Starting /dee2/code/volunteer_pipeline.sh SRR21853518 current disk space = 1550560059392 free memory = 1596917816 SRR21853518 SRAfilesize 9f86484b22d287f239525a4a3a96ecf0 SRR21853518.sra SRR21853518.sra file validated SRR21853518 is single end SRR21853518 is conventional basespace SRR21853518 read1 length is 45-101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR21853518_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 45-101 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 34.838 37.0 37.0 37.0 25.0 37.0 2 34.93825 37.0 37.0 37.0 25.0 37.0 3 35.3555 37.0 37.0 37.0 37.0 37.0 4 35.4075 37.0 37.0 37.0 37.0 37.0 5 35.653 37.0 37.0 37.0 37.0 37.0 6 35.5915 37.0 37.0 37.0 37.0 37.0 7 35.2015 37.0 37.0 37.0 25.0 37.0 8 35.553 37.0 37.0 37.0 37.0 37.0 9 35.658 37.0 37.0 37.0 37.0 37.0 10-11 35.80125 37.0 37.0 37.0 37.0 37.0 12-13 35.74275 37.0 37.0 37.0 37.0 37.0 14-15 35.66625 37.0 37.0 37.0 37.0 37.0 16-17 35.794 37.0 37.0 37.0 37.0 37.0 18-19 35.647 37.0 37.0 37.0 37.0 37.0 20-21 35.636250000000004 37.0 37.0 37.0 37.0 37.0 22-23 35.7085 37.0 37.0 37.0 37.0 37.0 24-25 35.6435 37.0 37.0 37.0 37.0 37.0 26-27 35.51225 37.0 37.0 37.0 37.0 37.0 28-29 35.473749999999995 37.0 37.0 37.0 37.0 37.0 30-31 35.492000000000004 37.0 37.0 37.0 37.0 37.0 32-33 35.513999999999996 37.0 37.0 37.0 37.0 37.0 34-35 35.445750000000004 37.0 37.0 37.0 37.0 37.0 36-37 35.3715 37.0 37.0 37.0 37.0 37.0 38-39 35.397000000000006 37.0 37.0 37.0 37.0 37.0 40-41 35.41 37.0 37.0 37.0 37.0 37.0 42-43 35.257 37.0 37.0 37.0 31.0 37.0 44-45 35.353 37.0 37.0 37.0 37.0 37.0 46-47 35.26788394197098 37.0 37.0 37.0 31.0 37.0 48-49 35.35692846423211 37.0 37.0 37.0 37.0 37.0 50-51 35.341170585292645 37.0 37.0 37.0 37.0 37.0 52-53 35.21685842921461 37.0 37.0 37.0 25.0 37.0 54-55 35.326413206603306 37.0 37.0 37.0 37.0 37.0 56-57 35.3024012006003 37.0 37.0 37.0 31.0 37.0 58-59 35.269702276707534 37.0 37.0 37.0 31.0 37.0 60-61 35.24193144858644 37.0 37.0 37.0 31.0 37.0 62-63 35.23467600700525 37.0 37.0 37.0 31.0 37.0 64-65 35.16937703277458 37.0 37.0 37.0 25.0 37.0 66-67 35.14385789342006 37.0 37.0 37.0 25.0 37.0 68-69 35.0237678258694 37.0 37.0 37.0 25.0 37.0 70-71 35.11785866426847 37.0 37.0 37.0 25.0 37.0 72-73 35.103353353353356 37.0 37.0 37.0 25.0 37.0 74-75 35.04079298322102 37.0 37.0 37.0 25.0 37.0 76-77 35.13893280471396 37.0 37.0 37.0 25.0 37.0 78-79 35.09893133374187 37.0 37.0 37.0 25.0 37.0 80-81 35.10345691382766 37.0 37.0 37.0 25.0 37.0 82-83 35.14529058116233 37.0 37.0 37.0 31.0 37.0 84-85 34.997244488977955 37.0 37.0 37.0 25.0 37.0 86-87 35.12675350701403 37.0 37.0 37.0 25.0 37.0 88-89 35.05360721442886 37.0 37.0 37.0 25.0 37.0 90-91 34.96993987975952 37.0 37.0 37.0 25.0 37.0 92-93 35.03984962406015 37.0 37.0 37.0 25.0 37.0 94-95 34.981704260651625 37.0 37.0 37.0 25.0 37.0 96-97 34.99250793231511 37.0 37.0 37.0 25.0 37.0 98-99 35.039605963459806 37.0 37.0 37.0 25.0 37.0 100-101 34.95014531273399 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100-101 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 1.0 22 1.0 23 4.0 24 4.0 25 15.0 26 11.0 27 25.0 28 45.0 29 69.0 30 89.0 31 137.0 32 165.0 33 210.0 34 285.0 35 586.0 36 1950.0 37 403.