Starting /dee2/code/volunteer_pipeline.sh SRR21853523 current disk space = 1550626058240 free memory = 1598287152 SRR21853523 SRAfilesize f118fa74a2d7130a397f7316e5c1e45b SRR21853523.sra SRR21853523.sra file validated SRR21853523 is single end SRR21853523 is conventional basespace SRR21853523 read1 length is 71-101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR21853523_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 71-101 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.1915 37.0 37.0 37.0 25.0 37.0 2 34.877 37.0 37.0 37.0 25.0 37.0 3 35.741 37.0 37.0 37.0 37.0 37.0 4 35.7735 37.0 37.0 37.0 37.0 37.0 5 35.786 37.0 37.0 37.0 37.0 37.0 6 35.796 37.0 37.0 37.0 37.0 37.0 7 35.644 37.0 37.0 37.0 37.0 37.0 8 35.841 37.0 37.0 37.0 37.0 37.0 9 35.796 37.0 37.0 37.0 37.0 37.0 10-11 35.857749999999996 37.0 37.0 37.0 37.0 37.0 12-13 35.913 37.0 37.0 37.0 37.0 37.0 14-15 35.848749999999995 37.0 37.0 37.0 37.0 37.0 16-17 35.86125 37.0 37.0 37.0 37.0 37.0 18-19 35.88275 37.0 37.0 37.0 37.0 37.0 20-21 35.935249999999996 37.0 37.0 37.0 37.0 37.0 22-23 35.9595 37.0 37.0 37.0 37.0 37.0 24-25 35.749750000000006 37.0 37.0 37.0 37.0 37.0 26-27 35.7535 37.0 37.0 37.0 37.0 37.0 28-29 35.7115 37.0 37.0 37.0 37.0 37.0 30-31 35.6475 37.0 37.0 37.0 37.0 37.0 32-33 35.53475 37.0 37.0 37.0 37.0 37.0 34-35 35.6305 37.0 37.0 37.0 37.0 37.0 36-37 35.678250000000006 37.0 37.0 37.0 37.0 37.0 38-39 35.65375 37.0 37.0 37.0 37.0 37.0 40-41 35.695 37.0 37.0 37.0 37.0 37.0 42-43 35.503249999999994 37.0 37.0 37.0 37.0 37.0 44-45 35.34025 37.0 37.0 37.0 37.0 37.0 46-47 35.57 37.0 37.0 37.0 37.0 37.0 48-49 35.0195 37.0 37.0 37.0 25.0 37.0 50-51 35.265 37.0 37.0 37.0 31.0 37.0 52-53 35.214749999999995 37.0 37.0 37.0 25.0 37.0 54-55 35.2405 37.0 37.0 37.0 31.0 37.0 56-57 35.078500000000005 37.0 37.0 37.0 25.0 37.0 58-59 35.1865 37.0 37.0 37.0 31.0 37.0 60-61 35.206 37.0 37.0 37.0 31.0 37.0 62-63 34.96175 37.0 37.0 37.0 25.0 37.0 64-65 35.30225 37.0 37.0 37.0 31.0 37.0 66-67 34.933 37.0 37.0 37.0 25.0 37.0 68-69 34.87075 37.0 37.0 37.0 25.0 37.0 70-71 34.933 37.0 37.0 37.0 25.0 37.0 72-73 35.16579144786196 37.0 37.0 37.0 25.0 37.0 74-75 35.347836959239814 37.0 37.0 37.0 37.0 37.0 76-77 35.39069534767384 37.0 37.0 37.0 37.0 37.0 78-79 35.342921460730366 37.0 37.0 37.0 37.0 37.0 80-81 35.41405562641181 37.0 37.0 37.0 37.0 37.0 82-83 35.49349349349349 37.0 37.0 37.0 37.0 37.0 84-85 35.1966966966967 37.0 37.0 37.0 31.0 37.0 86-87 35.32057057057057 37.0 37.0 37.0 31.0 37.0 88-89 35.43504380475595 37.0 37.0 37.0 37.0 37.0 90-91 35.377221526908635 37.0 37.0 37.0 37.0 37.0 92-93 35.28693039559339 37.0 37.0 37.0 37.0 37.0 94-95 35.257414860081255 37.0 37.0 37.0 37.0 37.0 96-97 35.28182726185257 37.0 37.0 37.0 31.0 37.0 98-99 35.23005091697068 37.0 37.0 37.0 31.0 37.0 100-101 35.18694696448479 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100-101 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 2.0 21 1.0 22 5.0 23 3.0 24 1.0 25 4.0 26 16.0 27 23.0 28 46.0 29 61.0 30 83.0 31 141.0 32 157.0 33 184.0 34 241.0 35 469.0 36 2084.0 37 479.