Starting /dee2/code/volunteer_pipeline.sh SRR21853522 current disk space = 1550640279552 free memory = 1343682656 SRR21853522 SRAfilesize 9ce0ce90c439fb3a313f87cf51092385 SRR21853522.sra SRR21853522.sra file validated SRR21853522 is single end SRR21853522 is conventional basespace SRR21853522 read1 length is 35-101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR21853522_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 35-101 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.97375 32.0 32.0 32.0 32.0 32.0 2 31.3075 32.0 32.0 32.0 32.0 32.0 3 31.478 32.0 32.0 32.0 32.0 32.0 4 31.631 32.0 32.0 32.0 32.0 32.0 5 31.6755 32.0 32.0 32.0 32.0 32.0 6 35.1005 36.0 36.0 36.0 36.0 36.0 7 35.16525 36.0 36.0 36.0 36.0 36.0 8 35.11225 36.0 36.0 36.0 36.0 36.0 9 35.09 36.0 36.0 36.0 36.0 36.0 10-11 35.136375 36.0 36.0 36.0 36.0 36.0 12-13 35.0815 36.0 36.0 36.0 36.0 36.0 14-15 35.079125000000005 36.0 36.0 36.0 36.0 36.0 16-17 35.0695 36.0 36.0 36.0 36.0 36.0 18-19 35.118624999999994 36.0 36.0 36.0 36.0 36.0 20-21 34.984 36.0 36.0 36.0 36.0 36.0 22-23 35.006249999999994 36.0 36.0 36.0 36.0 36.0 24-25 34.986125 36.0 36.0 36.0 36.0 36.0 26-27 34.849875 36.0 36.0 36.0 36.0 36.0 28-29 34.894375 36.0 36.0 36.0 36.0 36.0 30-31 34.88575 36.0 36.0 36.0 36.0 36.0 32-33 34.689125000000004 36.0 36.0 36.0 34.0 36.0 34-35 34.703 36.0 36.0 36.0 32.0 36.0 36-37 34.69756953144575 36.0 36.0 36.0 32.0 36.0 38-39 34.73189676772739 36.0 36.0 36.0 36.0 36.0 40-41 34.59609120521173 36.0 36.0 36.0 32.0 36.0 42-43 34.57103482836382 36.0 36.0 36.0 32.0 36.0 44-45 34.312954146830364 36.0 36.0 36.0 32.0 36.0 46-47 34.62315209220746 36.0 36.0 36.0 32.0 36.0 48-49 34.65610122776246 36.0 36.0 36.0 32.0 36.0 50-51 34.66612377850163 36.0 36.0 36.0 32.0 36.0 52-53 34.470558757203705 36.0 36.0 36.0 32.0 36.0 54-55 34.373715860686545 36.0 36.0 36.0 32.0 36.0 56-57 34.36168879979955 36.0 36.0 36.0 32.0 36.0 58-59 34.22788774743172 36.0 36.0 36.0 32.0 36.0 60-61 34.348784765722876 36.0 36.0 36.0 32.0 36.0 62-63 34.24745034096139 36.0 36.0 36.0 32.0 36.0 64-65 34.23947368421052 36.0 36.0 36.0 32.0 36.0 66-67 34.092481203007516 36.0 36.0 36.0 32.0 36.0 68-69 34.26766917293233 36.0 36.0 36.0 32.0 36.0 70-71 34.12205513784461 36.0 36.0 36.0 32.0 36.0 72-73 33.79248120300752 36.0 36.0 36.0 29.5 36.0 74-75 33.563909774436084 36.0 36.0 36.0 27.0 36.0 76-77 33.42387631148566 36.0 36.0 36.0 24.0 36.0 78-79 33.83993482075708 36.0 36.0 36.0 29.5 36.0 80-81 33.784281774880924 36.0 36.0 36.0 27.0 36.0 82-83 33.931812484331914 36.0 36.0 36.0 29.5 36.0 84-85 33.88631235898721 36.0 36.0 36.0 29.5 36.0 86-87 33.92165044667921 36.0 36.0 36.0 29.5 36.0 88-89 33.97465892348829 36.0 36.0 36.0 32.0 36.0 90-91 33.90702981136613 36.0 36.0 36.0 29.5 36.0 92-93 33.87198795180723 36.0 36.0 36.0 29.5 36.0 94-95 33.87749063035975 36.0 36.0 36.0 29.5 36.0 96-97 33.72549308912238 36.0 36.0 36.0 27.0 36.0 98-99 33.72619441584905 36.0 36.0 36.0 27.0 36.0 100-101 33.13128781649525 36.0 34.0 36.0 24.0 36.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 11101 1 0.0 11101 2 0.0 11101 3 0.0 11101 4 0.0 11101 5 0.0 11101 6 0.0 11101 7 0.0 11101 8 0.0 11101 9 0.0 11101 10-11 0.0 11101 12-13 0.0 11101 14-15 0.0 11101 16-17 0.0 11101 18-19 0.0 11101 20-21 0.0 11101 22-23 0.0 11101 24-25 0.0 11101 26-27 0.0 11101 28-29 0.0 11101 30-31 0.0 11101 32-33 0.0 11101 34-35 0.0 11101 36-37 0.0 11101 38-39 0.0 11101 40-41 0.0 11101 42-43 0.0 11101 44-45 0.0 11101 46-47 0.0 11101 48-49 0.0 11101 50-51 0.0 11101 52-53 0.0 11101 54-55 0.0 11101 56-57 0.0 11101 58-59 0.0 11101 60-61 0.0 11101 62-63 0.0 11101 64-65 0.0 11101 66-67 0.0 11101 68-69 0.0 11101 70-71 0.0 11101 72-73 0.0 11101 74-75 0.0 11101 76-77 0.0 11101 78-79 0.0 11101 80-81 0.0 11101 82-83 0.0 11101 84-85 0.0 11101 86-87 0.0 11101 88-89 0.0 11101 90-91 0.0 11101 92-93 0.0 11101 94-95 0.0 11101 96-97 0.0 11101 98-99 0.0 11101 100-101 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 9.