Starting /dee2/code/volunteer_pipeline.sh SRR21853524 current disk space = 1550686646272 free memory = 1327595020 SRR21853524 SRAfilesize ed9104c526e9e7b910616cb285e91734 SRR21853524.sra SRR21853524.sra file validated SRR21853524 is single end SRR21853524 is conventional basespace SRR21853524 read1 length is 96-101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR21853524_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 96-101 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.523 37.0 37.0 37.0 37.0 37.0 2 35.8125 37.0 37.0 37.0 37.0 37.0 3 35.931 37.0 37.0 37.0 37.0 37.0 4 35.9965 37.0 37.0 37.0 37.0 37.0 5 36.083 37.0 37.0 37.0 37.0 37.0 6 35.9665 37.0 37.0 37.0 37.0 37.0 7 36.043 37.0 37.0 37.0 37.0 37.0 8 36.0215 37.0 37.0 37.0 37.0 37.0 9 36.0 37.0 37.0 37.0 37.0 37.0 10-11 36.0355 37.0 37.0 37.0 37.0 37.0 12-13 36.09325 37.0 37.0 37.0 37.0 37.0 14-15 36.00325 37.0 37.0 37.0 37.0 37.0 16-17 35.9855 37.0 37.0 37.0 37.0 37.0 18-19 35.97575 37.0 37.0 37.0 37.0 37.0 20-21 35.89775 37.0 37.0 37.0 37.0 37.0 22-23 35.885999999999996 37.0 37.0 37.0 37.0 37.0 24-25 35.931 37.0 37.0 37.0 37.0 37.0 26-27 35.908 37.0 37.0 37.0 37.0 37.0 28-29 35.899249999999995 37.0 37.0 37.0 37.0 37.0 30-31 35.596000000000004 37.0 37.0 37.0 37.0 37.0 32-33 35.717 37.0 37.0 37.0 37.0 37.0 34-35 35.821 37.0 37.0 37.0 37.0 37.0 36-37 35.79175 37.0 37.0 37.0 37.0 37.0 38-39 35.860749999999996 37.0 37.0 37.0 37.0 37.0 40-41 35.76025 37.0 37.0 37.0 37.0 37.0 42-43 35.859750000000005 37.0 37.0 37.0 37.0 37.0 44-45 35.73524999999999 37.0 37.0 37.0 37.0 37.0 46-47 35.894 37.0 37.0 37.0 37.0 37.0 48-49 35.5375 37.0 37.0 37.0 37.0 37.0 50-51 35.668499999999995 37.0 37.0 37.0 37.0 37.0 52-53 35.630250000000004 37.0 37.0 37.0 37.0 37.0 54-55 35.63249999999999 37.0 37.0 37.0 37.0 37.0 56-57 35.6485 37.0 37.0 37.0 37.0 37.0 58-59 35.560249999999996 37.0 37.0 37.0 37.0 37.0 60-61 35.6855 37.0 37.0 37.0 37.0 37.0 62-63 35.68625 37.0 37.0 37.0 37.0 37.0 64-65 35.7195 37.0 37.0 37.0 37.0 37.0 66-67 35.6385 37.0 37.0 37.0 37.0 37.0 68-69 35.58025 37.0 37.0 37.0 37.0 37.0 70-71 35.63825 37.0 37.0 37.0 37.0 37.0 72-73 35.63725 37.0 37.0 37.0 37.0 37.0 74-75 35.53675 37.0 37.0 37.0 37.0 37.0 76-77 35.586 37.0 37.0 37.0 37.0 37.0 78-79 35.65675 37.0 37.0 37.0 37.0 37.0 80-81 35.503249999999994 37.0 37.0 37.0 37.0 37.0 82-83 35.52475 37.0 37.0 37.0 37.0 37.0 84-85 35.5705 37.0 37.0 37.0 37.0 37.0 86-87 35.45275 37.0 37.0 37.0 37.0 37.0 88-89 35.54325 37.0 37.0 37.0 37.0 37.0 90-91 35.50275 37.0 37.0 37.0 37.0 37.0 92-93 35.46425 37.0 37.0 37.0 37.0 37.0 94-95 35.54325 37.0 37.0 37.0 37.0 37.0 96-97 35.484412409216134 37.0 37.0 37.0 37.0 37.0 98-99 35.45825941381743 37.0 37.0 37.0 37.0 37.0 100-101 35.416966242809494 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 2101 1 0.0 2101 2 0.0 2101 3 0.0 2101 4 0.0 2101 5 0.0 2101 6 0.0 2101 7 0.0 2101 8 0.0 2101 9 0.0 2101 10-11 0.0 2101 12-13 0.0 2101 14-15 0.0 2101 16-17 0.0 2101 18-19 0.0 2101 20-21 