Starting /dee2/code/volunteer_pipeline.sh SRR21853520 current disk space = 1550626955264 free memory = 1600484152 SRR21853520 SRAfilesize 5dce06b305c197ec2ac3dd4c403183b5 SRR21853520.sra SRR21853520.sra file validated SRR21853520 is single end SRR21853520 is conventional basespace SRR21853520 read1 length is 35-101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR21853520_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 35-101 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.29475 37.0 37.0 37.0 37.0 37.0 2 35.152 37.0 37.0 37.0 25.0 37.0 3 35.58675 37.0 37.0 37.0 37.0 37.0 4 35.81225 37.0 37.0 37.0 37.0 37.0 5 35.89175 37.0 37.0 37.0 37.0 37.0 6 35.86225 37.0 37.0 37.0 37.0 37.0 7 35.61825 37.0 37.0 37.0 37.0 37.0 8 35.86425 37.0 37.0 37.0 37.0 37.0 9 35.86075 37.0 37.0 37.0 37.0 37.0 10-11 35.98525 37.0 37.0 37.0 37.0 37.0 12-13 35.832750000000004 37.0 37.0 37.0 37.0 37.0 14-15 35.87875 37.0 37.0 37.0 37.0 37.0 16-17 35.946 37.0 37.0 37.0 37.0 37.0 18-19 35.860749999999996 37.0 37.0 37.0 37.0 37.0 20-21 35.933 37.0 37.0 37.0 37.0 37.0 22-23 35.785 37.0 37.0 37.0 37.0 37.0 24-25 35.81125 37.0 37.0 37.0 37.0 37.0 26-27 35.65475 37.0 37.0 37.0 37.0 37.0 28-29 35.674 37.0 37.0 37.0 37.0 37.0 30-31 35.569 37.0 37.0 37.0 37.0 37.0 32-33 35.75375 37.0 37.0 37.0 37.0 37.0 34-35 35.64625 37.0 37.0 37.0 37.0 37.0 36-37 35.648912228057014 37.0 37.0 37.0 37.0 37.0 38-39 35.57114278569642 37.0 37.0 37.0 37.0 37.0 40-41 35.58764691172793 37.0 37.0 37.0 37.0 37.0 42-43 35.52663165791448 37.0 37.0 37.0 37.0 37.0 44-45 35.47111777944486 37.0 37.0 37.0 37.0 37.0 46-47 35.64666166541635 37.0 37.0 37.0 37.0 37.0 48-49 35.554388597149284 37.0 37.0 37.0 37.0 37.0 50-51 35.470367591897976 37.0 37.0 37.0 37.0 37.0 52-53 35.436859214803704 37.0 37.0 37.0 37.0 37.0 54-55 35.57089272318079 37.0 37.0 37.0 37.0 37.0 56-57 35.44347173586793 37.0 37.0 37.0 37.0 37.0 58-59 35.40645322661331 37.0 37.0 37.0 37.0 37.0 60-61 35.42971485742871 37.0 37.0 37.0 37.0 37.0 62-63 35.358679339669834 37.0 37.0 37.0 37.0 37.0 64-65 35.27200596543578 37.0 37.0 37.0 31.0 37.0 66-67 35.35894868585732 37.0 37.0 37.0 37.0 37.0 68-69 35.15322095268723 37.0 37.0 37.0 25.0 37.0 70-71 35.18407212622088 37.0 37.0 37.0 25.0 37.0 72-73 35.296268469822195 37.0 37.0 37.0 37.0 37.0 74-75 35.44653143000251 37.0 37.0 37.0 37.0 37.0 76-77 35.29326321061858 37.0 37.0 37.0 31.0 37.0 78-79 35.383420986726776 37.0 37.0 37.0 37.0 37.0 80-81 35.333416833667336 37.0 37.0 37.0 37.0 37.0 82-83 35.27980961923848 37.0 37.0 37.0 31.0 37.0 84-85 35.245490981963925 37.0 37.0 37.0 31.0 37.0 86-87 35.328406813627254 37.0 37.0 37.0 37.0 37.0 88-89 35.23071142284569 37.0 37.0 37.0 31.0 37.0 90-91 35.34678025557504 37.0 37.0 37.0 37.0 37.0 92-93 35.37678616194535 37.0 37.0 37.0 37.0 37.0 94-95 35.16771120581599 37.0 37.0 37.0 25.0 37.0 96-97 35.21128061999774 37.0 37.0 37.0 31.0 37.0 98-99 35.12558617868966 37.0 37.0 37.0 25.0 37.0 100-101 35.1899564843815 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100-101 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 1.0 20 1.0 21 2.0 22 3.0 23 4.0 24 5.0 25 9.0 26 13.0 27 28.0 28 27.0 29 63.0 30 73.0 31 95.0 32 128.0 33 191.0 34 278.0 35 522.0 36 2074.0 37 482.