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 27.1 13.825000000000001 18.224999999999998 40.849999999999994 2 24.251648909183153 21.461187214611872 31.608320649416537 22.67884322678843 3 25.15 22.95 26.375 25.525 4 25.7 28.15 18.075 28.075 5 28.225 31.075000000000003 21.5 19.2 6 24.825 31.175000000000004 20.599999999999998 23.400000000000002 7 19.725 19.475 37.775 23.025000000000002 8 20.925 25.2 25.424999999999997 28.449999999999996 9 23.275000000000002 21.85 28.9 25.974999999999998 10-11 26.9625 28.599999999999998 19.8375 24.6 12-13 22.575 23.775 26.674999999999997 26.974999999999998 14-15 23.2875 25.9625 25.5125 25.2375 16-17 26.05 23.35 24.8 25.8 18-19 23.225 25.412499999999998 25.874999999999996 25.4875 20-21 25.374999999999996 25.362499999999997 25.25 24.0125 22-23 24.0 27.05 24.2 24.75 24-25 23.65 25.275 25.837500000000002 25.2375 26-27 23.724999999999998 25.362499999999997 24.7875 26.125 28-29 24.4875 25.4375 24.837500000000002 25.2375 30-31 22.975 24.675 26.087500000000002 26.2625 32-33 23.474999999999998 26.375 24.2875 25.8625 34-35 23.5125 25.1 26.0625 25.324999999999996 36-37 25.2625 24.1625 25.674999999999997 24.9 38-39 24.3 26.05 24.95 24.7 40-41 25.25 25.924999999999997 24.85 23.974999999999998 42-43 23.200000000000003 26.637499999999996 25.474999999999998 24.6875 44-45 24.462500000000002 24.637500000000003 25.3 25.6 46-47 25.3125 24.637500000000003 24.474999999999998 25.575 48-49 24.05 25.650000000000002 25.7125 24.587500000000002 50-51 25.7125 24.6875 24.625 24.975 52-53 24.525 25.35 23.674999999999997 26.450000000000003 54-55 25.2625 25.874999999999996 24.9 23.962500000000002 56-57 25.05 24.175 24.725 26.05 58-59 24.224999999999998 25.624999999999996 25.6 24.55 60-61 25.474999999999998 24.65 24.925 24.95 62-63 25.4875 24.625 25.074999999999996 24.8125 64-65 25.124999999999996 25.424999999999997 24.9 24.55 66-67 24.087500000000002 26.4125 24.5125 24.9875 68-69 24.3875 25.95 24.1625 25.5 70-71 26.087500000000002 24.637500000000003 25.2875 23.9875 72-73 26.03150787696924 24.60615153788447 24.406101525381345 24.956239059764943 74-75 25.79394848712178 24.893723430857715 24.893723430857715 24.418604651162788 76-77 25.42521260630315 25.437718859429715 24.387193596798397 24.749874937468736 78-79 25.975487743871934 24.224612306153077 25.137568784392194 24.662331165582792 80-81 26.632474355766828 24.34325744308231 23.992994746059544 25.03127345509132 82-83 26.626626626626624 25.525525525525527 23.323323323323322 24.524524524524523 84-85 26.126126126126124 24.83733733733734 24.21171171171171 24.824824824824827 86-87 25.650650650650654 24.624624624624623 25.16266266266266 24.56206206206206 88-89 26.220275344180227 25.269086357947433 24.11764705882353 24.39299123904881 90-91 26.408010012515643 24.017521902377972 24.93116395494368 24.6433041301627 92-93 26.20180270405608 25.61342013019529 24.461692538808215 23.72308462694041 94-95 25.47890321772881 25.71678978339802 24.978089395267308 23.82621760360586 96-97 27.004008016032067 24.912324649298597 