Starting /dee2/code/volunteer_pipeline.sh SRR21853515 current disk space = 1550640357376 free memory = 1325324200 SRR21853515 SRAfilesize bcd26b00f406bd26756407f8552b40ec SRR21853515.sra SRR21853515.sra file validated SRR21853515 is single end SRR21853515 is conventional basespace SRR21853515 read1 length is 81-101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR21853515_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 81-101 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.2795 37.0 37.0 37.0 37.0 37.0 2 34.73275 37.0 37.0 37.0 25.0 37.0 3 35.4525 37.0 37.0 37.0 37.0 37.0 4 35.4655 37.0 37.0 37.0 37.0 37.0 5 35.795 37.0 37.0 37.0 37.0 37.0 6 35.6995 37.0 37.0 37.0 37.0 37.0 7 35.6665 37.0 37.0 37.0 37.0 37.0 8 35.752 37.0 37.0 37.0 37.0 37.0 9 35.7485 37.0 37.0 37.0 37.0 37.0 10-11 35.803 37.0 37.0 37.0 37.0 37.0 12-13 35.795 37.0 37.0 37.0 37.0 37.0 14-15 35.76975 37.0 37.0 37.0 37.0 37.0 16-17 35.834 37.0 37.0 37.0 37.0 37.0 18-19 35.758250000000004 37.0 37.0 37.0 37.0 37.0 20-21 35.713750000000005 37.0 37.0 37.0 37.0 37.0 22-23 35.795500000000004 37.0 37.0 37.0 37.0 37.0 24-25 35.772 37.0 37.0 37.0 37.0 37.0 26-27 35.589 37.0 37.0 37.0 37.0 37.0 28-29 35.621 37.0 37.0 37.0 37.0 37.0 30-31 35.6385 37.0 37.0 37.0 37.0 37.0 32-33 35.59225 37.0 37.0 37.0 37.0 37.0 34-35 35.507999999999996 37.0 37.0 37.0 37.0 37.0 36-37 35.53425 37.0 37.0 37.0 37.0 37.0 38-39 35.4365 37.0 37.0 37.0 37.0 37.0 40-41 35.415 37.0 37.0 37.0 31.0 37.0 42-43 35.510999999999996 37.0 37.0 37.0 37.0 37.0 44-45 35.50425 37.0 37.0 37.0 37.0 37.0 46-47 35.42975 37.0 37.0 37.0 37.0 37.0 48-49 35.42125 37.0 37.0 37.0 37.0 37.0 50-51 35.43425 37.0 37.0 37.0 37.0 37.0 52-53 35.3685 37.0 37.0 37.0 37.0 37.0 54-55 35.49 37.0 37.0 37.0 37.0 37.0 56-57 35.466750000000005 37.0 37.0 37.0 37.0 37.0 58-59 35.45525 37.0 37.0 37.0 37.0 37.0 60-61 35.407 37.0 37.0 37.0 37.0 37.0 62-63 35.45325 37.0 37.0 37.0 37.0 37.0 64-65 35.364000000000004 37.0 37.0 37.0 37.0 37.0 66-67 35.1935 37.0 37.0 37.0 25.0 37.0 68-69 35.28675 37.0 37.0 37.0 31.0 37.0 70-71 35.164500000000004 37.0 37.0 37.0 25.0 37.0 72-73 35.39175 37.0 37.0 37.0 37.0 37.0 74-75 35.388999999999996 37.0 37.0 37.0 37.0 37.0 76-77 35.2665 37.0 37.0 37.0 25.0 37.0 78-79 35.24575 37.0 37.0 37.0 25.0 37.0 80-81 35.301 37.0 37.0 37.0 37.0 37.0 82-83 35.34063174372883 37.0 37.0 37.0 37.0 37.0 84-85 35.2183591795898 37.0 37.0 37.0 31.0 37.0 86-87 35.29221916437328 37.0 37.0 37.0 37.0 37.0 88-89 35.2849637227921 37.0 37.0 37.0 31.0 37.0 90-91 35.20515386539905 37.0 37.0 37.0 31.0 37.0 92-93 35.22720174515271 37.0 37.0 37.0 25.0 37.0 94-95 35.12963689596981 37.0 37.0 37.0 25.0 37.0 96-97 35.259445181175494 37.0 37.0 37.0 31.0 37.0 98-99 35.12758284731093 37.0 37.0 37.0 25.0 37.0 100-101 35.14209970602816 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100-101 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 2.0 22 0.0 23 4.0 24 8.0 25 5.0 26 11.0 27 27.0 28 39.0 29 52.0 30 64.0 31 125.0 32 161.0 33 188.0 34 261.0 35 599.0 36 2068.0 37 386.