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 27.93198299574894 13.628407101775444 19.079769942485623 39.35983995999 2 24.107591754650578 21.266968325791854 31.674208144796378 22.951231774761187 3 24.8062015503876 23.080770192548137 25.456364091022753 26.65666416604151 4 27.35683920980245 28.832208052013 19.05476369092273 24.756189047261813 5 28.33208302075519 30.357589397349336 20.605151287821954 20.705176294073517 6 23.53088272068017 33.558389597399355 21.655413853463365 21.255313828457115 7 19.254813703425857 18.454613653413354 37.90947736934234 24.381095273818453 8 21.680420105026258 24.056014003500874 25.331332833208304 28.93223305826457 9 22.05551387846962 22.080520130032507 27.656914228557138 28.207051762940733 10-11 26.16904226056514 29.56989247311828 19.642410602650664 24.618654663665918 12-13 23.58089522380595 23.243310827706924 26.506626656664167 26.669167291822955 14-15 22.61815453863466 25.068767191797946 25.36884221055264 26.944236059014752 16-17 23.193298324581146 25.64391097774444 25.268817204301076 25.893973493373345 18-19 23.69342335583896 25.656414103525883 25.343835958989747 25.30632658164541 20-21 24.76869217304326 26.056514128532132 24.868717179294826 24.306076519129782 22-23 23.730932733183295 26.219054763690924 24.831207801950487 25.218804701175294 24-25 23.618404601150285 25.818954738684667 24.318579644911228 26.244061015253813 26-27 23.74343585896474 25.581395348837212 25.418854713678417 25.256314078519633 28-29 24.218554638659665 25.55638909727432 24.493623405851466 25.731432858214554 30-31 24.318579644911228 26.03150787696924 24.99374843710928 24.656164041010253 32-33 23.793448362090523 26.881720430107524 24.81870467616904 24.50612653163291 34-35 23.99349837459365 25.581395348837212 25.406351587896975 25.018754688672168 36-37 23.0432608152038 25.28132033008252 25.581395348837212 26.094023505876468 38-39 24.356089022255563 25.78144536134033 24.44361090272568 25.418854713678417 40-41 24.568642160540136 25.343835958989747 25.068767191797946 25.018754688672168 42-43 22.655663915978995 26.03150787696924 26.11902975743936 25.1937984496124 44-45 23.680920230057513 24.831207801950487 25.681420355088775 25.806451612903224 46-47 25.431357839459867 25.143785946486624 24.81870467616904 24.60615153788447 48-49 24.143535883970994 26.494123530882717 25.36884221055264 23.99349837459365 50-51 24.518629657414355 24.76869217304326 25.568892223055762 25.143785946486624 52-53 23.868467116779193 25.30632658164541 24.456114028507127 26.36909227306827 54-55 24.33108277069267 24.81870467616904 24.718679669917478 26.131532883220803 56-57 24.412206103051524 25.512756378189096 25.3751875937969 24.69984992496248 58-59 24.349674837418707 25.887943971985994 25.52526263131566 24.23711855927964 60-61 24.64982491245623 24.824912456228116 24.84992496248124 25.67533766883442 62-63 22.773886943471737 24.524762381190595 26.25062531265633 26.450725362681343 64-65 24.021018391092205 25.59739772300763 25.672463405479796 24.709120480420367 66-67 23.85481852315394 25.93241551939925 24.330413016270338 25.882352941176475 68-69 24.824737105658485 25.926389584376565 24.386579869804706 24.86229344016024 70-71 26.37114951164538 24.242424242424242 25.45704983721513 23.929376408715253 72-73 