0.0 2101 22-23 0.0 2101 24-25 0.0 2101 26-27 0.0 2101 28-29 0.0 2101 30-31 0.0 2101 32-33 0.0 2101 34-35 0.0 2101 36-37 0.0 2101 38-39 0.0 2101 40-41 0.0 2101 42-43 0.0 2101 44-45 0.0 2101 46-47 0.0 2101 48-49 0.0 2101 50-51 0.0 2101 52-53 0.0 2101 54-55 0.0 2101 56-57 0.0 2101 58-59 0.0 2101 60-61 0.0 2101 62-63 0.0 2101 64-65 0.0 2101 66-67 0.0 2101 68-69 0.0 2101 70-71 0.0 2101 72-73 0.0 2101 74-75 0.0 2101 76-77 0.0 2101 78-79 0.0 2101 80-81 0.0 2101 82-83 0.0 2101 84-85 0.0 2101 86-87 0.0 2101 88-89 0.0 2101 90-91 0.0 2101 92-93 0.0 2101 94-95 0.0 2101 96-97 0.0 2101 98-99 0.0 2101 100-101 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 17 1.0 18 0.0 19 1.0 20 1.0 21 1.0 22 1.0 23 2.0 24 1.0 25 5.0 26 11.0 27 26.0 28 36.0 29 49.0 30 58.0 31 90.0 32 111.0 33 131.0 34 220.0 35 484.0 36 2189.0 37 582.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 27.800000000000004 12.75 17.875 41.575 2 25.6 20.125 31.55 22.725 3 26.150000000000002 23.3 24.425 26.125 4 26.375 29.9 18.224999999999998 25.5 5 28.449999999999996 30.099999999999998 19.925 21.525 6 21.45 33.425 20.9 24.224999999999998 7 19.55 15.75 39.6 25.1 8 23.125 19.975 25.95 30.95 9 21.825 21.05 28.799999999999997 28.325 10-11 26.1 27.9375 19.975 25.9875 12-13 23.8125 21.6625 27.1125 27.4125 14-15 24.5625 25.074999999999996 25.2125 25.15 16-17 25.337500000000002 24.85 23.9375 25.874999999999996 18-19 24.575 25.674999999999997 24.5 25.25 20-21 25.45 24.075 24.55 25.924999999999997 22-23 25.162499999999998 25.275 23.849999999999998 25.7125 24-25 23.825 25.7625 24.4 26.0125 26-27 25.4625 24.462500000000002 24.175 25.900000000000002 28-29 25.85 25.137500000000003 23.375 25.637500000000003 30-31 24.25 25.75 23.5125 26.487500000000004 32-33 25.0375 25.8625 23.3375 25.7625 34-35 25.4625 24.625 24.025 25.887500000000003 36-37 24.087500000000002 26.0125 23.5875 26.3125 38-39 25.0 24.825 23.9125 26.2625 40-41 25.7625 24.712500000000002 24.224999999999998 25.3 42-43 24.0 24.95 24.9375 26.1125 44-45 25.5125 25.087500000000002 24.45 24.95 46-47 24.15 25.624999999999996 24.3625 25.8625 48-49 24.125 24.775 23.3 27.800000000000004 50-51 23.5625 25.825 24.775 25.837500000000002 52-53 24.962500000000002 24.75 23.3 26.987499999999997 54-55 25.0 25.087500000000002 24.2375 25.674999999999997 56-57 25.7125 24.575 23.75 25.9625 58-59 24.762500000000003 24.2375 24.45 26.55 60-61 25.137500000000003 25.25 24.0375 25.575 62-63 24.2625 25.587500000000002 24.3 25.85 64-65 25.5625 23.7 24.1375 26.6 66-67 24.275 25.3 23.925 26.5 68-69 24.5125 24.85 23.8375 26.8 70-71 24.875 25.35 23.974999999999998 25.8 72-73 24.625 24.462500000000002 24.2875 26.625 74-75 26.1 24.962500000000002 22.6125 26.325 76-77 25.55 25.3 23.849999999999998 25.3 78-79 24.875 24.8625 23.7375 26.525 80-81 24.9875 24.5625 25.224999999999998 25.224999999999998 82-83 24.6625 25.374999999999996 24.337500000000002 25.624999999999996 84-85 25.7625 23.2125 24.85 26.174999999999997 86-87 24.9375 25.0125 24.15 25.900000000000002 