Starting /dee2/code/volunteer_pipeline.sh SRR21853517 current disk space = 1550591963136 free memory = 1599727388 SRR21853517 SRAfilesize b523b44b8199077a29d1f4c7baa47e21 SRR21853517.sra SRR21853517.sra file validated SRR21853517 is single end SRR21853517 is conventional basespace SRR21853517 read1 length is 35-101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR21853517_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 35-101 %GC 54 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.01725 37.0 37.0 37.0 25.0 37.0 2 35.58175 37.0 37.0 37.0 37.0 37.0 3 35.797 37.0 37.0 37.0 37.0 37.0 4 35.85925 37.0 37.0 37.0 37.0 37.0 5 35.89625 37.0 37.0 37.0 37.0 37.0 6 35.97375 37.0 37.0 37.0 37.0 37.0 7 35.89575 37.0 37.0 37.0 37.0 37.0 8 36.00325 37.0 37.0 37.0 37.0 37.0 9 35.95625 37.0 37.0 37.0 37.0 37.0 10-11 36.03175 37.0 37.0 37.0 37.0 37.0 12-13 35.966750000000005 37.0 37.0 37.0 37.0 37.0 14-15 36.072 37.0 37.0 37.0 37.0 37.0 16-17 36.032 37.0 37.0 37.0 37.0 37.0 18-19 35.893 37.0 37.0 37.0 37.0 37.0 20-21 35.806250000000006 37.0 37.0 37.0 37.0 37.0 22-23 35.84525 37.0 37.0 37.0 37.0 37.0 24-25 35.79875 37.0 37.0 37.0 37.0 37.0 26-27 35.821 37.0 37.0 37.0 37.0 37.0 28-29 35.69175 37.0 37.0 37.0 37.0 37.0 30-31 35.7275 37.0 37.0 37.0 37.0 37.0 32-33 35.683 37.0 37.0 37.0 37.0 37.0 34-35 35.650999999999996 37.0 37.0 37.0 37.0 37.0 36-37 35.71092773193298 37.0 37.0 37.0 37.0 37.0 38-39 35.62265566391598 37.0 37.0 37.0 37.0 37.0 40-41 35.58439609902476 37.0 37.0 37.0 37.0 37.0 42-43 35.5796449112278 37.0 37.0 37.0 37.0 37.0 44-45 35.57239309827457 37.0 37.0 37.0 37.0 37.0 46-47 35.55088772193048 37.0 37.0 37.0 37.0 37.0 48-49 35.461615403850956 37.0 37.0 37.0 37.0 37.0 50-51 35.58489622405601 37.0 37.0 37.0 37.0 37.0 52-53 35.5666416604151 37.0 37.0 37.0 37.0 37.0 54-55 35.42885721430358 37.0 37.0 37.0 37.0 37.0 56-57 35.40910227556889 37.0 37.0 37.0 37.0 37.0 58-59 35.42635658914729 37.0 37.0 37.0 37.0 37.0 60-61 35.45286321580395 37.0 37.0 37.0 37.0 37.0 62-63 35.22205551387847 37.0 37.0 37.0 31.0 37.0 64-65 35.34433608402101 37.0 37.0 37.0 31.0 37.0 66-67 35.39859964991248 37.0 37.0 37.0 37.0 37.0 68-69 35.42535633908477 37.0 37.0 37.0 37.0 37.0 70-71 35.20080020005001 37.0 37.0 37.0 25.0 37.0 72-73 35.27360204233149 37.0 37.0 37.0 31.0 37.0 74-75 35.23736868434217 37.0 37.0 37.0 25.0 37.0 76-77 35.10180090045023 37.0 37.0 37.0 25.0 37.0 78-79 35.034267133566786 37.0 37.0 37.0 25.0 37.0 80-81 35.16783391695848 37.0 37.0 37.0 25.0 37.0 82-83 35.19684842421211 37.0 37.0 37.0 25.0 37.0 84-85 35.18634317158579 37.0 37.0 37.0 25.0 37.0 86-87 35.1735867933967 37.0 37.0 37.0 25.0 37.0 88-89 35.13431715857929 37.0 37.0 37.0 25.0 37.0 90-91 34.86193096548274 37.0 37.0 37.0 25.0 37.0 92-93 34.88094047023512 37.0 37.0 37.0 25.0 37.0 94-95 35.01225612806403 37.0 37.0 37.0 25.0 37.0 96-97 34.895013203693125 37.0 37.0 37.0 25.0 37.0 98-99 34.89284082037997 37.0 37.0 37.0 25.0 37.0 100-101 34.89566775960871 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 2101 1 0.0 2101 2 0.0 2101 3 0.0 2101 4 0.0 2101 5 0.0 2101 6 0.0 2101 7 0.0 2101 8 0.0 2101 9 0.0 2101 10-11 0.0 2101 12-13 0.0 2101 14-15 0.0 2101 16-17 0.0 2101 18-19 0.0 2101 20-21 0.0 2101 22-23 0.0 2101 24-25 0.0 2101 26-27 0.0 2101 28-29 0.0 