24.148296593186373 23.935370741482966 98-99 25.704851409702815 24.993649987299975 24.58724917449835 24.714249428498857 100-101 27.897807916732376 11.212742469642013 30.02680965147453 30.86263996215108 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 6.0 1 5.5 2 3.0 3 1.0 4 0.5 5 0.5 6 0.5 7 0.5 8 1.5 9 1.5 10 0.5 11 0.0 12 0.5 13 0.5 14 0.5 15 0.5 16 0.5 17 0.5 18 0.0 19 0.5 20 0.5 21 0.0 22 0.5 23 1.5 24 1.5 25 2.5 26 3.5 27 3.0 28 4.5 29 5.5 30 8.0 31 10.0 32 14.0 33 20.0 34 27.0 35 38.5 36 47.5 37 63.5 38 81.5 39 90.5 40 103.0 41 123.0 42 153.5 43 178.5 44 178.5 45 191.0 46 192.5 47 172.5 48 168.5 49 171.0 50 170.0 51 150.0 52 137.0 53 134.5 54 111.5 55 95.0 56 94.0 57 89.0 58 88.5 59 73.5 60 55.5 61 66.0 62 64.0 63 53.5 64 55.5 65 56.0 66 56.5 67 50.5 68 53.5 69 61.5 70 55.0 71 39.0 72 27.0 73 22.0 74 17.0 75 14.5 76 11.5 77 7.5 78 7.5 79 7.0 80 3.5 81 1.5 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.5 88 0.5 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 1.4500000000000002 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 71 1.0 72 0.0 73 0.0 74 0.0 75 1.0 76 0.0 77 0.0 78 0.0 79 0.0 80 2.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 1.0 88 0.0 89 0.0 90 0.0 91 1.0 92 0.0 93 0.0 94 1.0 95 0.0 96 2.0 97 14.0 98 80.0 99 266.0 100 921.0 101 2710.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.2 #Duplication Level Percentage of deduplicated Percentage of total 1 91.76829268292683 82.775 2 7.372505543237251 13.3 3 0.5543237250554324 1.5 4 0.11086474501108648 0.4 5 0.0 0.0 6 0.0 0.0 7 0.02771618625277162 0.17500000000000002 8 0.02771618625277162 0.2 9 0.05543237250554324 0.44999999999999996 >10 0.08314855875831485 1.2 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACTCCGGAGAATCTCGGTT 19 0.475 TruSeq Adapter, Index 6 (97% over 36bp) GATCGGAAGAGCACACGTCTGAACTCCAGTCACTCCGGAGAATCTCGTTT 19 0.475 TruSeq Adapter, Index 6 (97% over 36bp) AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA 10 0.25 No Hit GATCGGAAGAGCACACGTCTGAACTCCAGTCACTCCGGAGAATCGCGTTT 9 0.22499999999999998 TruSeq Adapter, Index 6 (97% over 36bp) GATCGGAAGAGCACACGTCTGAACTCCAGTCACTCCGGAGAATCTCGGAT 9 0.22499999999999998 TruSeq Adapter, Index 6 (97% over 36bp) GATCGGAAGAGCACACGTCTGAACTCCAGTCACTCCGGAGAATCGCGGTT 8 0.2 TruSeq Adapter, Index 6 (97% over 36bp) GATCGGAAGAGCACACGTCTGAACTCCAGTCACTCCGGAGAATCTCGTAT 7 0.17500000000000002 TruSeq Adapter, Index 6 (97% over 36bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 995413 spots for SRR21853523.sra Written 995413 spots for SRR21853523.sra Read 995413 spots for SRR21853523.sra Written 995413 spots for SRR21853523.sra Read 995414 spots for SRR21853523.sra Written 995414 spots for SRR21853523.sra Read 995413 spots for SRR21853523.sra Written 995413 spots for SRR21853523.sra Read 995413 spots for SRR21853523.sra Written 995413 spots for SRR21853523.sra Read 995413 spots for SRR21853523.sra Written 995413 spots for SRR21853523.sra Read 995413 spots for SRR21853523.sra Written 995413 spots for SRR21853523.sra Read 995413 spots for