Starting /dee2/code/volunteer_pipeline.sh SRR21853521 current disk space = 1550622523392 free memory = 1603550984 SRR21853521 SRAfilesize b685c0ff5f0e83db3ca4e250bc408476 SRR21853521.sra SRR21853521.sra file validated SRR21853521 is single end SRR21853521 is conventional basespace SRR21853521 read1 length is 35-101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR21853521_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 35-101 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.266 37.0 37.0 37.0 37.0 37.0 2 35.507 37.0 37.0 37.0 37.0 37.0 3 35.762 37.0 37.0 37.0 37.0 37.0 4 35.8345 37.0 37.0 37.0 37.0 37.0 5 36.0105 37.0 37.0 37.0 37.0 37.0 6 35.867 37.0 37.0 37.0 37.0 37.0 7 35.7315 37.0 37.0 37.0 37.0 37.0 8 35.978 37.0 37.0 37.0 37.0 37.0 9 35.926 37.0 37.0 37.0 37.0 37.0 10-11 35.945 37.0 37.0 37.0 37.0 37.0 12-13 35.9795 37.0 37.0 37.0 37.0 37.0 14-15 35.997 37.0 37.0 37.0 37.0 37.0 16-17 35.962 37.0 37.0 37.0 37.0 37.0 18-19 35.93 37.0 37.0 37.0 37.0 37.0 20-21 35.955 37.0 37.0 37.0 37.0 37.0 22-23 35.825 37.0 37.0 37.0 37.0 37.0 24-25 35.846000000000004 37.0 37.0 37.0 37.0 37.0 26-27 35.82225 37.0 37.0 37.0 37.0 37.0 28-29 35.729749999999996 37.0 37.0 37.0 37.0 37.0 30-31 35.760000000000005 37.0 37.0 37.0 37.0 37.0 32-33 35.69775 37.0 37.0 37.0 37.0 37.0 34-35 35.678 37.0 37.0 37.0 37.0 37.0 36-37 35.751001001001 37.0 37.0 37.0 37.0 37.0 38-39 35.67242242242243 37.0 37.0 37.0 37.0 37.0 40-41 35.65165165165165 37.0 37.0 37.0 37.0 37.0 42-43 35.71113892365457 37.0 37.0 37.0 37.0 37.0 44-45 35.66758448060075 37.0 37.0 37.0 37.0 37.0 46-47 35.51439299123905 37.0 37.0 37.0 37.0 37.0 48-49 35.471589486858576 37.0 37.0 37.0 37.0 37.0 50-51 35.50212765957447 37.0 37.0 37.0 37.0 37.0 52-53 35.498372966207754 37.0 37.0 37.0 37.0 37.0 54-55 35.4145181476846 37.0 37.0 37.0 37.0 37.0 56-57 35.27083854818523 37.0 37.0 37.0 31.0 37.0 58-59 35.296871088861074 37.0 37.0 37.0 31.0 37.0 60-61 35.393491864831034 37.0 37.0 37.0 37.0 37.0 62-63 35.10891337005508 37.0 37.0 37.0 25.0 37.0 64-65 35.15247871807712 37.0 37.0 37.0 25.0 37.0 66-67 35.28417626439659 37.0 37.0 37.0 31.0 37.0 68-69 35.17351026539809 37.0 37.0 37.0 25.0 37.0 70-71 35.144466700050074 37.0 37.0 37.0 25.0 37.0 72-73 35.14296444667001 37.0 37.0 37.0 25.0 37.0 74-75 35.2586379569354 37.0 37.0 37.0 31.0 37.0 76-77 35.22684026039059 37.0 37.0 37.0 25.0 37.0 78-79 35.08037055583375 37.0 37.0 37.0 25.0 37.0 80-81 35.15625623509143 37.0 37.0 37.0 25.0 37.0 82-83 35.07412972702229 37.0 37.0 37.0 25.0 37.0 84-85 35.05785123966942 37.0 37.0 37.0 25.0 37.0 86-87 35.03931880791385 37.0 37.0 37.0 25.0 37.0 88-89 34.89976933317516 37.0 37.0 37.0 25.0 37.0 90-91 34.74910703683249 37.0 37.0 37.0 25.0 37.0 92-93 34.851805416248745 37.0 37.0 37.0 25.0 37.0 94-95 34.77521324636227 37.0 37.0 37.0 25.0 37.0 96-97 34.70077811879912 37.0 37.0 37.0 25.0 37.0 98-99 34.652612463236025 37.0 37.0 37.0 25.0 37.0 100-101 34.55927983381091 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 2101 1 0.0 2101 2 0.0 2101 3 0.0 2101 4 0.0 2101 5 0.0 2101 6 0.0 2101 7 0.0 2101 8 0.0 2101 9 0.0 2101 10-11 0.0 2101 12-13 0.0 2101 14-15 0.0 2101 16-17 0.0 2101 18-19 0.0 2101 20-21 0.0 2101 22-23 0.0 2101 24-25 0.0 2101 26-27 0.0 2101 28-29 0.0 2101 30-31 0.0 2101 32-33 0.0 2101 34-35 0.0 2101 36-37 0.0 2101 38-39 0.0 2101 40-41 0.0 2101 42-43 0.0 2101 44-45 0.0 2101 46-47 0.0 2101 48-49 0.0 2101 50-51 0.0 2101 52-53 0.0 2101 54-55 0.0 2101 56-57 0.0 2101 58-59 0.0 2101 60-61 0.0 2101 62-63 0.0 2101 64-65 0.0 2101 66-67 0.0 2101 68-69 0.0 2101 70-71 0.0 2101 72-73 0.0 2101 74-75 0.0 2101 76-77 0.0 2101 78-79 0.0 2101 80-81 0.0 2101 82-83 0.0 2101 84-85 0.0 2101 86-87 0.0 2101 88-89 0.0 2101 90-91 0.0 2101 92-93 0.0 2101 94-95 0.0 2101 96-97 0.0 2101 98-99 0.0 2101 100-101 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 4.