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 1.0 18 4.0 19 9.0 20 6.0 21 6.0 22 12.0 23 10.0 24 9.0 25 23.0 26 25.0 27 32.0 28 58.0 29 77.0 30 107.0 31 114.0 32 166.0 33 310.0 34 626.0 35 2396.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 30.794287146078673 13.254823352543221 19.067902781257832 36.88298672012027 2 23.95389626659985 23.878727136056128 31.170132798797294 20.99724379854673 3 24.17940365823102 24.53019293410173 27.060886995740418 24.229516411926834 4 23.72838887496868 28.539213229766975 19.84465046354297 27.887747431721372 5 27.662240040090204 31.044850914557752 20.8970182911551 20.395890754196945 6 24.943594885936324 32.288794184006015 21.108047129606415 21.659563800451238 7 20.12027060886996 19.468804810824356 37.709847156101226 22.70107742420446 8 21.348033074417437 24.30468554247056 25.557504384865947 28.789776998246055 9 23.327486845402152 21.373089451265347 28.664495114006517 26.634928589325984 10-11 26.910548734652966 29.077925331996994 19.706840390879478 24.30468554247056 12-13 23.18967677273866 23.177148584314708 25.88323728388875 27.74993735905788 14-15 23.390127787521926 25.732899022801302 25.645201703833624 25.231771485843147 16-17 25.093961413179656 23.753445251816586 24.25457278877474 26.898020546229017 18-19 23.816086193936357 24.517664745677774 25.695314457529438 25.970934602856428 20-21 25.482335254322226 24.580305687797544 25.85818090704084 24.07917815083939 22-23 23.227261338010525 27.574542721122526 24.805813079428717 24.392382861438236 24-25 24.24204460035079 24.743172137308946 26.033575544976195 24.981207717364068 26-27 23.615635179153095 24.392382861438236 24.906038586820344 27.08594337258832 28-29 24.85592583312453 26.584815835630167 24.843397644700577 23.715860686544726 30-31 23.59057880230519 24.605362064645455 26.37183663242295 25.432222500626413 32-33 24.24204460035079 26.860435980957153 24.455023803558003 24.442495615134053 34-35 25.85818090704084 25.043848659483835 24.191931846654974 24.906038586820344 36-37 23.515409671761464 24.53019293410173 26.73515409671762 25.21924329741919 38-39 23.039338511651213 26.121272863943872 24.555249310949637 26.284139313455274 40-41 23.916311701327988 24.267100977198698 27.61212728639439 24.204460035078927 42-43 23.79102981708845 25.2442996742671 27.399148083187168 23.565522425457278 44-45 24.204460035078927 24.617890253069405 25.444750689050366 25.732899022801302 46-47 24.705587572037082 25.10648960160361 24.768228514156853 25.419694312202456 48-49 23.653219744424955 26.49711851666249 25.920821849160614 23.92883988975194 50-51 25.808068153345026 24.843397644700577 26.43447757454272 22.91405662741168 52-53 23.62816336757705 24.154347281383114 24.480080180405913 27.737409170633924 54-55 25.043848659483835 25.432222500626413 25.620145326985718 23.903783512904035 56-57 24.029065397143572 25.119017790027563 25.732899022801302 25.119017790027563 58-59 23.427712352793787 24.517664745677774 25.732899022801302 26.321723878727138 60-61 25.432222500626413 24.605362064645455 26.835379604109242 23.12703583061889 62-63 24.320260618970053 