SRR21853523.sra Written 995413 spots for SRR21853523.sra Read 995413 spots for SRR21853523.sra Written 995413 spots for SRR21853523.sra Read 995413 spots for SRR21853523.sra Written 995413 spots for SRR21853523.sra Read 995413 spots for SRR21853523.sra Written 995413 spots for SRR21853523.sra Read 995413 spots for SRR21853523.sra Written 995413 spots for SRR21853523.sra Read 995413 spots for SRR21853523.sra Written 995413 spots for SRR21853523.sra Read 995413 spots for SRR21853523.sra Written 995413 spots for SRR21853523.sra Read 995413 spots for SRR21853523.sra Written 995413 spots for SRR21853523.sra Read 995413 spots for SRR21853523.sra Written 995413 spots for SRR21853523.sra Read 995413 spots for SRR21853523.sra Written 995413 spots for SRR21853523.sra Read 995413 spots for SRR21853523.sra Written 995413 spots for SRR21853523.sra Read 995413 spots for SRR21853523.sra Written 995413 spots for SRR21853523.sra Read 995413 spots for SRR21853523.sra Written 995413 spots for SRR21853523.sra SRR ids: ['SRR21853523.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_jlckqq7q SRR21853523.sra spots: 19908261 blocks: [[1, 995413], [995414, 1990826], [1990827, 2986239], [2986240, 3981652], [3981653, 4977065], [4977066, 5972478], [5972479, 6967891], [6967892, 7963304], [7963305, 8958717], [8958718, 9954130], [9954131, 10949543], [10949544, 11944956], [11944957, 12940369], [12940370, 13935782], [13935783, 14931195], [14931196, 15926608], [15926609, 16922021], [16922022, 17917434], [17917435, 18912847], [18912848, 19908261]] SRR21853523 file size 5363079 SRR21853523 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR21853523 SRR21853523_1.fastq Input file: SRR21853523_1.fastq trimmed: SRR21853523-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Fri Dec 6 16:59:21 2024 >> started Fri Dec 6 16:59:31 2024 >> done (9.874s) 19908261 reads processed; of these: 49 ( 0.00%) short reads filtered out after trimming by size control 443243 ( 2.23%) empty reads filtered out after trimming by size control 19464969 (97.77%) reads available; of these: 476 ( 0.00%) trimmed reads available after processing 19464493 (100.00%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 1 0.00% 20 3 0.00% 21 3 0.00% 22 4 0.00% 23 5 0.00% 24 4 0.00% 25 3 0.00% 26 2 0.00% 27 5 0.00% 28 1 0.00% 29 5 0.00% 30 5 0.00% 31 5 0.00% 32 3 0.00% 33 12 0.00% 34 5 0.00% 35 80 0.00% 36 83 0.00% 37 86 0.00% 38 97 0.00% 39 102 0.00% 40 106 0.00% 41 107 0.00% 42 94 0.00% 43 113 0.00% 44 120 0.00% 45 111 0.00% 46 118 0.00% 47 149 0.00% 48 118 0.00% 49 170 0.00% 50 165 0.00% 51 170 0.00% 52 186 0.00% 53 169 0.00% 54 180 0.00% 55 209 0.00% 56 188 0.00% 57 192 0.00% 58 205 0.00% 59 248 0.00% 60 300 0.00% 61 282 0.00% 62 283 0.00% 63 289 0.00% 64 261 0.00% 65 326 0.00% 66 320 0.00% 67 322 0.00% 68 311 0.00% 69 374 0.00% 70 359 0.00% 71 409 0.00% 72 416 0.00% 73 436 0.00% 74 421 0.00% 75 462 0.00% 76 442 0.00% 77 544 0.00% 78 526 0.00% 79 604 0.00% 80 601 0.00% 81 682 0.00% 82 697 0.00% 83 757 0.00% 84 848 0.00% 85 863 0.00% 86 828 