Starting /dee2/code/volunteer_pipeline.sh SRR21853519 current disk space = 1550554943488 free memory = 1597341796 SRR21853519 SRAfilesize 70eb932b1bd6019fdb2e2d57a34f599d SRR21853519.sra SRR21853519.sra file validated SRR21853519 is single end SRR21853519 is conventional basespace SRR21853519 read1 length is 35-101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR21853519_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 35-101 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.17875 32.0 32.0 32.0 32.0 32.0 2 31.32675 32.0 32.0 32.0 32.0 32.0 3 31.502 32.0 32.0 32.0 32.0 32.0 4 31.606 32.0 32.0 32.0 32.0 32.0 5 31.519 32.0 32.0 32.0 32.0 32.0 6 34.93625 36.0 36.0 36.0 36.0 36.0 7 35.1755 36.0 36.0 36.0 36.0 36.0 8 35.0365 36.0 36.0 36.0 36.0 36.0 9 35.06475 36.0 36.0 36.0 36.0 36.0 10-11 35.158874999999995 36.0 36.0 36.0 36.0 36.0 12-13 35.132999999999996 36.0 36.0 36.0 36.0 36.0 14-15 35.131375000000006 36.0 36.0 36.0 36.0 36.0 16-17 35.063375 36.0 36.0 36.0 36.0 36.0 18-19 35.096625 36.0 36.0 36.0 36.0 36.0 20-21 35.1165 36.0 36.0 36.0 36.0 36.0 22-23 34.979875 36.0 36.0 36.0 36.0 36.0 24-25 34.941 36.0 36.0 36.0 36.0 36.0 26-27 34.866625 36.0 36.0 36.0 34.0 36.0 28-29 34.962625 36.0 36.0 36.0 34.0 36.0 30-31 34.87325 36.0 36.0 36.0 34.0 36.0 32-33 34.838 36.0 36.0 36.0 32.0 36.0 34-35 34.876875 36.0 36.0 36.0 34.0 36.0 36-37 34.770442610652665 36.0 36.0 36.0 32.0 36.0 38-39 34.67654413603401 36.0 36.0 36.0 32.0 36.0 40-41 34.701050262565644 36.0 36.0 36.0 34.0 36.0 42-43 34.74731182795699 36.0 36.0 36.0 34.0 36.0 44-45 34.66991747936984 36.0 36.0 36.0 32.0 36.0 46-47 34.67941985496374 36.0 36.0 36.0 32.0 36.0 48-49 34.60890222555639 36.0 36.0 36.0 32.0 36.0 50-51 34.63678419604901 36.0 36.0 36.0 32.0 36.0 52-53 34.58702175543886 36.0 36.0 36.0 32.0 36.0 54-55 34.269067266816705 36.0 36.0 36.0 32.0 36.0 56-57 34.4377344336084 36.0 36.0 36.0 32.0 36.0 58-59 34.33883470867717 36.0 36.0 36.0 32.0 36.0 60-61 34.42923230807702 36.0 36.0 36.0 32.0 36.0 62-63 34.25156289072268 36.0 36.0 36.0 32.0 36.0 64-65 34.22043010752688 36.0 36.0 36.0 32.0 36.0 66-67 34.140410102525635 36.0 36.0 36.0 32.0 36.0 68-69 34.352895064686635 36.0 36.0 36.0 32.0 36.0 70-71 34.034642321160575 36.0 36.0 36.0 32.0 36.0 72-73 34.15145072536268 36.0 36.0 36.0 32.0 36.0 74-75 34.0403951975988 36.0 36.0 36.0 32.0 36.0 76-77 33.95785392696348 36.0 36.0 36.0 29.5 36.0 78-79 33.907078539269634 36.0 36.0 36.0 29.5 36.0 80-81 33.88844422211106 36.0 36.0 36.0 29.5 36.0 82-83 33.894572286143074 36.0 36.0 36.0 29.5 36.0 84-85 33.89469734867434 36.0 36.0 36.0 32.0 36.0 86-87 33.99599524555873 36.0 36.0 36.0 32.0 36.0 88-89 33.88503877908431 36.0 36.0 36.0 29.5 36.0 90-91 33.80735551663748 36.0 36.0 36.0 27.0 36.0 92-93 33.81498623967976 36.0 36.0 36.0 27.0 36.0 94-95 33.75938438438438 36.0 36.0 36.0 27.0 36.0 96-97 33.745470586832624 36.0 36.0 36.0 27.0 36.0 98-99 33.710996054593124 36.0 36.0 36.0 27.0 36.0 100-101 32.74000562372048 36.0 34.0 36.0 20.5 36.