23.643653677484025 26.1746648289688 25.861420874577117 64-65 25.263157894736842 24.899749373433583 25.927318295739347 23.909774436090224 66-67 23.533834586466167 27.719298245614034 25.288220551378448 23.458646616541355 68-69 23.884711779448622 26.992481203007518 24.82456140350877 24.29824561403509 70-71 23.471177944862156 28.709273182957396 23.734335839598998 24.085213032581454 72-73 23.721804511278197 27.506265664160402 25.35087719298246 23.42105263157895 74-75 24.097744360902258 26.94235588972431 25.075187969924812 23.884711779448622 76-77 26.093495425491913 25.003133224714873 25.19112670760747 23.712244642185738 78-79 27.06192028077212 24.667836550513915 24.75557783905741 23.514665329656555 80-81 27.65104036099273 24.417147154675355 24.80571571822512 23.126096766106794 82-83 27.751316119328152 24.655302080721984 24.016044121333668 23.577337678616196 84-85 26.82376535472549 24.943594885936324 24.241664577588367 23.990975181749814 86-87 26.76780341023069 26.10330992978937 24.172517552657975 22.956369107321965 88-89 27.078891257995735 24.858898783393954 24.093816631130064 23.968393327480246 90-91 27.47459540835529 24.413498933634425 24.739681344875173 23.372224313135114 92-93 26.40562248995984 24.87449799196787 24.73644578313253 23.98343373493976 94-95 27.111836324839967 24.18727249905862 24.764654198569097 23.93623697753232 96-97 27.368685599396837 24.704699673284743 25.245036441316916 22.681578286001507 98-99 27.00395055435198 23.7415572830381 25.37275391869504 23.88173824391487 100-101 28.50563760520883 11.354613307924408 31.570589169445768 28.569159917420993 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 39.0 1 22.5 2 3.0 3 1.0 4 1.5 5 0.5 6 0.0 7 0.0 8 0.0 9 1.0 10 1.0 11 1.0 12 1.0 13 0.5 14 0.5 15 1.5 16 2.0 17 0.5 18 0.0 19 1.5 20 1.5 21 1.5 22 2.0 23 1.0 24 1.0 25 1.0 26 2.5 27 4.5 28 5.0 29 7.0 30 10.5 31 13.5 32 18.5 33 22.5 34 26.5 35 35.0 36 48.5 37 70.5 38 76.5 39 84.0 40 112.0 41 139.0 42 170.0 43 184.0 44 172.5 45 167.0 46 169.5 47 162.0 48 158.5 49 166.5 50 151.5 51 134.0 52 125.0 53 111.0 54 111.5 55 114.5 56 107.0 57 102.5 58 100.5 59 136.0 60 121.5 61 62.0 62 55.0 63 47.0 64 41.5 65 42.0 66 38.0 67 37.5 68 39.0 69 35.0 70 35.0 71 28.5 72 21.0 73 21.5 74 17.0 75 17.0 76 13.5 77 7.0 78 6.5 79 4.5 80 2.5 81 2.0 82 3.5 83 2.5 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.5 91 0.5 92 0.5 93 1.0 94 1.0 95 1.0 96 0.5 97 2.0 98 2.0 99 1.5 100 4.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.22499999999999998 2 0.22499999999999998 3 0.22499999999999998 4 0.22499999999999998 5 0.22499999999999998 6 0.27499999999999997 7 0.22499999999999998 8 0.22499999999999998 9 0.22499999999999998 10-11 0.22499999999999998 12-13 0.22499999999999998 14-15 0.22499999999999998 16-17 0.22499999999999998 18-19 0.22499999999999998 20-21 0.22499999999999998 22-23 0.22499999999999998 24-25 0.22499999999999998 26-27 0.22499999999999998 28-29 0.22499999999999998 30-31 0.22499999999999998 32-33 0.22499999999999998 34-35 0.22499999999999998 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 34-35 9.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 1.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 1.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 2.0 88-89 1.0 90-91 2.0 92-93 0.0 94-95 2.0 96-97 28.0 98-99 331.0 100-101 3623.