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 27.150000000000002 12.875 17.849999999999998 42.125 2 26.91631063081176 19.42699170645891 28.87660216134707 24.780095501382256 3 26.424999999999997 23.025000000000002 22.2 28.349999999999998 4 29.75 26.0 17.825 26.424999999999997 5 28.025 27.925 20.75 23.3 6 23.075000000000003 31.7 20.375 24.85 7 22.25 16.375 36.125 25.25 8 22.675 20.5 24.775 32.05 9 22.650000000000002 18.875 27.474999999999998 31.0 10-11 27.075 26.375 19.05 27.500000000000004 12-13 24.337500000000002 20.95 25.374999999999996 29.3375 14-15 24.325 22.287499999999998 25.0375 28.349999999999998 16-17 25.6125 23.575 22.8125 28.000000000000004 18-19 25.387500000000003 23.175 24.05 27.3875 20-21 25.9875 23.0875 23.8625 27.0625 22-23 25.224999999999998 23.875 23.3 27.6 24-25 25.5 23.0125 23.599999999999998 27.8875 26-27 24.762500000000003 25.362499999999997 21.925 27.950000000000003 28-29 25.937500000000004 24.275 22.8625 26.924999999999997 30-31 25.2875 22.85 24.05 27.8125 32-33 25.374999999999996 23.75 23.3875 27.487499999999997 34-35 25.5125 24.6875 23.775 26.025 36-37 26.2875 23.5625 22.412499999999998 27.737499999999997 38-39 25.912499999999998 23.0 23.8375 27.250000000000004 40-41 25.912499999999998 24.349999999999998 23.974999999999998 25.7625 42-43 25.45 23.25 23.3625 27.9375 44-45 26.474999999999998 23.4875 22.6875 27.35 46-47 26.000500250125064 24.249624812406203 22.048524262131068 27.70135067533767 48-49 25.250125062531264 23.36168084042021 22.861430715357677 28.526763381690845 50-51 26.18809404702351 23.36168084042021 23.32416208104052 27.126063031515756 52-53 26.088044022011005 23.424212106053027 22.773886943471737 27.71385692846423 54-55 26.550775387693847 22.898949474737368 22.311155577788895 28.23911955977989 56-57 26.663331665832917 23.12406203101551 22.961480740370185 27.251125562781393 58-59 25.73179884913685 23.01726294721041 23.930447835876908 27.32049036777583 60-61 26.13209907430573 23.279959969977483 22.779584688516387 27.808356267200402 62-63 25.519139354515886 22.91718789091819 23.54265699274456 28.021015761821367 64-65 26.1195896922692 22.52939704778584 24.06805103827871 27.282962221666253 66-67 26.307230422817113 22.91718789091819 22.416812609457093 28.358769076807604 68-69 25.281461095821868 23.967975981986488 22.216662496872654 28.533900425318986 70-71 26.598273489303143 22.970098836481924 23.070186413111475 27.361441261103465 72-73 26.45145145145145 22.47247247247247 23.836336336336338 27.239739739739736 74-75 27.806282067325743 22.225003128519585 22.92579151545489 27.04292328869979 76-77 26.937038427838278 22.91901364376017 22.66866942045312 27.47527850794843 78-79 27.075767063243582 23.919849718221666 22.128991859737006 26.875391358797746 80-81 26.91633266533066 23.55961923847695 21.718436873747496 27.805611222444888 82-83 26.791082164328657 23.008517034068134 22.75801603206413 27.44238476953908 84-85 26.352705410821642 22.77054108216433 23.008517034068134 27.86823647294589 86-87 26.603206412825653 23.04609218436874 22.970941883767534 27.37975951903808 88-89 27.49248496993988 22.40731462925852 22.382264529058116 27.71793587174349 90-91 26.089679358717433 22.983466933867735 23.071142284569138 27.85571142284569 92-93 27.04260651629073 22.39348370927318 23.546365914786968 27.017543859649123 94-95 28.421052631578945 22.581453634085214 22.593984962406015 26.403508771929822 96-97 26.282131661442005 22.771159874608152 22.758620689655174 28.188087774294672 98-99 27.70381640674528 22.188411309750222 22.391276784582224 27.716495498922278 100-101 29.28012519561815 9.624413145539906 27.151799687010953 33.943661971830984 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.5 26 1.5 27 2.0 28 2.5 29 3.5 30 7.0 31 8.5 32 10.5 33 14.5 34 16.0 35 22.0 36 27.5 37 38.5 38 56.0 39 77.0 40 97.5 41 105.5 42 113.5 43 137.5 44 145.5 45 139.5 46 148.5 47 151.0 48 144.5 49 134.0 50 135.5 51 137.5 52 122.5 53 114.5 54 107.0 55 95.5 56 89.5 57 91.5 58 98.0 59 103.5 60 102.5 61 95.0 62 91.5 63 80.5 64 70.5 65 78.5 66 83.5 67 85.5 68 91.5 69 84.0 70 69.0 71 62.5 72 53.0 73 41.5 74 42.0 75 43.0 76 34.0 77 25.5 78 23.5 79 17.5 80 11.0 81 10.0 82 6.5 83 2.5 84 2.5 85 1.5 86 0.0 87 1.5 88 1.5 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.525 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 44-45 2.