2101 30-31 0.0 2101 32-33 0.0 2101 34-35 0.0 2101 36-37 0.0 2101 38-39 0.0 2101 40-41 0.0 2101 42-43 0.0 2101 44-45 0.0 2101 46-47 0.0 2101 48-49 0.0 2101 50-51 0.0 2101 52-53 0.0 2101 54-55 0.0 2101 56-57 0.0 2101 58-59 0.0 2101 60-61 0.0 2101 62-63 0.0 2101 64-65 0.0 2101 66-67 0.0 2101 68-69 0.0 2101 70-71 0.0 2101 72-73 0.0 2101 74-75 0.0 2101 76-77 0.0 2101 78-79 0.0 2101 80-81 0.0 2101 82-83 0.0 2101 84-85 0.0 2101 86-87 0.0 2101 88-89 0.0 2101 90-91 0.0 2101 92-93 0.0 2101 94-95 0.0 2101 96-97 0.0 2101 98-99 0.0 2101 100-101 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 1.0 22 0.0 23 3.0 24 2.0 25 3.0 26 16.0 27 22.0 28 26.0 29 58.0 30 57.0 31 96.0 32 118.0 33 213.0 34 348.0 35 685.0 36 2005.0 37 346.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 27.609511889862326 13.11639549436796 15.39424280350438 43.879849812265334 2 27.33183295823956 18.30457614403601 28.40710177544386 25.95648912228057 3 28.96448224112056 21.160580290145074 21.53576788394197 28.339169584792394 4 29.457364341085274 25.581395348837212 16.854213553388348 28.107026756689173 5 29.00725181295324 28.33208302075519 18.504626156539132 24.15603900975244 6 24.63115778944736 30.057514378594647 19.4048512128032 25.906476619154787 7 22.18054513628407 16.35408852213053 35.80895223805952 25.656414103525883 8 23.705926481620406 20.455113778444613 24.281070267566893 31.557889472368096 9 23.280820205051263 21.10527631907977 26.806701675418854 28.80720180045011 10-11 27.219304826206553 26.081520380095025 18.967241810452613 27.731932983245812 12-13 25.918979744936234 21.642910727681922 23.968492123030757 28.469617404351087 14-15 24.90622655663916 23.443360840210055 24.293573393348336 27.35683920980245 16-17 25.71892973243311 22.99324831207802 22.868217054263564 28.419604901225306 18-19 25.568892223055762 22.74318579644911 23.168292073018254 28.51962990747687 20-21 26.85671417854464 23.74343585896474 22.193048262065513 27.206801700425103 22-23 26.144036009002253 24.043510877719427 22.31807951987997 27.494373593398347 24-25 25.593898474618655 23.305826456614152 23.10577644411103 27.994498624656167 26-27 26.281570392598148 24.218554638659665 22.268067016754188 27.231807951987996 28-29 25.943985996499126 22.99324831207802 23.568392098024507 27.494373593398347 30-31 26.081520380095025 23.068267066766694 23.668417104276067 27.181795448862218 32-33 25.481370342585645 23.20580145036259 22.968242060515127 28.34458614653663 34-35 25.531382845711427 23.918479619904975 22.99324831207802 27.556889222305575 36-37 26.63165791447862 22.36809202300575 22.418104526131533 28.582145536384097 38-39 26.38159539884971 22.843210802700675 23.13078269567392 27.644411102775695 40-41 25.993998499624904 23.10577644411103 22.50562640660165 28.394598649662417 42-43 26.131532883220803 22.918229557389346 23.36834208552138 27.581895473868467 44-45 26.881720430107524 23.58089522380595 21.892973243310827 27.644411102775695 46-47 26.319079769942487 23.355838959739934 22.330582645661416 27.994498624656167 48-49 26.419104776194047 22.20555138784696 22.73068267066767 28.644661165291325 50-51 26.244061015253813 23.13078269567392 22.343085771442862 28.28207051762941 52-53 26.281570392598148 22.29307326831708 23.243310827706924 28.182045511377847 54-55 26.04401100275069 