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 1.0 20 0.0 21 0.0 22 1.0 23 4.0 24 4.0 25 7.0 26 11.0 27 23.0 28 41.0 29 45.0 30 79.0 31 96.0 32 134.0 33 201.0 34 327.0 35 675.0 36 1979.0 37 368.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 28.918377566349523 13.57035553329995 18.452679018527792 39.05858788182273 2 24.524524524524523 19.944944944944947 32.532532532532535 22.997997997998 3 26.151151151151154 23.8988988988989 25.125125125125123 24.824824824824827 4 25.775775775775777 28.603603603603606 19.644644644644647 25.975975975975974 5 27.57757757757758 31.456456456456454 20.92092092092092 20.045045045045047 6 21.92192192192192 33.433433433433436 22.597597597597595 22.047047047047048 7 19.244244244244243 16.74174174174174 39.489489489489486 24.524524524524523 8 22.57257257257257 22.3973973973974 26.851851851851855 28.178178178178175 9 21.496496496496498 21.096096096096094 30.03003003003003 27.37737737737738 10-11 25.425425425425423 29.016516516516518 21.75925925925926 23.7987987987988 12-13 22.84784784784785 23.185685685685687 27.43993993993994 26.526526526526528 14-15 22.86036036036036 25.18768768768769 26.814314314314313 25.13763763763764 16-17 25.788288288288285 24.34934934934935 24.987487487487485 24.874874874874877 18-19 23.886386386386384 25.08758758758759 26.026026026026027 25.0 20-21 23.686186186186188 26.05105105105105 25.2002002002002 25.06256256256256 22-23 23.473473473473476 26.25125125125125 24.93743743743744 25.33783783783784 24-25 22.972972972972975 25.625625625625624 25.212712712712715 26.18868868868869 26-27 23.96146146146146 25.713213213213216 25.06256256256256 25.262762762762765 28-29 25.45045045045045 25.25025025025025 24.624624624624623 24.674674674674673 30-31 23.81131131131131 25.237737737737735 25.362862862862862 25.58808808808809 32-33 23.573573573573572 26.113613613613612 25.212712712712715 25.100100100100097 34-35 24.8998998998999 25.825825825825827 24.687187187187188 24.587087087087088 36-37 23.26076076076076 25.237737737737735 26.038538538538536 25.462962962962965 38-39 24.236736736736734 25.625625625625624 25.175175175175173 24.96246246246246 40-41 25.212712712712715 24.424424424424423 25.63813813813814 24.724724724724727 42-43 23.404255319148938 24.6433041301627 25.75719649561952 26.195244055068834 44-45 23.917396745932415 26.29536921151439 25.381727158948685 24.405506883604506 46-47 24.58072590738423 24.80600750938673 25.90738423028786 24.705882352941178 48-49 24.20525657071339 24.342928660826033 26.345431789737173 25.106382978723403 50-51 24.4180225281602 26.37046307884856 25.306633291614517 23.90488110137672 52-53 24.76846057571965 25.5819774718398 24.85607008760951 24.793491864831037 54-55 24.718397997496872 24.780976220275345 25.294117647058822 25.20650813516896 56-57 23.817271589486857 25.732165206508135 25.431789737171464 25.018773466833544 58-59 25.018773466833544 24.4180225281602 25.556946182728414 25.00625782227785 60-61 25.168961201501876 