25.25669922364137 25.807663410969194 24.267468069120962 24.66816929626847 74-75 25.356874530428247 25.6198347107438 24.480340596043078 24.542950162784873 76-77 26.008014024542952 24.94365138993238 24.30503380916604 24.74330077635863 78-79 25.29426496368645 25.694966190833963 24.02955171550213 24.98121712997746 80-81 25.56362725450902 26.265030060120242 23.584669338677354 24.586673346693384 82-83 25.187875751503007 25.688877755511026 24.599198396793586 24.524048096192384 84-85 25.651302605210418 25.212925851703403 23.972945891783567 25.162825651302605 86-87 24.148296593186373 25.67635270541082 25.400801603206414 24.774549098196395 88-89 25.288076152304612 25.726452905811627 24.34869739478958 24.636773547094187 90-91 25.331996993234778 25.895765472312704 24.668003006765222 24.104234527687296 92-93 25.520180496365004 25.307094509902235 24.12885434946102 25.04387064427175 94-95 24.75557783905741 25.946352469290552 25.344697919278016 23.95337177237403 96-97 23.94631209232313 25.413948820873056 25.087807325639737 25.551931761164077 98-99 25.546795523906408 24.440488301119025 24.974567650050865 25.038148524923702 100-101 26.830034558592526 11.482877788250079 30.99277411247251 30.694313540684888 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 6.0 1 3.0 2 0.0 3 0.5 4 0.5 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 1.0 15 1.0 16 0.0 17 0.5 18 0.5 19 0.0 20 0.0 21 1.5 22 2.5 23 2.5 24 2.5 25 2.0 26 3.0 27 5.0 28 5.0 29 4.5 30 10.5 31 16.5 32 25.5 33 27.0 34 28.5 35 40.5 36 51.0 37 61.0 38 81.0 39 104.5 40 124.5 41 132.5 42 150.0 43 194.5 44 201.5 45 190.0 46 187.0 47 169.0 48 162.5 49 154.0 50 141.5 51 139.5 52 127.5 53 116.0 54 115.0 55 105.0 56 94.5 57 95.5 58 88.5 59 70.0 60 63.5 61 66.0 62 71.5 63 69.0 64 52.5 65 59.0 66 60.0 67 46.5 68 41.5 69 36.5 70 30.0 71 28.5 72 26.5 73 21.5 74 22.5 75 17.0 76 12.0 77 14.0 78 11.0 79 4.0 80 1.0 81 1.0 82 0.5 83 1.0 84 0.5 85 0.0 86 0.5 87 0.5 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.5499999999999999 3 0.025 4 0.025 5 0.025 6 0.025 7 0.025 8 0.025 9 0.025 10-11 0.025 12-13 0.025 14-15 0.025 16-17 0.025 18-19 0.025 20-21 0.025 22-23 0.025 24-25 0.025 26-27 0.025 28-29 0.025 30-31 0.025 32-33 0.025 34-35 0.025 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 34-35 1.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 1.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 3.0 66-67 0.0 68-69 2.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 1.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 1.0 90-91 2.0 92-93 0.0 94-95 0.0 96-97 26.0 98-99 322.0 100-101 3641.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.64999999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 91.39547710976282 82.85 2 7.859900717043574 14.249999999999998 3 0.4964147821290678 1.35 4 0.1654715940430226 0.6 5 0.027578599007170437 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.05515719801434087 0.8250000000000001 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACCGCTCATTATCTCGTAT 23 0.575 TruSeq Adapter, Index 2 (97% over 37bp) GATCGGAAGAGCACACGTCTGAACTCCAGTCACCGCTCATTATCGCGTAT 10 0.25 TruSeq Adapter, Index 2 (97% over 37bp) AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 424887 spots for