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 1.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 1.0 72-73 0.0 74-75 1.0 76-77 2.0 78-79 1.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 2.0 92-93 0.0 94-95 0.0 96-97 19.0 98-99 362.0 100-101 3609.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.475 #Duplication Level Percentage of deduplicated Percentage of total 1 93.60791655522867 87.5 2 5.8571810644557365 10.95 3 0.4814121422840332 1.35 4 0.05349023803155924 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 362553 spots for SRR21853518.sra Written 362553 spots for SRR21853518.sra Read 362553 spots for SRR21853518.sra Written 362553 spots for SRR21853518.sra Read 362553 spots for SRR21853518.sra Written 362553 spots for SRR21853518.sra Read 362553 spots for SRR21853518.sra Written 362553 spots for SRR21853518.sra Read 362553 spots for SRR21853518.sra Written 362553 spots for SRR21853518.sra Read 362562 spots for SRR21853518.sra Written 362562 spots for SRR21853518.sra Read 362553 spots for SRR21853518.sra Written 362553 spots for SRR21853518.sra Read 362553 spots for SRR21853518.sra Written 362553 spots for SRR21853518.sra Read 362553 spots for SRR21853518.sra Written 362553 spots for SRR21853518.sra Read 362553 spots for SRR21853518.sra Written 362553 spots for SRR21853518.sra Read 362553 spots for SRR21853518.sra Written 362553 spots for SRR21853518.sra Read 362553 spots for SRR21853518.sra Written 362553 spots for SRR21853518.sra Read 362553 spots for SRR21853518.sra Written 362553 spots for SRR21853518.sra Read 362553 spots for SRR21853518.sra Written 362553 spots for SRR21853518.sra Read 362553 spots for SRR21853518.sra Written 362553 spots for SRR21853518.sra Read 362553 spots for SRR21853518.sra Written 362553 spots for SRR21853518.sra Read 362553 spots for SRR21853518.sra Written 362553 spots for SRR21853518.sra Read 362553 spots for SRR21853518.sra Written 362553 spots for SRR21853518.sra Read 362553 spots for SRR21853518.sra Written 362553 spots for SRR21853518.sra Read 362553 spots for SRR21853518.sra Written 362553 spots for SRR21853518.sra SRR ids: ['SRR21853518.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_1l31rr7i SRR21853518.sra spots: 7251069 blocks: [[1, 362553], [362554, 725106], [725107, 1087659], [1087660, 1450212], [1450213, 1812765], [1812766, 2175318], [2175319, 2537871], [2537872, 2900424], [2900425, 3262977], [3262978, 3625530], [3625531, 3988083], [3988084, 4350636], [4350637, 4713189], [4713190, 5075742], [5075743, 5438295], [5438296, 5800848], [5800849, 6163401], [6163402, 6525954], [6525955, 6888507], [6888508, 7251069]] SRR21853518 file size 1948626 SRR21853518 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR21853518 SRR21853518_1.fastq Input file: SRR21853518_1.fastq trimmed: SRR21853518-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Fri Dec 6 16:52:05 2024 >> started Fri Dec 6 16:52:09 2024 >> done (3.914s) 7251069 reads processed; of these: 31 ( 0.00%) short reads filtered out after trimming by size control 34391 ( 0.47%) empty reads filtered out after trimming by size control 7216647 (99.53%) reads available; of these: 286 ( 0.00%) trimmed reads available after processing 7216361 (100.00%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 19 1 0.00% 20 7 0.00% 21 4 0.00% 22 4 0.00% 23 4 0.00% 24 1 0.00% 25 2 0.00% 26 4 0.00% 27 5 