 465292 N_noFeature 885170 9115073 9217231 N_ambiguous 282510 18816 20484 UnstrandedReadsAssigned:16524331 PositiveStrandReadsAssigned:8558122 NegativeStrandReadsAssigned:8454296 Dataset is classified unstranded MeadianReadLen=101 20thPercentileLength=100 echo kmer=95 SRR21853514 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR21853514-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 18,695,721 reads, 17,048,069 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,235 rounds 52973 SRR21853514.ke.tsv 35125 SRR21853514.se.tsv 88098 total ==> SRR21853514.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 17.3908 2.20823 PNS24247 1044 945 90.8154 10.2136 PNS24249 1928 1829 149.149 8.66677 PNS24246 1044 945 90.8154 10.2136 PNS24248 1044 945 90.8154 10.2136 PNS24244 1471 1372 123.014 9.52907 PNS24243 293 194 47 25.7482 KQK14069 1603 1504 10610.2 749.763 KQK14071 474 375 2461.67 697.669 ==> SRR21853514.se.tsv <== BRADI_1g14170v3 14481 BRADI_1g53295v3 141 BRADI_1g59795v3 339 BRADI_1g07683v3 0 BRADI_1g00485v3 64 BRADI_1g20270v3 1116 BRADI_1g74790v3 176 BRADI_1g09890v3 1 BRADI_1g77505v3 279 BRADI_1g48960v3 0 SRR21853514 completed mapping pipeline successfully