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 11101 1 0.0 11101 2 0.0 11101 3 0.0 11101 4 0.0 11101 5 0.0 11101 6 0.0 11101 7 0.0 11101 8 0.0 11101 9 0.0 11101 10-11 0.0 11101 12-13 0.0 11101 14-15 0.0 11101 16-17 0.0 11101 18-19 0.0 11101 20-21 0.0 11101 22-23 0.0 11101 24-25 0.0 11101 26-27 0.0 11101 28-29 0.0 11101 30-31 0.0 11101 32-33 0.0 11101 34-35 0.0 11101 36-37 0.0 11101 38-39 0.0 11101 40-41 0.0 11101 42-43 0.0 11101 44-45 0.0 11101 46-47 0.0 11101 48-49 0.0 11101 50-51 0.0 11101 52-53 0.0 11101 54-55 0.0 11101 56-57 0.0 11101 58-59 0.0 11101 60-61 0.0 11101 62-63 0.0 11101 64-65 0.0 11101 66-67 0.0 11101 68-69 0.0 11101 70-71 0.0 11101 72-73 0.0 11101 74-75 0.0 11101 76-77 0.0 11101 78-79 0.0 11101 80-81 0.0 11101 82-83 0.0 11101 84-85 0.0 11101 86-87 0.0 11101 88-89 0.0 11101 90-91 0.0 11101 92-93 0.0 11101 94-95 0.0 11101 96-97 0.0 11101 98-99 0.0 11101 100-101 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 2.0 20 0.0 21 1.0 22 4.0 23 5.0 24 7.0 25 24.0 26 30.0 27 44.0 28 62.0 29 75.0 30 110.0 31 134.0 32 191.0 33 333.0 34 659.0 35 2318.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 27.106776694173547 12.80320080020005 16.754188547136785 43.33583395848962 2 25.681420355088775 19.079769942485623 29.307326831707925 25.93148287071768 3 27.831957989497376 21.8304576144036 22.1055263815954 28.232058014503625 4 27.38184546136534 26.93173293323331 18.3295823955989 27.35683920980245 5 27.081770442610654 29.557389347336834 20.080020005001252 23.280820205051263 6 23.483709273182956 32.78195488721805 19.62406015037594 24.110275689223055 7 21.980495123780948 15.428857214303576 36.68417104276069 25.906476619154787 8 22.230557639409852 21.355338834708675 24.381095273818453 32.03300825206302 9 22.1055263815954 20.955238809702426 27.93198299574894 29.00725181295324 10-11 25.71892973243311 26.969242310577645 19.24231057764441 28.069517379344838 12-13 24.093523380845213 21.555388847211805 25.44386096524131 28.907226806701676 14-15 24.218554638659665 23.74343585896474 24.381095273818453 27.656914228557138 16-17 25.76894223555889 23.655913978494624 22.793198299574893 27.781945486371594 18-19 25.36884221055264 23.15578894723681 23.030757689422355 28.444611152788195 20-21 26.219054763690924 23.88097024256064 23.3183295823956 26.581645411352838 22-23 25.78144536134033 23.80595148787197 22.818204551137786 27.59439859964991 24-25 25.393848462115532 23.99349837459365 23.15578894723681 27.45686421605401 26-27 24.99374843710928 23.655913978494624 23.680920230057513 27.66941735433858 28-29 26.71917979494874 23.905976494123532 22.793198299574893 26.581645411352838 30-31 25.23130782695674 24.343585896474117 22.593148287071767 27.831957989497376 32-33 26.144036009002253 24.356089022255563 22.73068267066767 26.76919229807452 34-35 25.256314078519633 23.69342335583896 23.268317079269817 27.781945486371594 36-37 26.231557889472366 