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.125 #Duplication Level Percentage of deduplicated Percentage of total 1 99.23784494086728 94.39999999999999 2 0.5519053876478318 1.05 3 0.052562417871222074 0.15 4 0.026281208935611037 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.026281208935611037 0.22499999999999998 >10 0.07884362680683311 1.075 >50 0.0 0.0 >100 0.026281208935611037 3.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACCGCTCATTATCTCGTAT 120 3.0 TruSeq Adapter, Index 2 (97% over 37bp) TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT 21 0.525 No Hit AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA 11 0.27499999999999997 No Hit GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 11 0.27499999999999997 No Hit NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 9 0.22499999999999998 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 83802 spots for SRR21853522.sra Written 83802 spots for SRR21853522.sra Read 83802 spots for SRR21853522.sra Written 83802 spots for SRR21853522.sra Read 83802 spots for SRR21853522.sra Written 83802 spots for SRR21853522.sra Read 83802 spots for SRR21853522.sra Written 83802 spots for SRR21853522.sra Read 83802 spots for SRR21853522.sra Written 83802 spots for SRR21853522.sra Read 83802 spots for SRR21853522.sra Written 83802 spots for SRR21853522.sra Read 83802 spots for SRR21853522.sra Written 83802 spots for SRR21853522.sra Read 83802 spots for SRR21853522.sra Written 83802 spots for SRR21853522.sra Read 83802 spots for SRR21853522.sra Written 83802 spots for SRR21853522.sra Read 83804 spots for SRR21853522.sra Written 83804 spots for SRR21853522.sra Read 83802 spots for SRR21853522.sra Written 83802 spots for SRR21853522.sra Read 83802 spots for SRR21853522.sra Written 83802 spots for SRR21853522.sra Read 83802 spots for SRR21853522.sra Written 83802 spots for SRR21853522.sra Read 83802 spots for SRR21853522.sra Written 83802 spots for SRR21853522.sra Read 83802 spots for SRR21853522.sra Written 83802 spots for SRR21853522.sra Read 83802 spots for SRR21853522.sra Written 83802 spots for SRR21853522.sra Read 83802 spots for SRR21853522.sra Written 83802 spots for SRR21853522.sra Read 83802 spots for SRR21853522.sra Written 83802 spots for SRR21853522.sra Read 83802 spots for SRR21853522.sra Written 83802 spots for SRR21853522.sra Read 83802 spots for SRR21853522.sra Written 83802 spots for SRR21853522.sra SRR ids: ['SRR21853522.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_7dzwiigx SRR21853522.sra spots: 1676042 blocks: [[1, 83802], [83803, 167604], [167605, 251406], [251407, 335208], [335209, 419010], [419011, 502812], [502813, 586614], [586615, 670416], [670417, 754218], [754219, 838020], [838021, 921822], [921823, 1005624], [1005625, 1089426], [1089427, 1173228], [1173229, 1257030], [1257031, 1340832], [1340833, 1424634], [1424635, 1508436], [1508437, 1592238], [1592239, 1676042]] SRR21853522 file size 455407 SRR21853522 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR21853522 SRR21853522_1.fastq Input file: SRR21853522_1.fastq trimmed: SRR21853522-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Fri Dec 6 16:58:12 2024 >> started Fri Dec 6 16:58:13 2024 >> done (1.294s) 1676042 reads processed; of these: 21 ( 0.00%) short reads filtered out after trimming by size control 63803 ( 3.81%) empty reads filtered out after trimming by size control 1612218 (96.19%) reads available; of these: 43 ( 0.00%) trimmed reads available after processing 1612175 (100.00%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 0 0.00% 20 1 0.00% 21 1 0.00% 22 2 0.00% 23 2 0.00% 24 0 0.00% 25 0 0.00% 26 0 0.00% 27 1 0.00% 28 2 0.00% 29 1 0.00% 30 