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 27.325 11.774999999999999 19.775000000000002 41.125 2 26.737967914438503 19.556913674560732 29.360835243188184 24.34428316781258 3 27.325 24.0 22.35 26.325 4 28.849999999999998 26.35 18.375 26.424999999999997 5 28.95 30.675 19.900000000000002 20.474999999999998 6 22.95 33.0 19.2 24.85 7 21.775 16.05 37.25 24.925 8 23.9 22.45 24.175 29.475 9 23.375 19.825 27.725 29.075 10-11 25.7625 27.962500000000002 19.400000000000002 26.875 12-13 25.374999999999996 21.6 25.85 27.175 14-15 25.3125 23.625 24.575 26.487500000000004 16-17 25.4 24.0375 23.6625 26.900000000000002 18-19 24.575 24.175 24.55 26.700000000000003 20-21 25.55 24.762500000000003 24.3625 25.324999999999996 22-23 25.2625 24.5125 24.1875 26.0375 24-25 24.8 24.4875 24.175 26.5375 26-27 25.362499999999997 24.4875 23.962500000000002 26.187500000000004 28-29 25.6125 24.762500000000003 23.674999999999997 25.95 30-31 25.0375 23.150000000000002 24.3625 27.450000000000003 32-33 24.2 25.5 24.2625 26.0375 34-35 25.4625 24.775 24.0 25.7625 36-37 25.2375 23.775 24.0 26.987499999999997 38-39 25.662499999999998 24.825 23.4625 26.05 40-41 25.162499999999998 24.224999999999998 24.75 25.8625 42-43 24.4 24.5 24.3 26.8 44-45 25.75 24.675 23.5125 26.0625 46-47 24.85 25.0625 23.4375 26.650000000000002 48-49 24.175 24.7875 25.074999999999996 25.9625 50-51 25.362499999999997 23.625 24.55 26.4625 52-53 25.687500000000004 23.5875 24.325 26.400000000000002 54-55 24.9875 24.587500000000002 23.9875 26.437500000000004 56-57 25.5 23.7625 24.0 26.737499999999997 58-59 24.825 22.95 24.4375 27.787499999999998 60-61 25.05 24.3 24.375 26.275 62-63 26.2875 24.175 23.2375 26.3 64-65 24.9 25.650000000000002 23.3 26.150000000000002 66-67 24.925 24.6875 23.962500000000002 26.424999999999997 68-69 26.2125 24.637500000000003 23.025000000000002 26.125 70-71 25.7375 24.625 23.150000000000002 26.487500000000004 72-73 25.124999999999996 23.8875 24.275 26.7125 74-75 26.05 24.1125 24.075 25.7625 76-77 26.2875 23.5875 24.25 25.874999999999996 78-79 26.400000000000002 23.9125 22.912499999999998 26.775 80-81 25.374999999999996 25.224999999999998 23.549999999999997 25.85 82-83 25.78466925096911 24.221583093660122 23.571339252219584 26.42240840315118 84-85 25.900450225112557 25.03751875937969 23.43671835917959 25.625312656328163 86-87 25.91943957968476 24.668501376032022 23.667750813109834 25.74430823117338 88-89 25.869402051538653 23.329997498123593 24.430823117338004 26.36977733299975 90-91 25.66925193895422 23.942957217913435 24.230673004753562 26.157117838378785 92-93 25.760040035030652 23.908419867383962 24.09608407356437 26.23545602402102 94-95 26.2670504317357 23.96446001751971 23.70166437241897 26.066825178325615 96-97 25.861852826877275 24.269775604863984 24.081734988090762 25.786636580167983 98-99 25.795367778060573 23.31382031051158 24.128276915245607 26.762534996182236 100-101 27.84549627987969 10.337185372803546 29.159411112870032 32.65790723444673 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1.0 1 1.0 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.5 26 0.5 27 1.0 28 1.0 29 2.0 30 5.5 31 6.5 32 13.0 33 22.0 34 27.0 35 30.5 36 36.0 37 45.0 38 60.0 39 75.0 40 106.5 41 125.0 42 131.0 43 145.5 44 153.5 45 170.0 46 185.5 47 188.0 48 161.5 49 143.5 50 154.0 51 146.5 52 121.5 53 116.0 54 118.0 55 110.5 56 104.0 57 93.5 58 87.0 59 80.0 60 74.0 61 78.5 62 74.5 63 74.0 64 80.5 65 73.0 66 73.5 67 75.0 68 64.5 69 58.5 70 55.5 71 53.0 72 48.0 73 41.0 74 32.5 75 23.5 76 16.0 77 15.0 78 12.0 79 6.5 80 3.0 81 0.5 82 0.0 83 0.0 84 0.5 85 0.5 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 1.825 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 81 1.0 82 1.0 83 0.0 84 0.0 85 1.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 1.0 93 0.0 94 1.0 95 2.0 96 9.0 97 23.0 98 64.0 99 304.0 100 869.0 101 2724.