22.85571392848212 22.418104526131533 28.68217054263566 56-57 25.806451612903224 23.543385846461614 22.755688922230558 27.894473618404604 58-59 25.468867216804203 22.868217054263564 23.280820205051263 28.382095523880967 60-61 27.231807951987996 23.818454613653415 22.280570142535634 26.669167291822955 62-63 26.894223555888974 22.755688922230558 22.693173293323333 27.656914228557138 64-65 26.744186046511626 23.618404601150285 22.443110777694425 27.19429857464366 66-67 26.78169542385596 23.393348337084273 22.29307326831708 27.53188297074269 68-69 26.819204801200303 22.83070767691923 22.630657664416105 27.719429857464366 70-71 26.531632908227053 22.193048262065513 22.718179544886222 28.557139284821204 72-73 26.60997874202826 23.68388145554583 22.72102038264349 26.985119419782418 74-75 26.388194097048522 23.19909954977489 22.461230615307652 27.951475737868936 76-77 26.91345672836418 23.574287143571787 22.098549274637318 27.41370685342671 78-79 26.788394197098548 22.59879939969985 23.32416208104052 27.288644322161083 80-81 26.725862931465734 22.386193096548272 23.411705852926463 27.47623811905953 82-83 27.63881940970485 22.07353676838419 22.373686843421712 27.913956978489246 84-85 26.500750375187593 22.623811905952977 23.09904952476238 27.776388194097045 86-87 26.87593796898449 22.548774387193596 23.011505752876438 27.56378189094547 88-89 26.40070035017509 23.12406203101551 22.948974487243625 27.52626313156578 90-91 26.500750375187593 22.461230615307652 22.32366183091546 28.714357178589296 92-93 27.33866933466733 23.374187093546773 22.086043021510758 27.201100550275136 94-95 26.813406703351678 22.24862431215608 22.573786893446723 28.36418209104552 96-97 27.710994239919863 22.088655146506387 22.364137240170297 27.836213373403456 98-99 26.578579595985264 21.954008385211534 23.008512260195655 28.458899758607547 100-101 29.616455304670588 9.433962264150944 27.03371481596041 33.91586761521806 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 1.0 23 0.5 24 0.0 25 0.0 26 0.5 27 1.0 28 1.5 29 3.5 30 6.0 31 6.0 32 6.0 33 9.5 34 15.5 35 25.0 36 36.5 37 45.0 38 59.5 39 67.5 40 75.0 41 89.0 42 106.5 43 121.0 44 124.5 45 145.5 46 149.5 47 138.0 48 137.5 49 130.5 50 135.5 51 135.0 52 115.5 53 111.5 54 104.5 55 98.5 56 108.5 57 99.5 58 89.5 59 89.5 60 88.0 61 101.0 62 115.5 63 98.5 64 82.0 65 88.5 66 94.5 67 90.5 68 81.5 69 77.5 70 72.0 71 70.5 72 70.5 73 61.0 74 54.5 75 44.5 76 31.5 77 25.0 78 20.5 79 17.5 80 14.0 81 8.0 82 4.0 83 2.5 84 1.0 85 1.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.125 2 0.025 3 0.05 4 0.025 5 0.025 6 0.025 7 0.025 8 0.025 9 0.025 10-11 0.025 12-13 0.025 14-15 0.025 16-17 0.025 18-19 0.025 20-21 0.025 22-23 0.025 24-25 0.025 26-27 0.025 28-29 0.025 30-31 0.025 32-33 0.025 34-35 0.025 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 34-35 1.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 1.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 28.0 98-99 336.0 100-101 3634.