24.81852315394243 26.095118898623284 23.917396745932415 62-63 24.499248873309966 25.375563345017525 24.887330996494743 25.237856785177765 64-65 25.250375563345017 24.674511767651477 25.10015022533801 24.9749624436655 66-67 25.01251877816725 25.876314471707563 24.98748122183275 24.123685528292437 68-69 24.211316975463195 26.727591387080622 25.27541311967952 23.785678517776667 70-71 24.849774661992992 25.425638457686528 24.949924887330997 24.774661992989483 72-73 25.237856785177765 24.59939909864797 25.575863795693543 24.586880320480724 74-75 24.76214321482223 24.887330996494743 24.73710565848773 25.61342013019529 76-77 26.051577366049074 24.386579869804706 24.73710565848773 24.824737105658485 78-79 25.450676014021035 24.361542313470206 25.801201802704053 24.386579869804706 80-81 25.20345561537499 24.514836609490423 24.87792663077501 25.403781144359584 82-83 25.156523916854496 25.519659403956922 24.64312546957175 24.68069120961683 84-85 25.832707237665915 25.532181317305287 24.292511895817682 24.34259954921112 86-87 24.9686952166291 25.870272977710997 24.530428249436515 24.63060355622339 88-89 24.790179130652636 24.71501941625955 25.353876988600778 25.140924464487036 90-91 25.59217947111167 24.251159293144504 25.02819902243389 25.128462213309938 92-93 25.614343029087262 25.514042126379138 24.32296890672016 24.54864593781344 94-95 25.22579026593076 25.57701956848971 24.172102358253888 25.02508780732564 96-97 25.426706827309236 24.52309236947791 25.01255020080321 25.037650602409638 98-99 25.476977868226914 24.459425082676166 25.540574917323838 24.523022131773086 100-101 27.158358232426483 11.605598364522724 30.90108507626985 30.334958326780942 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 11.0 1 6.0 2 0.5 3 1.0 4 1.5 5 1.5 6 1.5 7 0.5 8 0.0 9 0.5 10 1.0 11 1.5 12 1.5 13 1.0 14 1.5 15 1.0 16 0.0 17 1.0 18 1.0 19 0.5 20 0.5 21 0.0 22 0.0 23 0.0 24 1.0 25 2.5 26 2.0 27 3.0 28 6.0 29 7.0 30 8.5 31 9.5 32 18.5 33 30.0 34 33.0 35 33.5 36 39.5 37 63.0 38 86.5 39 102.0 40 127.0 41 142.5 42 149.5 43 171.0 44 181.5 45 175.5 46 176.0 47 190.5 48 185.5 49 165.5 50 148.0 51 145.0 52 137.0 53 127.5 54 125.0 55 106.0 56 95.0 57 91.0 58 82.5 59 75.5 60 74.0 61 70.0 62 66.5 63 59.0 64 53.0 65 56.0 66 51.0 67 43.0 68 32.0 69 30.0 70 36.0 71 29.5 72 22.5 73 21.5 74 20.5 75 17.0 76 15.5 77 10.5 78 8.5 79 7.5 80 4.5 81 2.0 82 1.5 83 1.5 84 0.5 85 0.0 86 0.0 87 0.5 88 0.5 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.15 2 0.1 3 0.1 4 0.1 5 0.1 6 0.1 7 0.1 8 0.1 9 0.1 10-11 0.1 12-13 0.1 14-15 0.1 16-17 0.1 18-19 0.1 20-21 0.1 22-23 0.1 24-25 0.1 26-27 0.1 28-29 0.1 30-31 0.1 32-33 0.1 34-35 0.1 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 34-35 4.0 36-37 0.0 38-39 0.0 40-41 1.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 1.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 1.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 3.0 90-91 2.0 92-93 2.0 94-95 1.0 96-97 20.0 98-99 325.0 100-101 3640.