24.23105776444111 22.61815453863466 26.91922980745186 38-39 25.71892973243311 24.23105776444111 22.13053263315829 27.91947986996749 40-41 26.11902975743936 23.243310827706924 22.355588897224308 28.28207051762941 42-43 25.318829707426854 23.80595148787197 23.10577644411103 27.769442360590148 44-45 26.71917979494874 23.355838959739934 22.48062015503876 27.44436109027257 46-47 26.78169542385596 23.69342335583896 22.568142035508878 26.9567391847962 48-49 25.95648912228057 23.618404601150285 22.53063265816454 27.894473618404604 50-51 26.59414853713428 23.36834208552138 22.95573893473368 27.081770442610654 52-53 26.244061015253813 23.1807951987997 22.13053263315829 28.444611152788195 54-55 26.406601650412604 22.88072018004501 23.20580145036259 27.506876719179797 56-57 26.11902975743936 23.818454613653415 22.168042010502624 27.894473618404604 58-59 26.244061015253813 22.868217054263564 23.330832708177045 27.556889222305575 60-61 26.581645411352838 24.031007751937985 21.867966991747938 27.51937984496124 62-63 26.79419854963741 22.643160790197552 23.50587646911728 27.056764191047762 64-65 26.30657664416104 23.718429607401852 23.268317079269817 26.70667666916729 66-67 26.544136034008503 23.755938984746187 22.61815453863466 27.081770442610654 68-69 25.884706765036892 23.22120795298237 23.74640490183819 27.147680380142553 70-71 26.40070035017509 23.499249624812407 22.973986993496748 27.126063031515756 72-73 25.900450225112557 23.611805902951478 22.823911955977987 27.66383191595798 74-75 25.68784392196098 23.686843421710854 22.886443221610804 27.738869434717362 76-77 26.575787893946973 23.311655827913956 23.06153076538269 27.051025512756375 78-79 26.76338169084542 23.6368184092046 22.423711855927962 27.176088044022013 80-81 27.47623811905953 22.98649324662331 22.886443221610804 26.650825412706354 82-83 27.163581790895446 22.948974487243625 22.486243121560783 27.40120060030015 84-85 26.313156578289142 23.74937468734367 22.098549274637318 27.838919459729865 86-87 26.804252657911192 24.090056285178235 21.913696060037523 27.19199499687305 88-89 26.307230422817113 22.95471603702777 23.505128846634975 27.23292469352014 90-91 26.770077558168627 23.254941205904426 22.992244183137352 26.98273705278959 92-93 26.46985238929197 23.129847385539154 22.892169126845133 27.50813109832374 94-95 26.38888888888889 22.7977977977978 23.3983983983984 27.414914914914917 96-97 25.60120240480962 23.446893787575153 23.13376753507014 27.81813627254509 98-99 27.084917617237007 21.584283903675537 23.15589353612167 28.174904942965778 100-101 27.883868964446513 10.340009315323707 28.039124359571492 33.736997360658286 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 2.0 1 1.