88-89 25.4 24.2 23.65 26.75 90-91 24.5625 25.0 24.15 26.2875 92-93 26.437500000000004 24.85 24.0375 24.675 94-95 26.075 24.1375 23.3625 26.424999999999997 96-97 24.571500062554737 24.959339421994244 24.433879644689103 26.035280870761916 98-99 25.257273535764195 22.843349002668024 25.5748951848558 26.32448227671198 100-101 26.712759270898808 11.69076052796983 29.494028912633564 32.102451288497804 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1.0 1 2.0 2 1.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.5 17 0.5 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 0.5 24 0.0 25 1.0 26 1.5 27 3.5 28 5.0 29 4.0 30 7.0 31 12.0 32 14.0 33 17.0 34 23.0 35 33.0 36 44.5 37 56.5 38 74.5 39 90.0 40 109.5 41 131.5 42 150.0 43 176.5 44 181.0 45 171.5 46 172.0 47 184.5 48 185.0 49 162.0 50 138.5 51 128.5 52 116.0 53 111.5 54 118.5 55 98.0 56 92.5 57 91.0 58 78.0 59 75.0 60 74.5 61 71.0 62 73.5 63 73.5 64 56.5 65 47.0 66 50.5 67 61.5 68 65.5 69 52.5 70 52.0 71 53.5 72 38.5 73 34.0 74 33.0 75 26.5 76 23.5 77 19.5 78 14.0 79 9.0 80 4.5 81 2.0 82 1.0 83 1.0 84 0.5 85 0.0 86 0.0 87 0.0 88 0.5 89 0.5 90 0.0 91 0.0 92 0.5 93 0.5 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 96 7.0 97 16.0 98 83.0 99 235.0 100 954.0 101 2705.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.55 #Duplication Level Percentage of deduplicated Percentage of total 1 91.31622064445658 83.6 2 8.137629710540688 14.899999999999999 3 0.5461496450027308 1.5 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0125 0.0 20-21 0.0 0.0 0.0 0.025 0.0 22-23 0.0 0.0 0.0 0.025 0.0 24-25 0.0 0.0 0.0 0.025 0.0 26-27 0.0 0.0 0.0 0.025 0.0 28-29 0.0 0.0 0.0 0.025 0.0 30-31 0.0 0.0 0.0 0.025 0.0 32-33 0.0 0.0 0.0 0.025 0.0 34-35 0.0 0.0 0.0 0.025 0.0 36-37 0.0 0.0 0.0 0.025 0.0 38-39 0.0 0.0 0.0 0.025 0.0 40-41 0.0 0.0 0.0 0.025 0.0 42-43 0.0 0.0 0.0 0.025 0.0 44-45 0.0 0.0 0.0 0.025 0.0 46-47 0.0 0.0 0.0 0.025 0.0 48-49 0.0 0.0 0.0 0.025 0.0 50-51 0.0 0.0 0.0 0.025 0.0 52-53 0.0 0.0 0.0 0.025 0.0 54-55 0.0 0.0 0.0 0.025 0.0 56-57 0.0 0.0 0.0 0.025 0.0 58-59 0.0 0.0 0.0 0.025 0.0 60-61 0.0 0.0 0.0 0.025 0.0 62-63 0.0 0.0 0.0 0.025 0.0 64-65 0.0 0.0 0.0 0.025 0.0 66-67 0.0 0.0 0.0 0.025 0.0 68-69 0.0 0.0 0.0 0.025 0.0 70-71 0.0 0.0 0.0 0.025 0.0 72-73 0.0 0.0 0.0 0.025 0.0 74-75 0.0 0.0 0.0 0.025 0.0 76-77 0.0 0.0 0.0 0.025 0.0 78-79 0.0 0.0 0.0 0.025 0.0 80-81 0.0 0.0 0.0 0.025 0.0 82-83 0.0 0.0 0.0 0.025 0.0 84-85 0.0 0.0 0.0 0.025 0.0 86-87 0.0 0.0 0.0 0.025 0.0 88-89 0.0 0.0 0.0 0.025 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 299350 spots for SRR21853524.sra Written 299350 spots for SRR21853524.sra Read 299350 spots for SRR21853524.sra Written 299350 spots for SRR21853524.sra Read 299350 spots for SRR21853524.sra Written 299350 spots for SRR21853524.sra Read 299350 spots for SRR21853524.sra Written 299350 spots for SRR21853524.sra Read 299350 spots for SRR21853524.sra Written 299350 spots for SRR21853524.sra Read 299350 spots for