SRR21853520.sra Written 424887 spots for SRR21853520.sra Read 424887 spots for SRR21853520.sra Written 424887 spots for SRR21853520.sra Read 424887 spots for SRR21853520.sra Written 424887 spots for SRR21853520.sra Read 424887 spots for SRR21853520.sra Written 424887 spots for SRR21853520.sra Read 424887 spots for SRR21853520.sra Written 424887 spots for SRR21853520.sra Read 424887 spots for SRR21853520.sra Written 424887 spots for SRR21853520.sra Read 424887 spots for SRR21853520.sra Written 424887 spots for SRR21853520.sra Read 424887 spots for SRR21853520.sra Written 424887 spots for SRR21853520.sra Read 424887 spots for SRR21853520.sra Written 424887 spots for SRR21853520.sra Read 424887 spots for SRR21853520.sra Written 424887 spots for SRR21853520.sra Read 424894 spots for SRR21853520.sra Written 424894 spots for SRR21853520.sra Read 424887 spots for SRR21853520.sra Written 424887 spots for SRR21853520.sra Read 424887 spots for SRR21853520.sra Written 424887 spots for SRR21853520.sra Read 424887 spots for SRR21853520.sra Written 424887 spots for SRR21853520.sra Read 424887 spots for SRR21853520.sra Written 424887 spots for SRR21853520.sra Read 424887 spots for SRR21853520.sra Written 424887 spots for SRR21853520.sra Read 424887 spots for SRR21853520.sra Written 424887 spots for SRR21853520.sra Read 424887 spots for SRR21853520.sra Written 424887 spots for SRR21853520.sra Read 424887 spots for SRR21853520.sra Written 424887 spots for SRR21853520.sra Read 424887 spots for SRR21853520.sra Written 424887 spots for SRR21853520.sra SRR ids: ['SRR21853520.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_3ovtdw6f SRR21853520.sra spots: 8497747 blocks: [[1, 424887], [424888, 849774], [849775, 1274661], [1274662, 1699548], [1699549, 2124435], [2124436, 2549322], [2549323, 2974209], [2974210, 3399096], [3399097, 3823983], [3823984, 4248870], [4248871, 4673757], [4673758, 5098644], [5098645, 5523531], [5523532, 5948418], [5948419, 6373305], [6373306, 6798192], [6798193, 7223079], [7223080, 7647966], [7647967, 8072853], [8072854, 8497747]] SRR21853520 file size 2283417 SRR21853520 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR21853520 SRR21853520_1.fastq Input file: SRR21853520_1.fastq trimmed: SRR21853520-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Fri Dec 6 16:55:54 2024 >> started Fri Dec 6 16:55:58 2024 >> done (4.680s) 8497747 reads processed; of these: 35 ( 0.00%) short reads filtered out after trimming by size control 71547 ( 0.84%) empty reads filtered out after trimming by size control 8426165 (99.16%) reads available; of these: 267 ( 0.00%) trimmed reads available after processing 8425898 (100.00%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 1 0.00% 20 3 0.00% 21 1 0.00% 22 2 0.00% 23 4 0.00% 24 3 0.00% 25 2 0.00% 26 3 0.00% 27 4 0.00% 28 4 0.00% 29 6 0.00% 30 2 0.00% 31 5 0.00% 32 3 0.00% 33 5 0.00% 34 6 0.00% 35 119 0.00% 36 115 0.00% 37 109 0.00% 38 114 0.00% 39 119 0.00% 40 128 0.00% 41 126 0.00% 42 106 0.00% 43 121 0.00% 44 122 0.00% 45 121 0.00% 46 128 0.00% 47 135 0.00% 48 125 0.00% 49 131 0.00% 50 158 0.00% 51 179 0.00% 52 133 0.00% 53 170 0.00% 54 174 0.00% 55 177 0.00% 56 187 0.00% 57 168 0.00% 58 192 0.00% 59 197 0.00% 