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 0.5 24 0.5 25 2.0 26 2.0 27 0.5 28 2.0 29 4.0 30 5.0 31 7.0 32 11.5 33 15.5 34 17.5 35 22.0 36 26.0 37 40.0 38 53.5 39 66.5 40 90.0 41 106.5 42 116.0 43 121.0 44 140.0 45 154.5 46 150.0 47 156.5 48 151.5 49 137.5 50 132.0 51 128.0 52 134.5 53 121.0 54 106.5 55 110.0 56 100.5 57 93.0 58 104.5 59 113.0 60 96.5 61 91.5 62 98.0 63 90.0 64 88.5 65 87.5 66 74.5 67 69.0 68 62.5 69 62.0 70 73.5 71 64.5 72 52.0 73 49.0 74 43.0 75 32.5 76 27.0 77 24.0 78 18.0 79 14.5 80 11.5 81 7.5 82 5.5 83 4.5 84 3.5 85 3.5 86 1.0 87 1.0 88 1.0 89 0.5 90 0.5 91 0.0 92 0.0 93 0.0 94 0.0 95 0.5 96 0.5 97 0.0 98 0.0 99 0.5 100 1.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.025 3 0.025 4 0.025 5 0.025 6 0.25 7 0.025 8 0.025 9 0.025 10-11 0.025 12-13 0.025 14-15 0.025 16-17 0.025 18-19 0.025 20-21 0.025 22-23 0.025 24-25 0.025 26-27 0.025 28-29 0.025 30-31 0.025 32-33 0.025 34-35 0.025 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 34-35 1.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 1.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 1.0 88-89 0.0 90-91 0.0 92-93 1.0 94-95 2.0 96-97 24.0 98-99 318.0 100-101 3652.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.45 #Duplication Level Percentage of deduplicated Percentage of total 1 99.52237305178483 98.97500000000001 2 0.40221216691804923 0.8 3 0.07541478129713425 0.22499999999999998 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.025 16-17 0.0 0.0 0.0 0.0 0.025 18-19 0.0 0.0 0.0 0.0 0.025 20-21 0.0 0.0 0.0 0.0 0.025 22-23 0.0 0.0 0.0 0.0 0.025 24-25 0.0 0.0 0.0 0.0 0.025 26-27 0.0 0.0 0.0 0.0 0.025 28-29 0.0 0.0 0.0 0.0 0.025 30-31 0.0 0.0 0.0 0.0 0.025 32-33 0.0 0.0 0.0 0.0 0.025 34-35 0.0 0.0 0.0 0.0 0.025 36-37 0.0 0.0 0.0 0.0 0.025 38-39 0.0 0.0 0.0 0.0 0.025 40-41 0.0 0.0 0.0 0.0 0.025 42-43 0.0 0.0 0.0 0.0 0.025 44-45 0.0 0.0 0.0 0.0 0.025 46-47 0.0 0.0 0.0 0.0 0.025 48-49 0.0 0.0 0.0 0.0 0.025 50-51 0.0 0.0 0.0 0.0 0.025 52-53 0.0 0.0 0.0 0.0 0.025 54-55 0.0 0.0 0.0 0.0 0.025 56-57 0.0 0.0 0.0 0.0 0.025 58-59 0.0 0.0 0.0 0.0 0.025 60-61 0.0 0.0 0.0 0.0 0.025 62-63 0.0 0.0 0.0 0.0 0.025 64-65 0.0 0.0 0.0 0.0 0.025 66-67 0.0 0.0 0.0 0.0 0.025 68-69 0.0 0.0 0.0 0.0 0.025 70-71 0.0 0.0 0.0 0.0 0.025 72-73 0.0 0.0 0.0 0.0 0.025 74-75 0.0 0.0 0.0 0.0 0.025 76-77 0.0 0.0 0.0 0.0 0.025 78-79 0.0 0.0 0.0 0.0 0.025 80-81 0.0 0.0 0.0 0.0 0.025 82-83 0.0 0.0 0.0 0.0 0.025 84-85 0.0 0.0 0.0 0.0 0.025 86-87 0.0 0.0 0.0 0.0 0.025 88-89 0.0 0.0 0.0 0.0 0.025 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 436330 spots for SRR21853519.sra Written 436330 spots for SRR21853519.sra Read 436330 spots for SRR21853519.sra Written 436330 spots for SRR21853519.sra Read 436330 spots for SRR21853519.sra Written 436330 spots for SRR21853519.sra Read 436330 spots for SRR21853519.sra Written 436330 spots for SRR21853519.sra Read 436330 spots for SRR21853519.sra Written 436330 spots for SRR21853519.sra Read 436349 spots for SRR21853519.sra Written 436349 spots for SRR21853519.sra Read 436330 spots for SRR21853519.sra Written 436330 spots for SRR21853519.sra Read 436330 spots for SRR21853519.sra Written 436330 