SRR21853524.sra Written 299350 spots for SRR21853524.sra Read 299350 spots for SRR21853524.sra Written 299350 spots for SRR21853524.sra Read 299350 spots for SRR21853524.sra Written 299350 spots for SRR21853524.sra Read 299350 spots for SRR21853524.sra Written 299350 spots for SRR21853524.sra Read 299350 spots for SRR21853524.sra Written 299350 spots for SRR21853524.sra Read 299350 spots for SRR21853524.sra Written 299350 spots for SRR21853524.sra Read 299350 spots for SRR21853524.sra Written 299350 spots for SRR21853524.sra Read 299351 spots for SRR21853524.sra Written 299351 spots for SRR21853524.sra Read 299350 spots for SRR21853524.sra Written 299350 spots for SRR21853524.sra Read 299350 spots for SRR21853524.sra Written 299350 spots for SRR21853524.sra Read 299350 spots for SRR21853524.sra Written 299350 spots for SRR21853524.sra Read 299350 spots for SRR21853524.sra Written 299350 spots for SRR21853524.sra Read 299350 spots for SRR21853524.sra Written 299350 spots for SRR21853524.sra Read 299350 spots for SRR21853524.sra Written 299350 spots for SRR21853524.sra Read 299350 spots for SRR21853524.sra Written 299350 spots for SRR21853524.sra SRR ids: ['SRR21853524.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ay58xrmd SRR21853524.sra spots: 5987001 blocks: [[1, 299350], [299351, 598700], [598701, 898050], [898051, 1197400], [1197401, 1496750], [1496751, 1796100], [1796101, 2095450], [2095451, 2394800], [2394801, 2694150], [2694151, 2993500], [2993501, 3292850], [3292851, 3592200], [3592201, 3891550], [3891551, 4190900], [4190901, 4490250], [4490251, 4789600], [4789601, 5088950], [5088951, 5388300], [5388301, 5687650], [5687651, 5987001]] SRR21853524 file size 1609468 SRR21853524 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR21853524 SRR21853524_1.fastq Input file: SRR21853524_1.fastq trimmed: SRR21853524-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Fri Dec 6 17:04:04 2024 >> started Fri Dec 6 17:04:07 2024 >> done (3.694s) 5987001 reads processed; of these: 3 ( 0.00%) short reads filtered out after trimming by size control 24197 ( 0.40%) empty reads filtered out after trimming by size control 5962801 (99.60%) reads available; of these: 206 ( 0.00%) trimmed reads available after processing 5962595 (100.00%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 23 1 0.00% 24 0 0.00% 25 1 0.00% 26 0 0.00% 27 2 0.00% 28 1 0.00% 29 1 0.00% 30 0 0.00% 31 3 0.00% 32 5 0.00% 33 8 0.00% 34 1 0.00% 35 10 0.00% 36 15 0.00% 37 9 0.00% 38 12 0.00% 39 9 0.00% 40 13 0.00% 41 9 0.00% 42 13 0.00% 43 21 0.00% 44 9 0.00% 45 11 0.00% 46 16 0.00% 47 15 0.00% 48 12 0.00% 49 15 0.00% 50 18 0.00% 51 17 0.00% 52 15 0.00% 53 15 0.00% 54 17 0.00% 55 19 0.00% 56 15 0.00% 57 17 0.00% 58 18 0.00% 59 19 0.00% 60 20 0.00% 61 27 0.00% 62 30 0.00% 63 22 0.00% 64 22 0.00% 65 26 0.00% 66 26 0.00% 67 21 0.00% 68 29 0.00% 69 20 0.00% 70 30 0.00% 71 28 0.00% 72 23 0.00% 73 28 0.00% 74 35 0.00% 75 23 0.00% 76 49 0.00% 77 32 0.00% 78 26 0.00% 