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.075 #Duplication Level Percentage of deduplicated Percentage of total 1 93.33870534515177 86.875 2 6.1778135911899 11.5 3 0.37604082728982 1.05 4 0.05372011818426001 0.2 5 0.0 0.0 6 0.026860059092130004 0.15 7 0.0 0.0 8 0.0 0.0 9 0.026860059092130004 0.22499999999999998 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACTCCGCGAAATCTCGTAT 9 0.22499999999999998 TruSeq Adapter, Index 6 (97% over 36bp) GATCGGAAGAGCACACGTCTGAACTCCAGTCACTCCGCGAAATCGCGTAT 6 0.15 TruSeq Adapter, Index 6 (97% over 36bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 976316 spots for SRR21853515.sra Written 976316 spots for SRR21853515.sra Read 976316 spots for SRR21853515.sra Written 976316 spots for SRR21853515.sra Read 976316 spots for SRR21853515.sra Written 976316 spots for SRR21853515.sra Read 976316 spots for SRR21853515.sra Written 976316 spots for SRR21853515.sra Read 976316 spots for SRR21853515.sra Written 976316 spots for SRR21853515.sra Read 976316 spots for SRR21853515.sra Written 976316 spots for SRR21853515.sra Read 976316 spots for SRR21853515.sra Written 976316 spots for SRR21853515.sra Read 976316 spots for SRR21853515.sra Written 976316 spots for SRR21853515.sra Read 976316 spots for SRR21853515.sra Written 976316 spots for SRR21853515.sra Read 976316 spots for SRR21853515.sra Written 976316 spots for SRR21853515.sra Read 976316 spots for SRR21853515.sra Written 976316 spots for SRR21853515.sra Read 976316 spots for SRR21853515.sra Written 976316 spots for SRR21853515.sra Read 976325 spots for SRR21853515.sra Written 976325 spots for SRR21853515.sra Read 976316 spots for SRR21853515.sra Written 976316 spots for SRR21853515.sra Read 976316 spots for SRR21853515.sra Written 976316 spots for SRR21853515.sra Read 976316 spots for SRR21853515.sra Written 976316 spots for SRR21853515.sra Read 976316 spots for SRR21853515.sra Written 976316 spots for SRR21853515.sra Read 976316 spots for SRR21853515.sra Written 976316 spots for SRR21853515.sra Read 976316 spots for SRR21853515.sra Written 976316 spots for SRR21853515.sra Read 976316 spots for SRR21853515.sra Written 976316 spots for SRR21853515.sra SRR ids: ['SRR21853515.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_gf_8f3h7 SRR21853515.sra spots: 19526329 blocks: [[1, 976316], [976317, 1952632], [1952633, 2928948], [2928949, 3905264], [3905265, 4881580], [4881581, 5857896], [5857897, 6834212], [6834213, 7810528], [7810529, 8786844], [8786845, 9763160], [9763161, 10739476], [10739477, 11715792], [11715793, 12692108], [12692109, 13668424], [13668425, 14644740], [14644741, 15621056], [15621057, 16597372], [16597373, 17573688], [17573689, 18550004], [18550005, 19526329]] SRR21853515 file size 5259273 SRR21853515 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR21853515 SRR21853515_1.fastq Input file: SRR21853515_1.fastq trimmed: SRR21853515-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Fri Dec 6 16:49:00 2024 >> started Fri Dec 6 16:49:10 2024 >> done (9.813s) 19526329 reads processed; of these: 41 ( 0.00%) short reads filtered out after trimming by size control 102416 ( 0.52%) empty reads filtered out after trimming by size control 19423872 (99.48%) reads available; of these: 395 ( 0.00%) trimmed reads available after processing 19423477 (100.00%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 4 0.00% 20 1 0.00% 21 0 0.00% 22 5 0.00% 23 4 0.00% 24 5 0.00% 25 1 0.00% 26 5 0.00% 27 6 0.00% 28 4 0.00% 29 4 0.00% 30 3 0.00% 31 5 0.00% 32 8 0.00% 33 4 0.00% 34 3 0.00% 35 177 0.00% 36 170 0.00% 37 169 0.00% 38 162 0.00% 39 159 0.00% 40 