Starting /dee2/code/volunteer_pipeline.sh SRR21853516 current disk space = 1550645964800 free memory = 1316736704 SRR21853516 SRAfilesize 1d23f3fff5700e39630c92858cab36ca SRR21853516.sra SRR21853516.sra file validated SRR21853516 is single end SRR21853516 is conventional basespace SRR21853516 read1 length is 55-101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR21853516_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 55-101 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.102 37.0 37.0 37.0 25.0 37.0 2 34.8485 37.0 37.0 37.0 25.0 37.0 3 35.4135 37.0 37.0 37.0 37.0 37.0 4 35.5 37.0 37.0 37.0 37.0 37.0 5 35.6065 37.0 37.0 37.0 37.0 37.0 6 35.4675 37.0 37.0 37.0 37.0 37.0 7 35.5945 37.0 37.0 37.0 37.0 37.0 8 35.7225 37.0 37.0 37.0 37.0 37.0 9 35.637 37.0 37.0 37.0 37.0 37.0 10-11 35.792500000000004 37.0 37.0 37.0 37.0 37.0 12-13 35.629000000000005 37.0 37.0 37.0 37.0 37.0 14-15 35.66475 37.0 37.0 37.0 37.0 37.0 16-17 35.6185 37.0 37.0 37.0 37.0 37.0 18-19 35.69225 37.0 37.0 37.0 37.0 37.0 20-21 35.696749999999994 37.0 37.0 37.0 37.0 37.0 22-23 35.545500000000004 37.0 37.0 37.0 37.0 37.0 24-25 35.52375 37.0 37.0 37.0 37.0 37.0 26-27 35.403499999999994 37.0 37.0 37.0 37.0 37.0 28-29 35.39075 37.0 37.0 37.0 37.0 37.0 30-31 35.40975 37.0 37.0 37.0 37.0 37.0 32-33 35.411 37.0 37.0 37.0 37.0 37.0 34-35 35.3605 37.0 37.0 37.0 31.0 37.0 36-37 35.36 37.0 37.0 37.0 31.0 37.0 38-39 35.27175 37.0 37.0 37.0 31.0 37.0 40-41 35.32525 37.0 37.0 37.0 37.0 37.0 42-43 35.37325 37.0 37.0 37.0 37.0 37.0 44-45 35.34975 37.0 37.0 37.0 37.0 37.0 46-47 35.329750000000004 37.0 37.0 37.0 37.0 37.0 48-49 35.38225 37.0 37.0 37.0 37.0 37.0 50-51 35.24275 37.0 37.0 37.0 31.0 37.0 52-53 35.26475 37.0 37.0 37.0 37.0 37.0 54-55 35.34125 37.0 37.0 37.0 31.0 37.0 56-57 35.332583145786444 37.0 37.0 37.0 37.0 37.0 58-59 35.33958489622405 37.0 37.0 37.0 37.0 37.0 60-61 35.28332083020755 37.0 37.0 37.0 31.0 37.0 62-63 35.21255313828458 37.0 37.0 37.0 31.0 37.0 64-65 35.30132533133283 37.0 37.0 37.0 31.0 37.0 66-67 35.24087043521761 37.0 37.0 37.0 31.0 37.0 68-69 35.28464232116058 37.0 37.0 37.0 31.0 37.0 70-71 35.15507753876938 37.0 37.0 37.0 25.0 37.0 72-73 35.11455727863932 37.0 37.0 37.0 25.0 37.0 74-75 35.07303651825913 37.0 37.0 37.0 25.0 37.0 76-77 35.110555277638824 37.0 37.0 37.0 25.0 37.0 78-79 35.064282141070535 37.0 37.0 37.0 25.0 37.0 80-81 35.23386693346673 37.0 37.0 37.0 25.0 37.0 82-83 34.99099549774888 37.0 37.0 37.0 25.0 37.0 84-85 35.161080540270135 37.0 37.0 37.0 25.0 37.0 86-87 35.14257128564282 37.0 37.0 37.0 25.0 37.0 88-89 35.06953476738369 37.0 37.0 37.0 25.0 37.0 90-91 35.059029514757384 37.0 37.0 37.0 25.0 37.0 92-93 34.99724793595196 37.0 37.0 37.0 25.0 37.0 94-95 35.015511633725296 37.0 37.0 37.0 25.0 37.0 96-97 34.93936478468943 37.0 37.0 37.0 25.0 37.0 98-99 35.10368103887022 37.0 37.0 37.0 25.0 37.0 100-101 34.986095827165144 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100-101 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 18 1.0 19 0.0 20 0.0 21 0.0 22 2.0 23 7.0 24 6.0 25 6.0 26 23.0 27 30.0 28 46.0 29 75.0 30 83.0 31 108.0 32 155.0 33 198.0 34 297.0 35 609.0 36 2002.0 37 352.