spots for SRR21853519.sra Read 436330 spots for SRR21853519.sra Written 436330 spots for SRR21853519.sra Read 436330 spots for SRR21853519.sra Written 436330 spots for SRR21853519.sra Read 436330 spots for SRR21853519.sra Written 436330 spots for SRR21853519.sra Read 436330 spots for SRR21853519.sra Written 436330 spots for SRR21853519.sra Read 436330 spots for SRR21853519.sra Written 436330 spots for SRR21853519.sra Read 436330 spots for SRR21853519.sra Written 436330 spots for SRR21853519.sra Read 436330 spots for SRR21853519.sra Written 436330 spots for SRR21853519.sra Read 436330 spots for SRR21853519.sra Written 436330 spots for SRR21853519.sra Read 436330 spots for SRR21853519.sra Written 436330 spots for SRR21853519.sra Read 436330 spots for SRR21853519.sra Written 436330 spots for SRR21853519.sra Read 436330 spots for SRR21853519.sra Written 436330 spots for SRR21853519.sra Read 436330 spots for SRR21853519.sra Written 436330 spots for SRR21853519.sra SRR ids: ['SRR21853519.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_36442ty7 SRR21853519.sra spots: 8726619 blocks: [[1, 436330], [436331, 872660], [872661, 1308990], [1308991, 1745320], [1745321, 2181650], [2181651, 2617980], [2617981, 3054310], [3054311, 3490640], [3490641, 3926970], [3926971, 4363300], [4363301, 4799630], [4799631, 5235960], [5235961, 5672290], [5672291, 6108620], [6108621, 6544950], [6544951, 6981280], [6981281, 7417610], [7417611, 7853940], [7853941, 8290270], [8290271, 8726619]] SRR21853519 file size 2378259 SRR21853519 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR21853519 SRR21853519_1.fastq Input file: SRR21853519_1.fastq trimmed: SRR21853519-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Fri Dec 6 16:51:50 2024 >> started Fri Dec 6 16:51:58 2024 >> done (7.536s) 8726619 reads processed; of these: 26 ( 0.00%) short reads filtered out after trimming by size control 29539 ( 0.34%) empty reads filtered out after trimming by size control 8697054 (99.66%) reads available; of these: 74 ( 0.00%) trimmed reads available after processing 8696980 (100.00%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 0 0.00% 20 1 0.00% 21 0 0.00% 22 4 0.00% 23 1 0.00% 24 0 0.00% 25 0 0.00% 26 2 0.00% 27 2 0.00% 28 0 0.00% 29 1 0.00% 30 1 0.00% 31 1 0.00% 32 0 0.00% 33 0 0.00% 34 2 0.00% 35 53 0.00% 36 72 0.00% 37 50 0.00% 38 71 0.00% 39 50 0.00% 40 50 0.00% 41 50 0.00% 42 56 0.00% 43 62 0.00% 44 57 0.00% 45 66 0.00% 46 50 0.00% 47 66 0.00% 48 58 0.00% 49 73 0.00% 50 66 0.00% 51 77 0.00% 52 75 0.00% 53 66 0.00% 54 79 0.00% 55 69 0.00% 56 78 0.00% 57 88 0.00% 58 85 0.00% 59 75 0.00% 60 83 0.00% 61 77 0.00% 62 108 0.00% 63 101 0.00% 64 89 0.00% 65 105 0.00% 66 76 0.00% 67 94 0.00% 68 110 0.00% 69 113 0.00% 70 119 0.00% 71 149 0.00% 72 133 0.00% 73 130 0.00% 74 138 0.00% 75 145 0.00% 76 158 0.00% 77 151 0.00% 78 169 0.00% 79 163 0.00% 80 191 0.00% 81 218 0.00% 82 196 0.00% 83 208 0.00% 84 232 0.00% 