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.39999999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 94.33262711864407 89.05 2 5.508474576271186 10.4 3 0.13241525423728812 0.375 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.026483050847457626 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACTCCGCGAAATCTCGTAT 7 0.17500000000000002 TruSeq Adapter, Index 6 (97% over 36bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 211480 spots for SRR21853517.sra Written 211480 spots for SRR21853517.sra Read 211480 spots for SRR21853517.sra Written 211480 spots for SRR21853517.sra Read 211480 spots for SRR21853517.sra Written 211480 spots for SRR21853517.sra Read 211480 spots for SRR21853517.sra Written 211480 spots for SRR21853517.sra Read 211480 spots for SRR21853517.sra Written 211480 spots for SRR21853517.sra Read 211480 spots for SRR21853517.sra Written 211480 spots for SRR21853517.sra Read 211480 spots for SRR21853517.sra Written 211480 spots for SRR21853517.sra Read 211480 spots for SRR21853517.sra Written 211480 spots for SRR21853517.sra Read 211480 spots for SRR21853517.sra Written 211480 spots for SRR21853517.sra Read 211480 spots for SRR21853517.sra Written 211480 spots for SRR21853517.sra Read 211480 spots for SRR21853517.sra Written 211480 spots for SRR21853517.sra Read 211481 spots for SRR21853517.sra Written 211481 spots for SRR21853517.sra Read 211480 spots for SRR21853517.sra Written 211480 spots for SRR21853517.sra Read 211480 spots for SRR21853517.sra Written 211480 spots for SRR21853517.sra Read 211480 spots for SRR21853517.sra Written 211480 spots for SRR21853517.sra Read 211480 spots for SRR21853517.sra Written 211480 spots for SRR21853517.sra Read 211480 spots for SRR21853517.sra Written 211480 spots for SRR21853517.sra Read 211480 spots for SRR21853517.sra Written 211480 spots for SRR21853517.sra Read 211480 spots for SRR21853517.sra Written 211480 spots for SRR21853517.sra Read 211480 spots for SRR21853517.sra Written 211480 spots for SRR21853517.sra SRR ids: ['SRR21853517.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_6l4qx8u8 SRR21853517.sra spots: 4229601 blocks: [[1, 211480], [211481, 422960], [422961, 634440], [634441, 845920], [845921, 1057400], [1057401, 1268880], [1268881, 1480360], [1480361, 1691840], [1691841, 1903320], [1903321, 2114800], [2114801, 2326280], [2326281, 2537760], [2537761, 2749240], [2749241, 2960720], [2960721, 3172200], [3172201, 3383680], [3383681, 3595160], [3595161, 3806640], [3806641, 4018120], [4018121, 4229601]] SRR21853517 file size 1136657 SRR21853517 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR21853517 SRR21853517_1.fastq Input file: SRR21853517_1.fastq trimmed: SRR21853517-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Fri Dec 6 16:51:00 2024 >> started Fri Dec 6 16:51:02 2024 >> done (2.218s) 4229601 reads processed; of these: 11 ( 0.00%) short reads filtered out after trimming by size control 10380 ( 0.25%) empty reads filtered out after trimming by size control 4219210 (99.75%) reads available; of these: 286 ( 0.01%) trimmed reads available after processing 4218924 (99.99%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 0 0.00% 20 2 0.00% 21 0 0.00% 22 1 0.00% 23 0 0.00% 24 0 0.00% 25 2 0.00% 26 0 0.00% 27 0 0.00% 28 0 0.00% 29 0 0.00% 30 0 0.00% 31 1 0.00% 32 2 0.00% 33 0 0.00% 34 5 0.00% 35 30 0.00% 36 47 0.00% 37 31 0.00% 38 34 0.00% 39 34 0.00% 40 30 0.00% 41 35 0.00% 42 30 0.00% 43 43 0.00% 44 31 0.00% 45 31 0.00% 46 34 0.00% 47 33 0.00% 48 28 0.00% 49 19 0.00% 50 34 0.00% 