0.00% 28 3 0.00% 29 6 0.00% 30 6 0.00% 31 1 0.00% 32 3 0.00% 33 10 0.00% 34 3 0.00% 35 103 0.00% 36 118 0.00% 37 97 0.00% 38 116 0.00% 39 121 0.00% 40 115 0.00% 41 96 0.00% 42 116 0.00% 43 118 0.00% 44 92 0.00% 45 120 0.00% 46 116 0.00% 47 122 0.00% 48 103 0.00% 49 119 0.00% 50 124 0.00% 51 99 0.00% 52 122 0.00% 53 108 0.00% 54 111 0.00% 55 115 0.00% 56 105 0.00% 57 106 0.00% 58 131 0.00% 59 150 0.00% 60 142 0.00% 61 139 0.00% 62 141 0.00% 63 148 0.00% 64 148 0.00% 65 162 0.00% 66 157 0.00% 67 157 0.00% 68 162 0.00% 69 144 0.00% 70 171 0.00% 71 178 0.00% 72 163 0.00% 73 156 0.00% 74 180 0.00% 75 177 0.00% 76 189 0.00% 77 192 0.00% 78 241 0.00% 79 239 0.00% 80 227 0.00% 81 263 0.00% 82 269 0.00% 83 274 0.00% 84 294 0.00% 85 262 0.00% 86 306 0.00% 87 325 0.00% 88 345 0.00% 89 377 0.01% 90 390 0.01% 91 666 0.01% 92 502 0.01% 93 530 0.01% 94 895 0.01% 95 2217 0.03% 96 10154 0.14% 97 30581 0.42% 98 122088 1.69% 99 474135 6.57% 100 1539399 21.33% 101 5025855 69.64% 7216647 reads passed initial QC criterion=sequence-density sequence-density=0.25 sequence-density-rank=1 fanout-score=2.30 fanout-score-rank=23 prefix-density=0.29 prefix-fanout=2.0 sequence=GCTCCTTTCCAGGG criterion=fanout-score sequence-density=0.10 sequence-density-rank=24 fanout-score=264.79 fanout-score-rank=1 prefix-density=1.11 prefix-fanout=24.0 sequence=CGCCGCCGCCGA Started job on | Dec 06 16:52:25 Started mapping on | Dec 06 16:52:26 Finished on | Dec 06 16:52:40 Mapping speed, Million of reads per hour | 1855.71 Number of input reads | 7216647 Average input read length | 100 UNIQUE READS: Uniquely mapped reads number | 6743565 Uniquely mapped reads % | 93.44% Average mapped length | 100.26 Number of splices: Total | 2225554 Number of splices: Annotated (sjdb) | 2111630 Number of splices: GT/AG | 2194936 Number of splices: GC/AG | 26402 Number of splices: AT/AC | 1092 Number of splices: Non-canonical | 3124 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.00% Deletion average length | 2.01 Insertion rate per base | 0.00% Insertion average length | 1.92 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 209744 % of reads mapped to multiple loci | 2.91% Number of reads mapped to too many loci | 163354 % of reads mapped to too many loci | 2.26% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.05% % of reads unmapped: other | 0.33% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 263338 263338 263338 N_multimapping 209744 209744 209744 N_noFeature 226458 3489318 3393866 N_ambiguous 101489 9021 6436 UnstrandedReadsAssigned:6415618 PositiveStrandReadsAssigned:3245226 NegativeStrandReadsAssigned:3343263 Dataset is classified unstranded MeadianReadLen=101 20thPercentileLength=100 echo kmer=95 SRR21853518 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR21853518-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 7,216,647 reads, 6,599,163 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,154 rounds 52973 SRR21853518.ke.tsv 35125 SRR21853518.se.tsv 88098 total ==> SRR21853518.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 45.285 13.3885 PNS24247 1044 945 2.91667 0.763762 PNS24249 1928 1829 104.639 14.1574 PNS24246 1044 945 2.91667 0.763762 PNS24248 1044 945 2.91667 0.763762 PNS24244 1471 1372 8.32619 1.50174 PNS24243 293 194 2 2.55112 KQK14069 1603 1504 937.922 154.32 KQK14071 474 375 102.823 67.852 ==> SRR21853518.se.tsv <== BRADI_1g14170v3 1161 BRADI_1g53295v3 60 BRADI_1g59795v3 50 BRADI_1g07683v3 0 BRADI_1g00485v3 20 BRADI_1g20270v3 584 BRADI_1g74790v3 66 BRADI_1g09890v3 2 BRADI_1g77505v3 87 BRADI_1g48960v3 0 SRR21853518 completed mapping pipeline successfully