85 253 0.00% 86 274 0.00% 87 304 0.00% 88 296 0.00% 89 328 0.00% 90 336 0.00% 91 622 0.01% 92 410 0.00% 93 491 0.01% 94 916 0.01% 95 2492 0.03% 96 11155 0.13% 97 36129 0.42% 98 141771 1.63% 99 554773 6.38% 100 1816466 20.89% 101 6124924 70.43% 8697054 reads passed initial QC criterion=sequence-density sequence-density=0.47 sequence-density-rank=1 fanout-score=2.30 fanout-score-rank=20 prefix-density=0.49 prefix-fanout=2.2 sequence=CCATGGCACCCACCGTGATGGCTTCCTCCGCCACCTCCGTGGC criterion=fanout-score sequence-density=0.12 sequence-density-rank=20 fanout-score=243.31 fanout-score-rank=1 prefix-density=1.15 prefix-fanout=25.5 sequence=GCCGCCGCCACCCTGA Started job on | Dec 06 16:52:14 Started mapping on | Dec 06 16:52:14 Finished on | Dec 06 16:52:27 Mapping speed, Million of reads per hour | 2408.41 Number of input reads | 8697054 Average input read length | 100 UNIQUE READS: Uniquely mapped reads number | 8068286 Uniquely mapped reads % | 92.77% Average mapped length | 100.28 Number of splices: Total | 2599877 Number of splices: Annotated (sjdb) | 2468576 Number of splices: GT/AG | 2565270 Number of splices: GC/AG | 30302 Number of splices: AT/AC | 1319 Number of splices: Non-canonical | 2986 Mismatch rate per base, % | 0.30% Deletion rate per base | 0.00% Deletion average length | 1.73 Insertion rate per base | 0.00% Insertion average length | 1.88 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 250355 % of reads mapped to multiple loci | 2.88% Number of reads mapped to too many loci | 213092 % of reads mapped to too many loci | 2.45% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.66% % of reads unmapped: other | 0.24% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 378413 378413 378413 N_multimapping 250355 250355 250355 N_noFeature 266925 4181132 4052402 N_ambiguous 120348 12043 7610 UnstrandedReadsAssigned:7681013 PositiveStrandReadsAssigned:3875111 NegativeStrandReadsAssigned:4008274 Dataset is classified unstranded MeadianReadLen=101 20thPercentileLength=100 echo kmer=95 SRR21853519 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR21853519-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 8,697,054 reads, 7,958,897 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,167 rounds 52973 SRR21853519.ke.tsv 35125 SRR21853519.se.tsv 88098 total ==> SRR21853519.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 11.6042 2.81423 PNS24247 1044 945 11.6667 2.50603 PNS24249 1928 1829 123.093 13.6613 PNS24246 1044 945 11.6667 2.50603 PNS24248 1044 945 11.6667 2.50603 PNS24244 1471 1372 8.30239 1.22834 PNS24243 293 194 8 8.37065 KQK14069 1603 1504 1008.25 136.079 KQK14071 474 375 114.49 61.9734 ==> SRR21853519.se.tsv <== BRADI_1g14170v3 1181 BRADI_1g53295v3 60 BRADI_1g59795v3 59 BRADI_1g07683v3 0 BRADI_1g00485v3 28 BRADI_1g20270v3 696 BRADI_1g74790v3 90 BRADI_1g09890v3 6 BRADI_1g77505v3 89 BRADI_1g48960v3 0 SRR21853519 completed mapping pipeline successfully