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 28.325 12.5 16.725 42.449999999999996 2 26.987341772151897 19.89873417721519 30.835443037974684 22.278481012658226 3 28.175 24.0 21.224999999999998 26.6 4 29.299999999999997 28.025 17.325 25.35 5 29.125 29.099999999999998 19.625 22.15 6 22.325 31.900000000000002 20.05 25.724999999999998 7 20.599999999999998 15.525 37.2 26.674999999999997 8 23.400000000000002 22.15 23.325000000000003 31.125000000000004 9 21.375 22.775000000000002 27.375 28.475 10-11 27.2625 26.025 19.225 27.487499999999997 12-13 24.725 22.15 24.587500000000002 28.537499999999998 14-15 23.7625 23.9125 24.6625 27.6625 16-17 25.2 24.2 23.35 27.250000000000004 18-19 25.25 24.099999999999998 23.1125 27.537499999999998 20-21 26.8125 24.025 23.3625 25.8 22-23 25.55 23.974999999999998 22.8 27.675 24-25 24.75 23.875 23.25 28.125 26-27 25.7875 24.099999999999998 22.975 27.1375 28-29 25.7125 24.837500000000002 22.7375 26.7125 30-31 25.1875 24.0375 24.099999999999998 26.674999999999997 32-33 25.874999999999996 23.200000000000003 24.2625 26.6625 34-35 25.5625 24.1125 23.35 26.974999999999998 36-37 26.0125 23.9375 24.0375 26.0125 38-39 25.9625 23.2625 23.625 27.150000000000002 40-41 25.7125 24.05 23.3875 26.85 42-43 25.087500000000002 24.125 23.6625 27.125 44-45 25.874999999999996 24.375 23.825 25.924999999999997 46-47 25.974999999999998 23.525 23.775 26.724999999999998 48-49 25.674999999999997 25.1 22.4375 26.787499999999998 50-51 26.7125 24.887500000000003 22.5625 25.837500000000002 52-53 26.575 22.8125 22.975 27.6375 54-55 25.2125 24.8 23.775 26.2125 56-57 26.019004751187797 23.280820205051263 22.930732683170792 27.769442360590148 58-59 26.16904226056514 22.980745186296573 24.418604651162788 26.431607901975497 60-61 25.79394848712178 23.280820205051263 22.99324831207802 27.93198299574894 62-63 25.71892973243311 23.280820205051263 23.293323330832706 27.70692673168292 64-65 26.85671417854464 23.718429607401852 22.218054513628406 27.206801700425103 66-67 26.088044022011005 24.462231115557778 23.224112056028016 26.225612806403202 68-69 26.588294147073537 23.84942471235618 23.574287143571787 25.987993996998497 70-71 26.675837918959477 23.524262131065534 23.19909954977489 26.600800400200097 72-73 25.812906453226613 22.886443221610804 24.73736868434217 26.563281640820406 74-75 26.650825412706354 23.67433716858429 23.486743371685844 26.18809404702351 76-77 25.82541270635318 23.499249624812407 23.536768384192097 27.138569284642323 78-79 26.550775387693847 24.137068534267133 23.17408704352176 26.138069034517258 80-81 25.86293146573287 25.100050025012504 22.56128064032016 26.475737868934466 82-83 27.463731865932967 23.774387193596798 21.96098049024512 26.80090045022511 84-85 27.43871935967984 23.724362181090545 22.67383691845923 26.163081540770385 86-87 26.063031515757878 24.012006003001503 22.511255627813906 27.41370685342671 88-89 26.100550275137568 23.999499749874936 22.473736868434216 27.426213106553277 90-91 26.100550275137568 23.374187093546773 23.56178089044522 26.96348174087044 92-93 25.50662997247936 23.329997498123593 24.418313735301474 26.745058794095574 94-95 26.26970227670753 23.492619464598448 23.95546659994996 26.28221165874406 96-97 25.30995616781465 24.758922980588604 23.16844082654978 26.762680025046965 98-99 26.366641240783117 22.31121281464531 23.824052885837784 27.49809305873379 100-101 27.22126120459192 9.498348796980657 28.40069193269382 34.879698065733606 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 1.0 27 1.5 28 3.0 29 3.5 30 4.0 31 7.0 32 7.5 33 10.5 34 18.0 35 27.0 36 29.5 37 41.5 38 63.0 39 81.5 40 98.0 41 110.0 42 113.0 43 117.0 44 148.0 45 163.0 46 158.5 47 166.5 48 177.5 49 171.0 50 147.0 51 135.5 52 122.5 53 109.5 54 107.0 55 111.5 56 111.0 57 96.5 58 87.0 59 78.0 60 86.0 61 98.5 62 91.5 63 85.0 64 76.5 65 74.5 66 79.5 67 73.0 68 70.0 69 68.0 70 67.5 71 63.0 72 57.0 73 51.0 74 38.0 75 29.5 76 23.0 77 16.5 78 9.0 79 8.0 80 6.0 81 3.0 82 2.5 83 2.0 84 1.0 85 0.5 86 0.5 87 0.0 88 0.5 89 0.5 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 1.25 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 55 1.0 56 0.0 57 0.0 58 0.0 59 0.0 60 0.0 61 0.0 62 0.0 63 0.0 64 0.0 65 1.0 66 0.0 67 0.0 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 1.0 92 0.0 93 0.0 94 0.0 95 1.0 96 7.0 97 21.0 98 70.0 99 281.0 100 875.0 101 2742.