51 45 0.00% 52 41 0.00% 53 41 0.00% 54 41 0.00% 55 25 0.00% 56 43 0.00% 57 29 0.00% 58 26 0.00% 59 44 0.00% 60 38 0.00% 61 41 0.00% 62 26 0.00% 63 39 0.00% 64 39 0.00% 65 49 0.00% 66 40 0.00% 67 44 0.00% 68 38 0.00% 69 46 0.00% 70 46 0.00% 71 59 0.00% 72 49 0.00% 73 45 0.00% 74 54 0.00% 75 49 0.00% 76 53 0.00% 77 64 0.00% 78 46 0.00% 79 75 0.00% 80 67 0.00% 81 67 0.00% 82 77 0.00% 83 89 0.00% 84 73 0.00% 85 70 0.00% 86 106 0.00% 87 68 0.00% 88 81 0.00% 89 105 0.00% 90 108 0.00% 91 245 0.01% 92 162 0.00% 93 175 0.00% 94 349 0.01% 95 1188 0.03% 96 5451 0.13% 97 17080 0.40% 98 69700 1.65% 99 275742 6.54% 100 883959 20.95% 101 2962434 70.21% 4219210 reads passed initial QC criterion=sequence-density sequence-density=0.29 sequence-density-rank=1 fanout-score=2.27 fanout-score-rank=23 prefix-density=0.34 prefix-fanout=1.9 sequence=GCTCCTTTCCAGGG criterion=fanout-score sequence-density=0.11 sequence-density-rank=23 fanout-score=266.02 fanout-score-rank=1 prefix-density=1.22 prefix-fanout=24.2 sequence=CGCCGCCGCCGA Started job on | Dec 06 16:51:17 Started mapping on | Dec 06 16:51:18 Finished on | Dec 06 16:51:25 Mapping speed, Million of reads per hour | 2169.88 Number of input reads | 4219210 Average input read length | 100 UNIQUE READS: Uniquely mapped reads number | 3953625 Uniquely mapped reads % | 93.71% Average mapped length | 100.34 Number of splices: Total | 1259925 Number of splices: Annotated (sjdb) | 1195512 Number of splices: GT/AG | 1242735 Number of splices: GC/AG | 15008 Number of splices: AT/AC | 662 Number of splices: Non-canonical | 1520 Mismatch rate per base, % | 0.22% Deletion rate per base | 0.00% Deletion average length | 2.00 Insertion rate per base | 0.00% Insertion average length | 1.94 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 120369 % of reads mapped to multiple loci | 2.85% Number of reads mapped to too many loci | 102638 % of reads mapped to too many loci | 2.43% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.80% % of reads unmapped: other | 0.21% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 145216 145216 145216 N_multimapping 120369 120369 120369 N_noFeature 126555 2054280 1975227 N_ambiguous 59385 5538 3662 UnstrandedReadsAssigned:3767685 PositiveStrandReadsAssigned:1893807 NegativeStrandReadsAssigned:1974736 Dataset is classified unstranded MeadianReadLen=101 20thPercentileLength=100 echo kmer=95 SRR21853517 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR21853517-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 4,219,210 reads, 3,877,380 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,088 rounds 52973 SRR21853517.ke.tsv 35125 SRR21853517.se.tsv 88098 total ==> SRR21853517.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 22.4066 11.261 PNS24247 1044 945 0 0 PNS24249 1928 1829 55.5838 12.7838 PNS24246 1044 945 0 0 PNS24248 1044 945 0 0 PNS24244 1471 1372 15.0096 4.60193 PNS24243 293 194 2 4.33664 KQK14069 1603 1504 519.996 145.438 KQK14071 474 375 64.0911 71.8938 ==> SRR21853517.se.tsv <== BRADI_1g14170v3 617 BRADI_1g53295v3 33 BRADI_1g59795v3 27 BRADI_1g07683v3 0 BRADI_1g00485v3 9 BRADI_1g20270v3 343 BRADI_1g74790v3 37 BRADI_1g09890v3 2 BRADI_1g77505v3 34 BRADI_1g48960v3 0 SRR21853517 completed mapping pipeline successfully