0.00% 87 919 0.00% 88 1011 0.01% 89 1063 0.01% 90 1258 0.01% 91 2202 0.01% 92 1528 0.01% 93 1735 0.01% 94 2270 0.01% 95 5308 0.03% 96 26558 0.14% 97 95765 0.49% 98 360702 1.85% 99 1309565 6.73% 100 4597911 23.62% 101 13040578 67.00% 19464969 reads passed initial QC criterion=sequence-density sequence-density=0.23 sequence-density-rank=1 fanout-score=1.93 fanout-score-rank=26 prefix-density=0.22 prefix-fanout=1.9 sequence=CCGTCAATTCCTTT criterion=fanout-score sequence-density=0.07 sequence-density-rank=12 fanout-score=20.10 fanout-score-rank=1 prefix-density=0.34 prefix-fanout=4.3 sequence=TCCAGCTCCTTGAGCACCTGTGTGGCGTCGGTGCACCCGAACATGGGCAGCTTCCACATTGTCCAGTACCTGCCATCATAGTACCCAGGGGAGCTGTTGTGCTCGCGGAAGACGAAGCCGACCTTGCTGAACTCCAGGCAAGGAACCCACTTGGAG Started job on | Dec 06 16:59:50 Started mapping on | Dec 06 16:59:50 Finished on | Dec 06 17:00:36 Mapping speed, Million of reads per hour | 1523.35 Number of input reads | 19464969 Average input read length | 100 UNIQUE READS: Uniquely mapped reads number | 16507978 Uniquely mapped reads % | 84.81% Average mapped length | 100.18 Number of splices: Total | 6217739 Number of splices: Annotated (sjdb) | 5888037 Number of splices: GT/AG | 6133128 Number of splices: GC/AG | 69804 Number of splices: AT/AC | 3520 Number of splices: Non-canonical | 11287 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.01% Deletion average length | 2.10 Insertion rate per base | 0.01% Insertion average length | 1.94 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1010582 % of reads mapped to multiple loci | 5.19% Number of reads mapped to too many loci | 1338192 % of reads mapped to too many loci | 6.87% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.15% % of reads unmapped: other | 0.98% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1946409 1946409 1946409 N_multimapping 1010582 1010582 1010582 N_noFeature 1015021 8696253 8617962 N_ambiguous 239030 15018 16673 UnstrandedReadsAssigned:15253927 PositiveStrandReadsAssigned:7796707 NegativeStrandReadsAssigned:7873343 Dataset is classified unstranded MeadianReadLen=101 20thPercentileLength=100 echo kmer=95 SRR21853523 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR21853523-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 19,464,969 reads, 16,032,217 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,168 rounds 52973 SRR21853523.ke.tsv 35125 SRR21853523.se.tsv 88098 total ==> SRR21853523.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 27.8107 3.65404 PNS24247 1044 945 37.9167 4.41252 PNS24249 1928 1829 78.7525 4.7352 PNS24246 1044 945 37.9167 4.41252 PNS24248 1044 945 37.9167 4.41252 PNS24244 1471 1372 18.6869 1.49786 PNS24243 293 194 29 16.4393 KQK14069 1603 1504 3434.98 251.168 KQK14071 474 375 591.44 173.447 ==> SRR21853523.se.tsv <== BRADI_1g14170v3 4221 BRADI_1g53295v3 49 BRADI_1g59795v3 376 BRADI_1g07683v3 0 BRADI_1g00485v3 51 BRADI_1g20270v3 651 BRADI_1g74790v3 103 BRADI_1g09890v3 0 BRADI_1g77505v3 166 BRADI_1g48960v3 0 SRR21853523 completed mapping pipeline successfully