147 0.00% 41 206 0.00% 42 186 0.00% 43 199 0.00% 44 167 0.00% 45 202 0.00% 46 179 0.00% 47 193 0.00% 48 183 0.00% 49 216 0.00% 50 213 0.00% 51 218 0.00% 52 213 0.00% 53 199 0.00% 54 180 0.00% 55 230 0.00% 56 227 0.00% 57 255 0.00% 58 254 0.00% 59 295 0.00% 60 293 0.00% 61 305 0.00% 62 300 0.00% 63 309 0.00% 64 285 0.00% 65 309 0.00% 66 320 0.00% 67 331 0.00% 68 345 0.00% 69 340 0.00% 70 399 0.00% 71 411 0.00% 72 404 0.00% 73 434 0.00% 74 450 0.00% 75 448 0.00% 76 447 0.00% 77 522 0.00% 78 518 0.00% 79 575 0.00% 80 560 0.00% 81 607 0.00% 82 720 0.00% 83 637 0.00% 84 681 0.00% 85 797 0.00% 86 823 0.00% 87 854 0.00% 88 951 0.00% 89 959 0.00% 90 1079 0.01% 91 1696 0.01% 92 1195 0.01% 93 1404 0.01% 94 2187 0.01% 95 5903 0.03% 96 27985 0.14% 97 89999 0.46% 98 352188 1.81% 99 1308223 6.74% 100 4355796 22.42% 101 13255820 68.24% 19423872 reads passed initial QC criterion=sequence-density sequence-density=0.21 sequence-density-rank=1 fanout-score=2.20 fanout-score-rank=24 prefix-density=0.24 prefix-fanout=1.9 sequence=GCTCCTTTCCAGGG criterion=fanout-score sequence-density=0.08 sequence-density-rank=21 fanout-score=206.30 fanout-score-rank=1 prefix-density=0.76 prefix-fanout=22.6 sequence=CCGCCGCCGCCA Started job on | Dec 06 16:49:31 Started mapping on | Dec 06 16:49:33 Finished on | Dec 06 16:49:56 Mapping speed, Million of reads per hour | 3040.26 Number of input reads | 19423872 Average input read length | 100 UNIQUE READS: Uniquely mapped reads number | 18397649 Uniquely mapped reads % | 94.72% Average mapped length | 100.21 Number of splices: Total | 6553920 Number of splices: Annotated (sjdb) | 6217743 Number of splices: GT/AG | 6461457 Number of splices: GC/AG | 78342 Number of splices: AT/AC | 3551 Number of splices: Non-canonical | 10570 Mismatch rate per base, % | 0.32% Deletion rate per base | 0.01% Deletion average length | 2.14 Insertion rate per base | 0.00% Insertion average length | 1.94 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 458172 % of reads mapped to multiple loci | 2.36% Number of reads mapped to too many loci | 295357 % of reads mapped to too many loci | 1.52% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.19% % of reads unmapped: other | 0.21% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 568051 568051 568051 N_multimapping 458172 458172 458172 N_noFeature 681914 9395269 9429301 N_ambiguous 288961 17232 18936 UnstrandedReadsAssigned:17426774 PositiveStrandReadsAssigned:8985148 NegativeStrandReadsAssigned:8949412 Dataset is classified unstranded MeadianReadLen=101 20thPercentileLength=100 echo kmer=95 SRR21853515 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR21853515-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 19,423,872 reads, 17,936,665 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,177 rounds 52973 SRR21853515.ke.tsv 35125 SRR21853515.se.tsv 88098 total ==> SRR21853515.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 105.12 11.7068 PNS24247 1044 945 32.0762 3.16396 PNS24249 1928 1829 101.082 5.15158 PNS24246 1044 945 32.0762 3.16396 PNS24248 1044 945 32.0762 3.16396 PNS24244 1471 1372 64.5692 4.38683 PNS24243 293 194 10 4.80483 KQK14069 1603 1504 3061.23 189.726 KQK14071 474 375 570.772 141.877 ==> SRR21853515.se.tsv <== BRADI_1g14170v3 3925 BRADI_1g53295v3 156 BRADI_1g59795v3 190 BRADI_1g07683v3 0 BRADI_1g00485v3 73 BRADI_1g20270v3 2035 BRADI_1g74790v3 185 BRADI_1g09890v3 9 BRADI_1g77505v3 268 BRADI_1g48960v3 0 SRR21853515 completed mapping pipeline successfully