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.80000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 93.72306034482759 86.97500000000001 2 5.899784482758621 10.95 3 0.21551724137931033 0.6 4 0.02693965517241379 0.1 5 0.02693965517241379 0.125 6 0.05387931034482758 0.3 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.05387931034482758 0.95 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACCGCTCATTATCTCGTAT 23 0.575 TruSeq Adapter, Index 2 (97% over 37bp) TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT 15 0.375 No Hit AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA 6 0.15 No Hit GATCGGAAGAGCACACGTCTGAACTCCAGTCACCGCTCATTATCGCGTAT 6 0.15 TruSeq Adapter, Index 2 (97% over 37bp) TTTGGTGAAACAGCTGGGCACTGAACAAACATATACTGTCCACTCTTATA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 153703 spots for SRR21853521.sra Written 153703 spots for SRR21853521.sra Read 153703 spots for SRR21853521.sra Written 153703 spots for SRR21853521.sra Read 153703 spots for SRR21853521.sra Written 153703 spots for SRR21853521.sra Read 153703 spots for SRR21853521.sra Written 153703 spots for SRR21853521.sra Read 153703 spots for SRR21853521.sra Written 153703 spots for SRR21853521.sra Read 153703 spots for SRR21853521.sra Written 153703 spots for SRR21853521.sra Read 153703 spots for SRR21853521.sra Written 153703 spots for SRR21853521.sra Read 153703 spots for SRR21853521.sra Written 153703 spots for SRR21853521.sra Read 153703 spots for SRR21853521.sra Written 153703 spots for SRR21853521.sra Read 153703 spots for SRR21853521.sra Written 153703 spots for SRR21853521.sra Read 153703 spots for SRR21853521.sra Written 153703 spots for SRR21853521.sra Read 153703 spots for SRR21853521.sra Written 153703 spots for SRR21853521.sra Read 153703 spots for SRR21853521.sra Written 153703 spots for SRR21853521.sra Read 153703 spots for SRR21853521.sra Written 153703 spots for SRR21853521.sra Read 153703 spots for SRR21853521.sra Written 153703 spots for SRR21853521.sra Read 153703 spots for SRR21853521.sra Written 153703 spots for SRR21853521.sra Read 153703 spots for SRR21853521.sra Written 153703 spots for SRR21853521.sra Read 153703 spots for SRR21853521.sra Written 153703 spots for SRR21853521.sra Read 153705 spots for SRR21853521.sra Written 153705 spots for SRR21853521.sra Read 153703 spots for SRR21853521.sra Written 153703 spots for SRR21853521.sra SRR ids: ['SRR21853521.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_dmftstly SRR21853521.sra spots: 3074062 blocks: [[1, 153703], [153704, 307406], [307407, 461109], [461110, 614812], [614813, 768515], [768516, 922218], [922219, 1075921], [1075922, 1229624], [1229625, 1383327], [1383328, 1537030], [1537031, 1690733], [1690734, 1844436], [1844437, 1998139], [1998140, 2151842], [2151843, 2305545], [2305546, 2459248], [2459249, 2612951], [2612952, 2766654], [2766655, 2920357], [2920358, 3074062]] SRR21853521 file size 825432 SRR21853521 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR21853521 SRR21853521_1.fastq Input file: SRR21853521_1.fastq trimmed: SRR21853521-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Fri Dec 6 16:58:10 2024 >> started Fri Dec 6 16:58:12 2024 >> done (1.947s) 3074062 reads processed; of these: 7 ( 0.00%) short reads filtered out after trimming by size control 24485 ( 0.80%) empty reads filtered out after trimming by size control 3049570 (99.20%) reads available; of these: 237 ( 0.01%) trimmed reads available after processing 3049333 (99.99%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 20 1 0.00% 21 0 0.00% 22 1 0.00% 23 0 0.00% 24 0 0.00% 25 3 0.00% 26 1 0.00% 27 2 0.00% 28 0 0.00% 29 2 0.00% 30 0 0.00% 31 2 0.00% 32 1 0.00% 33 1 0.00% 34 4 0.00% 35 41 0.00% 36 36 0.00% 37 21 0.00% 38 43 0.00% 39 28 0.00% 40 21 0.00% 41 35 