60 195 0.00% 61 177 0.00% 62 210 0.00% 63 184 0.00% 64 236 0.00% 65 227 0.00% 66 239 0.00% 67 207 0.00% 68 317 0.00% 69 232 0.00% 70 248 0.00% 71 260 0.00% 72 281 0.00% 73 263 0.00% 74 249 0.00% 75 289 0.00% 76 302 0.00% 77 320 0.00% 78 321 0.00% 79 356 0.00% 80 343 0.00% 81 375 0.00% 82 397 0.00% 83 406 0.00% 84 443 0.01% 85 414 0.00% 86 454 0.01% 87 471 0.01% 88 521 0.01% 89 564 0.01% 90 559 0.01% 91 934 0.01% 92 594 0.01% 93 640 0.01% 94 1021 0.01% 95 2382 0.03% 96 11830 0.14% 97 41830 0.50% 98 158194 1.88% 99 562476 6.68% 100 1992481 23.65% 101 5640112 66.94% 8426165 reads passed initial QC criterion=sequence-density sequence-density=0.18 sequence-density-rank=1 fanout-score=1.97 fanout-score-rank=33 prefix-density=0.17 prefix-fanout=2.0 sequence=CCGTCAATTCCTTT criterion=fanout-score sequence-density=0.07 sequence-density-rank=20 fanout-score=198.08 fanout-score-rank=1 prefix-density=0.61 prefix-fanout=23.1 sequence=CGCCGCCGCCGC Started job on | Dec 06 16:56:16 Started mapping on | Dec 06 16:56:16 Finished on | Dec 06 16:56:32 Mapping speed, Million of reads per hour | 1895.89 Number of input reads | 8426165 Average input read length | 100 UNIQUE READS: Uniquely mapped reads number | 7453509 Uniquely mapped reads % | 88.46% Average mapped length | 100.14 Number of splices: Total | 2739400 Number of splices: Annotated (sjdb) | 2583921 Number of splices: GT/AG | 2701569 Number of splices: GC/AG | 30649 Number of splices: AT/AC | 1517 Number of splices: Non-canonical | 5665 Mismatch rate per base, % | 0.39% Deletion rate per base | 0.01% Deletion average length | 2.18 Insertion rate per base | 0.01% Insertion average length | 2.03 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 331679 % of reads mapped to multiple loci | 3.94% Number of reads mapped to too many loci | 426766 % of reads mapped to too many loci | 5.06% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.79% % of reads unmapped: other | 0.75% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 640977 640977 640977 N_multimapping 331679 331679 331679 N_noFeature 469012 3945972 3884058 N_ambiguous 106270 6947 7493 UnstrandedReadsAssigned:6878227 PositiveStrandReadsAssigned:3500590 NegativeStrandReadsAssigned:3561958 Dataset is classified unstranded MeadianReadLen=101 20thPercentileLength=100 echo kmer=95 SRR21853520 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR21853520-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 8,426,165 reads, 7,162,286 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,084 rounds 52973 SRR21853520.ke.tsv 35125 SRR21853520.se.tsv 88098 total ==> SRR21853520.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 40.9214 12.2791 PNS24247 1044 945 5.83333 1.55034 PNS24249 1928 1829 35.2808 4.8447 PNS24246 1044 945 5.83333 1.55034 PNS24248 1044 945 5.83333 1.55034 PNS24244 1471 1372 25.2978 4.63095 PNS24243 293 194 8 10.3569 KQK14069 1603 1504 2145.12 358.217 KQK14071 474 375 146.89 98.3794 ==> SRR21853520.se.tsv <== BRADI_1g14170v3 2416 BRADI_1g53295v3 36 BRADI_1g59795v3 131 BRADI_1g07683v3 0 BRADI_1g00485v3 31 BRADI_1g20270v3 217 BRADI_1g74790v3 43 BRADI_1g09890v3 0 BRADI_1g77505v3 40 BRADI_1g48960v3 0 SRR21853520 completed mapping pipeline successfully