79 48 0.00% 80 38 0.00% 81 53 0.00% 82 39 0.00% 83 40 0.00% 84 32 0.00% 85 56 0.00% 86 62 0.00% 87 66 0.00% 88 70 0.00% 89 67 0.00% 90 97 0.00% 91 267 0.00% 92 93 0.00% 93 138 0.00% 94 369 0.01% 95 1409 0.02% 96 8057 0.14% 97 27800 0.47% 98 108416 1.82% 99 400428 6.72% 100 1355917 22.74% 101 4058340 68.06% 5962801 reads passed initial QC criterion=sequence-density sequence-density=0.23 sequence-density-rank=1 fanout-score=2.71 fanout-score-rank=20 prefix-density=0.32 prefix-fanout=2.0 sequence=CCTTTCCAGGGCCTCAAGTCCACCGCCGGCCTCCCC criterion=fanout-score sequence-density=0.07 sequence-density-rank=21 fanout-score=206.82 fanout-score-rank=1 prefix-density=0.72 prefix-fanout=21.2 sequence=CCGCCGCCGCCA Started job on | Dec 06 17:04:30 Started mapping on | Dec 06 17:04:30 Finished on | Dec 06 17:04:39 Mapping speed, Million of reads per hour | 2385.12 Number of input reads | 5962801 Average input read length | 100 UNIQUE READS: Uniquely mapped reads number | 5631617 Uniquely mapped reads % | 94.45% Average mapped length | 100.25 Number of splices: Total | 1979739 Number of splices: Annotated (sjdb) | 1878418 Number of splices: GT/AG | 1952573 Number of splices: GC/AG | 23280 Number of splices: AT/AC | 1111 Number of splices: Non-canonical | 2775 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.01% Deletion average length | 2.26 Insertion rate per base | 0.01% Insertion average length | 2.00 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 150402 % of reads mapped to multiple loci | 2.52% Number of reads mapped to too many loci | 92497 % of reads mapped to too many loci | 1.55% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.25% % of reads unmapped: other | 0.23% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 180782 180782 180782 N_multimapping 150402 150402 150402 N_noFeature 225270 2895498 2885200 N_ambiguous 87159 5760 5830 UnstrandedReadsAssigned:5319188 PositiveStrandReadsAssigned:2730359 NegativeStrandReadsAssigned:2740587 Dataset is classified unstranded MeadianReadLen=101 20thPercentileLength=100 echo kmer=95 SRR21853524 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR21853524-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 5,962,801 reads, 5,475,258 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,016 rounds 52973 SRR21853524.ke.tsv 35125 SRR21853524.se.tsv 88098 total ==> SRR21853524.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 36.3746 13.8399 PNS24247 1044 945 10.0087 3.37292 PNS24249 1928 1829 40.7307 7.09201 PNS24246 1044 945 10.0087 3.37292 PNS24248 1044 945 10.0087 3.37292 PNS24244 1471 1372 26.8686 6.23666 PNS24243 293 194 1 1.64157 KQK14069 1603 1504 949.99 201.155 KQK14071 474 375 141.989 120.582 ==> SRR21853524.se.tsv <== BRADI_1g14170v3 1217 BRADI_1g53295v3 31 BRADI_1g59795v3 67 BRADI_1g07683v3 0 BRADI_1g00485v3 20 BRADI_1g20270v3 616 BRADI_1g74790v3 37 BRADI_1g09890v3 3 BRADI_1g77505v3 75 BRADI_1g48960v3 0 SRR21853524 completed mapping pipeline successfully