0.00% 42 33 0.00% 43 38 0.00% 44 21 0.00% 45 35 0.00% 46 39 0.00% 47 31 0.00% 48 35 0.00% 49 35 0.00% 50 38 0.00% 51 38 0.00% 52 47 0.00% 53 37 0.00% 54 44 0.00% 55 46 0.00% 56 39 0.00% 57 34 0.00% 58 51 0.00% 59 69 0.00% 60 49 0.00% 61 62 0.00% 62 51 0.00% 63 51 0.00% 64 58 0.00% 65 59 0.00% 66 64 0.00% 67 70 0.00% 68 79 0.00% 69 70 0.00% 70 76 0.00% 71 63 0.00% 72 73 0.00% 73 74 0.00% 74 82 0.00% 75 83 0.00% 76 104 0.00% 77 86 0.00% 78 102 0.00% 79 78 0.00% 80 118 0.00% 81 118 0.00% 82 156 0.01% 83 141 0.00% 84 127 0.00% 85 166 0.01% 86 148 0.00% 87 189 0.01% 88 176 0.01% 89 184 0.01% 90 242 0.01% 91 357 0.01% 92 287 0.01% 93 334 0.01% 94 435 0.01% 95 892 0.03% 96 4339 0.14% 97 15077 0.49% 98 56930 1.87% 99 204740 6.71% 100 715723 23.47% 101 2046304 67.10% 3049570 reads passed initial QC criterion=sequence-density sequence-density=0.19 sequence-density-rank=1 fanout-score=1.93 fanout-score-rank=34 prefix-density=0.18 prefix-fanout=1.9 sequence=CCGTCAATTCCTTT criterion=fanout-score sequence-density=0.07 sequence-density-rank=21 fanout-score=212.30 fanout-score-rank=1 prefix-density=0.62 prefix-fanout=24.1 sequence=CGCCGCCGCCGC Started job on | Dec 06 16:58:35 Started mapping on | Dec 06 16:58:35 Finished on | Dec 06 16:58:46 Mapping speed, Million of reads per hour | 998.04 Number of input reads | 3049570 Average input read length | 100 UNIQUE READS: Uniquely mapped reads number | 2635542 Uniquely mapped reads % | 86.42% Average mapped length | 100.18 Number of splices: Total | 963020 Number of splices: Annotated (sjdb) | 908587 Number of splices: GT/AG | 949870 Number of splices: GC/AG | 10606 Number of splices: AT/AC | 585 Number of splices: Non-canonical | 1959 Mismatch rate per base, % | 0.28% Deletion rate per base | 0.01% Deletion average length | 2.14 Insertion rate per base | 0.01% Insertion average length | 2.03 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 116948 % of reads mapped to multiple loci | 3.83% Number of reads mapped to too many loci | 171161 % of reads mapped to too many loci | 5.61% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.67% % of reads unmapped: other | 0.46% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 297080 297080 297080 N_multimapping 116948 116948 116948 N_noFeature 167977 1400086 1370823 N_ambiguous 37498 2451 2692 UnstrandedReadsAssigned:2430067 PositiveStrandReadsAssigned:1233005 NegativeStrandReadsAssigned:1262027 Dataset is classified unstranded MeadianReadLen=101 20thPercentileLength=100 echo kmer=95 SRR21853521 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR21853521-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 3,049,570 reads, 2,536,373 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 989 rounds 52973 SRR21853521.ke.tsv 35125 SRR21853521.se.tsv 88098 total ==> SRR21853521.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 0 0 PNS24247 1044 945 3.84775 2.89974 PNS24249 1928 1829 17.4568 6.79727 PNS24246 1044 945 3.84775 2.89974 PNS24248 1044 945 3.84775 2.89974 PNS24244 1471 1372 0 0 PNS24243 293 194 1 3.67099 KQK14069 1603 1504 754.773 357.399 KQK14071 474 375 66.2422 125.802 ==> SRR21853521.se.tsv <== BRADI_1g14170v3 870 BRADI_1g53295v3 14 BRADI_1g59795v3 39 BRADI_1g07683v3 0 BRADI_1g00485v3 8 BRADI_1g20270v3 65 BRADI_1g74790v3 19 BRADI_1g09890v3 0 BRADI_1g77505v3 32 BRADI_1g48960v3 0 SRR21853521 completed mapping pipeline successfully