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.0 #Duplication Level Percentage of deduplicated Percentage of total 1 92.98387096774194 86.47500000000001 2 6.505376344086021 12.1 3 0.510752688172043 1.425 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 995266 spots for SRR21853516.sra Written 995266 spots for SRR21853516.sra Read 995266 spots for SRR21853516.sra Written 995266 spots for SRR21853516.sra Read 995266 spots for SRR21853516.sra Written 995266 spots for SRR21853516.sra Read 995266 spots for SRR21853516.sra Written 995266 spots for SRR21853516.sra Read 995266 spots for SRR21853516.sra Written 995266 spots for SRR21853516.sra Read 995266 spots for SRR21853516.sra Written 995266 spots for SRR21853516.sra Read 995266 spots for SRR21853516.sra Written 995266 spots for SRR21853516.sra Read 995266 spots for SRR21853516.sra Written 995266 spots for SRR21853516.sra Read 995266 spots for SRR21853516.sra Written 995266 spots for SRR21853516.sra Read 995266 spots for SRR21853516.sra Written 995266 spots for SRR21853516.sra Read 995266 spots for SRR21853516.sra Written 995266 spots for SRR21853516.sra Read 995266 spots for SRR21853516.sra Written 995266 spots for SRR21853516.sra Read 995266 spots for SRR21853516.sra Written 995266 spots for SRR21853516.sra Read 995266 spots for SRR21853516.sra Written 995266 spots for SRR21853516.sra Read 995281 spots for SRR21853516.sra Written 995281 spots for SRR21853516.sra Read 995266 spots for SRR21853516.sra Written 995266 spots for SRR21853516.sra Read 995266 spots for SRR21853516.sra Written 995266 spots for SRR21853516.sra Read 995266 spots for SRR21853516.sra Written 995266 spots for SRR21853516.sra Read 995266 spots for SRR21853516.sra Written 995266 spots for SRR21853516.sra Read 995266 spots for SRR21853516.sra Written 995266 spots for SRR21853516.sra SRR ids: ['SRR21853516.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_5n4rtecr SRR21853516.sra spots: 19905335 blocks: [[1, 995266], [995267, 1990532], [1990533, 2985798], [2985799, 3981064], [3981065, 4976330], [4976331, 5971596], [5971597, 6966862], [6966863, 7962128], [7962129, 8957394], [8957395, 9952660], [9952661, 10947926], [10947927, 11943192], [11943193, 12938458], [12938459, 13933724], [13933725, 14928990], [14928991, 15924256], [15924257, 16919522], [16919523, 17914788], [17914789, 18910054], [18910055, 19905335]] SRR21853516 file size 5362473 SRR21853516 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR21853516 SRR21853516_1.fastq Input file: SRR21853516_1.fastq trimmed: SRR21853516-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Fri Dec 6 16:49:45 2024 >> started Fri Dec 6 16:49:56 2024 >> done (11.066s) 19905335 reads processed; of these: 48 ( 0.00%) short reads filtered out after trimming by size control 31306 ( 0.16%) empty reads filtered out after trimming by size control 19873981 (99.84%) reads available; of these: 530 ( 0.00%) trimmed reads available after processing 19873451 (100.00%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 1 0.00% 20 5 0.00% 21 2 0.00% 22 6 0.00% 23 8 0.00% 24 7 0.00% 25 5 0.00% 26 3 0.00% 27 6 0.00% 28 11 0.00% 29 8 0.00% 30 5 0.00% 31 5 0.00% 32 10 0.00% 33 11 0.00% 