1 0.00% 31 0 0.00% 32 1 0.00% 33 0 0.00% 34 0 0.00% 35 35 0.00% 36 45 0.00% 37 43 0.00% 38 38 0.00% 39 41 0.00% 40 30 0.00% 41 46 0.00% 42 48 0.00% 43 57 0.00% 44 39 0.00% 45 43 0.00% 46 37 0.00% 47 38 0.00% 48 51 0.00% 49 40 0.00% 50 44 0.00% 51 51 0.00% 52 60 0.00% 53 53 0.00% 54 62 0.00% 55 57 0.00% 56 58 0.00% 57 54 0.00% 58 65 0.00% 59 62 0.00% 60 70 0.00% 61 65 0.00% 62 62 0.00% 63 84 0.01% 64 81 0.01% 65 74 0.00% 66 79 0.00% 67 71 0.00% 68 91 0.01% 69 92 0.01% 70 86 0.01% 71 93 0.01% 72 78 0.00% 73 93 0.01% 74 89 0.01% 75 86 0.01% 76 82 0.01% 77 88 0.01% 78 100 0.01% 79 112 0.01% 80 118 0.01% 81 143 0.01% 82 126 0.01% 83 146 0.01% 84 137 0.01% 85 137 0.01% 86 141 0.01% 87 163 0.01% 88 151 0.01% 89 172 0.01% 90 140 0.01% 91 237 0.01% 92 170 0.01% 93 195 0.01% 94 282 0.02% 95 481 0.03% 96 2052 0.13% 97 7751 0.48% 98 28813 1.79% 99 101087 6.27% 100 368111 22.83% 101 1098579 68.14% 1612218 reads passed initial QC criterion=sequence-density sequence-density=0.12 sequence-density-rank=1 fanout-score=1.99 fanout-score-rank=26 prefix-density=0.12 prefix-fanout=2.0 sequence=CGCGCTTGGTTGAA criterion=fanout-score sequence-density=0.07 sequence-density-rank=9 fanout-score=125.55 fanout-score-rank=1 prefix-density=0.48 prefix-fanout=17.8 sequence=CCGCCGCCGCCG Started job on | Dec 06 16:58:41 Started mapping on | Dec 06 16:58:41 Finished on | Dec 06 16:58:50 Mapping speed, Million of reads per hour | 644.89 Number of input reads | 1612218 Average input read length | 100 UNIQUE READS: Uniquely mapped reads number | 1323114 Uniquely mapped reads % | 82.07% Average mapped length | 100.06 Number of splices: Total | 481405 Number of splices: Annotated (sjdb) | 453840 Number of splices: GT/AG | 474711 Number of splices: GC/AG | 5353 Number of splices: AT/AC | 275 Number of splices: Non-canonical | 1066 Mismatch rate per base, % | 0.33% Deletion rate per base | 0.01% Deletion average length | 1.97 Insertion rate per base | 0.01% Insertion average length | 1.98 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 58498 % of reads mapped to multiple loci | 3.63% Number of reads mapped to too many loci | 86174 % of reads mapped to too many loci | 5.35% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 8.48% % of reads unmapped: other | 0.48% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 230606 230606 230606 N_multimapping 58498 58498 58498 N_noFeature 89252 697487 698355 N_ambiguous 19196 1366 1454 UnstrandedReadsAssigned:1214666 PositiveStrandReadsAssigned:624261 NegativeStrandReadsAssigned:623305 Dataset is classified unstranded MeadianReadLen=101 20thPercentileLength=100 echo kmer=95 SRR21853522 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR21853522-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 1,612,218 reads, 1,343,878 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 918 rounds 52973 SRR21853522.ke.tsv 35125 SRR21853522.se.tsv 88098 total ==> SRR21853522.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 0 0 PNS24247 1044 945 3.07521 4.44759 PNS24249 1928 1829 0 0 PNS24246 1044 945 3.07521 4.44759 PNS24248 1044 945 3.07521 4.44759 PNS24244 1471 1372 7.77437 7.74449 PNS24243 293 194 3 21.135 KQK14069 1603 1504 348.057 316.289 KQK14071 474 375 40.751 148.521 ==> SRR21853522.se.tsv <== BRADI_1g14170v3 403 BRADI_1g53295v3 4 BRADI_1g59795v3 18 BRADI_1g07683v3 0 BRADI_1g00485v3 3 BRADI_1g20270v3 40 BRADI_1g74790v3 10 BRADI_1g09890v3 0 BRADI_1g77505v3 11 BRADI_1g48960v3 0 SRR21853522 completed mapping pipeline successfully