34 12 0.00% 35 159 0.00% 36 173 0.00% 37 158 0.00% 38 161 0.00% 39 151 0.00% 40 155 0.00% 41 176 0.00% 42 144 0.00% 43 154 0.00% 44 167 0.00% 45 173 0.00% 46 167 0.00% 47 169 0.00% 48 211 0.00% 49 149 0.00% 50 175 0.00% 51 180 0.00% 52 189 0.00% 53 206 0.00% 54 203 0.00% 55 210 0.00% 56 171 0.00% 57 185 0.00% 58 195 0.00% 59 234 0.00% 60 206 0.00% 61 239 0.00% 62 199 0.00% 63 230 0.00% 64 238 0.00% 65 255 0.00% 66 253 0.00% 67 232 0.00% 68 248 0.00% 69 235 0.00% 70 226 0.00% 71 276 0.00% 72 232 0.00% 73 260 0.00% 74 291 0.00% 75 276 0.00% 76 326 0.00% 77 321 0.00% 78 328 0.00% 79 346 0.00% 80 334 0.00% 81 342 0.00% 82 360 0.00% 83 379 0.00% 84 396 0.00% 85 378 0.00% 86 455 0.00% 87 470 0.00% 88 514 0.00% 89 483 0.00% 90 643 0.00% 91 1247 0.01% 92 640 0.00% 93 724 0.00% 94 1571 0.01% 95 5280 0.03% 96 26879 0.14% 97 87190 0.44% 98 347502 1.75% 99 1319703 6.64% 100 4344806 21.86% 101 13723944 69.05% 19873981 reads passed initial QC criterion=sequence-density sequence-density=0.19 sequence-density-rank=1 fanout-score=2.23 fanout-score-rank=24 prefix-density=0.22 prefix-fanout=1.9 sequence=GCTCCTTTCCAGGG criterion=fanout-score sequence-density=0.09 sequence-density-rank=24 fanout-score=280.42 fanout-score-rank=1 prefix-density=0.99 prefix-fanout=24.6 sequence=GCCGCCGCCACC Started job on | Dec 06 16:50:19 Started mapping on | Dec 06 16:50:19 Finished on | Dec 06 16:50:49 Mapping speed, Million of reads per hour | 2384.88 Number of input reads | 19873981 Average input read length | 100 UNIQUE READS: Uniquely mapped reads number | 18494820 Uniquely mapped reads % | 93.06% Average mapped length | 100.26 Number of splices: Total | 6325490 Number of splices: Annotated (sjdb) | 6011172 Number of splices: GT/AG | 6237435 Number of splices: GC/AG | 74625 Number of splices: AT/AC | 3405 Number of splices: Non-canonical | 10025 Mismatch rate per base, % | 0.33% Deletion rate per base | 0.01% Deletion average length | 2.16 Insertion rate per base | 0.00% Insertion average length | 1.93 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 594458 % of reads mapped to multiple loci | 2.99% Number of reads mapped to too many loci | 517940 % of reads mapped to too many loci | 2.61% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.96% % of reads unmapped: other | 0.38% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 784703 784703 784703 N_multimapping 594458 594458 594458 N_noFeature 641953 9528818 9357918 N_ambiguous 285354 19012 18679 UnstrandedReadsAssigned:17567513 PositiveStrandReadsAssigned:8946990 NegativeStrandReadsAssigned:9118223 Dataset is classified unstranded MeadianReadLen=101 20thPercentileLength=100 echo kmer=95 SRR21853516 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR21853516-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 19,873,981 reads, 18,093,064 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,120 rounds 52973 SRR21853516.ke.tsv 35125 SRR21853516.se.tsv 88098 total ==> SRR21853516.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 0 0 PNS24247 1044 945 39.5904 3.81007 PNS24249 1928 1829 240.237 11.9454 PNS24246 1044 945 39.5904 3.81007 PNS24248 1044 945 39.5904 3.81007 PNS24244 1471 1372 36.9915 2.45201 PNS24243 293 194 8 3.75028 KQK14069 1603 1504 2398.53 145.035 KQK14071 474 375 337.679 81.8931 ==> SRR21853516.se.tsv <== BRADI_1g14170v3 2913 BRADI_1g53295v3 98 BRADI_1g59795v3 170 BRADI_1g07683v3 0 BRADI_1g00485v3 72 BRADI_1g20270v3 2053 BRADI_1g74790v3 214 BRADI_1g09890v3 12 BRADI_1g77505v3 241 BRADI_1g48960v3 0 SRR21853516 completed mapping pipeline successfully