Starting /dee2/code/volunteer_pipeline.sh SRR21853525 current disk space = 1550702837760 free memory = 1327559324 SRR21853525 SRAfilesize 1154c8a3df2f0120000e6ac2e47085bf SRR21853525.sra SRR21853525.sra file validated SRR21853525 is single end SRR21853525 is conventional basespace SRR21853525 read1 length is 53-101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR21853525_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 53-101 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.184 37.0 37.0 37.0 25.0 37.0 2 34.95 37.0 37.0 37.0 25.0 37.0 3 35.731 37.0 37.0 37.0 37.0 37.0 4 35.6855 37.0 37.0 37.0 37.0 37.0 5 35.906 37.0 37.0 37.0 37.0 37.0 6 35.878 37.0 37.0 37.0 37.0 37.0 7 35.522 37.0 37.0 37.0 37.0 37.0 8 35.845 37.0 37.0 37.0 37.0 37.0 9 35.868 37.0 37.0 37.0 37.0 37.0 10-11 35.814750000000004 37.0 37.0 37.0 37.0 37.0 12-13 35.83425 37.0 37.0 37.0 37.0 37.0 14-15 35.9405 37.0 37.0 37.0 37.0 37.0 16-17 35.89225 37.0 37.0 37.0 37.0 37.0 18-19 35.84825 37.0 37.0 37.0 37.0 37.0 20-21 35.8785 37.0 37.0 37.0 37.0 37.0 22-23 35.79925 37.0 37.0 37.0 37.0 37.0 24-25 35.78725 37.0 37.0 37.0 37.0 37.0 26-27 35.77525 37.0 37.0 37.0 37.0 37.0 28-29 35.6795 37.0 37.0 37.0 37.0 37.0 30-31 35.5065 37.0 37.0 37.0 37.0 37.0 32-33 35.548249999999996 37.0 37.0 37.0 37.0 37.0 34-35 35.575 37.0 37.0 37.0 37.0 37.0 36-37 35.53125 37.0 37.0 37.0 37.0 37.0 38-39 35.679249999999996 37.0 37.0 37.0 37.0 37.0 40-41 35.6305 37.0 37.0 37.0 37.0 37.0 42-43 35.5475 37.0 37.0 37.0 37.0 37.0 44-45 35.41975 37.0 37.0 37.0 37.0 37.0 46-47 35.569 37.0 37.0 37.0 37.0 37.0 48-49 35.30375 37.0 37.0 37.0 37.0 37.0 50-51 35.436 37.0 37.0 37.0 37.0 37.0 52-53 35.3435 37.0 37.0 37.0 37.0 37.0 54-55 35.34808702175544 37.0 37.0 37.0 37.0 37.0 56-57 35.24831207801951 37.0 37.0 37.0 37.0 37.0 58-59 35.39509877469367 37.0 37.0 37.0 37.0 37.0 60-61 35.34158539634909 37.0 37.0 37.0 37.0 37.0 62-63 35.26656664166042 37.0 37.0 37.0 37.0 37.0 64-65 35.192798199549884 37.0 37.0 37.0 31.0 37.0 66-67 35.173543385846465 37.0 37.0 37.0 25.0 37.0 68-69 35.20205051262816 37.0 37.0 37.0 37.0 37.0 70-71 35.08027006751688 37.0 37.0 37.0 31.0 37.0 72-73 35.238119059529765 37.0 37.0 37.0 37.0 37.0 74-75 35.30265132566283 37.0 37.0 37.0 37.0 37.0 76-77 35.19984992496248 37.0 37.0 37.0 25.0 37.0 78-79 35.29914957478739 37.0 37.0 37.0 37.0 37.0 80-81 35.30815407703852 37.0 37.0 37.0 37.0 37.0 82-83 35.28789394697348 37.0 37.0 37.0 31.0 37.0 84-85 35.37093546773387 37.0 37.0 37.0 37.0 37.0 86-87 35.27538769384692 37.0 37.0 37.0 37.0 37.0 88-89 35.33046170320587 37.0 37.0 37.0 37.0 37.0 90-91 35.25994495871904 37.0 37.0 37.0 37.0 37.0 92-93 35.23617713284963 37.0 37.0 37.0 31.0 37.0 94-95 35.24618463847886 37.0 37.0 37.0 31.0 37.0 96-97 35.181709572081346 37.0 37.0 37.0 31.0 37.0 98-99 35.215679728307904 37.0 37.0 37.0 31.0 37.0 100-101 35.262044787077826 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100-101 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 4.0 22 4.0 23 3.0 24 9.0 25 10.0 26 16.0 27 31.0 28 43.0 29 52.0 30 76.0 31 98.0 32 147.0 33 167.0 34 281.0 35 493.0 36 2139.0 37 427.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 27.325 13.575000000000001 17.075000000000003 42.025 2 23.89873417721519 21.746835443037973 31.265822784810126 23.088607594936708 3 25.15 24.275 23.474999999999998 27.1 4 26.0 31.175000000000004 17.474999999999998 25.35 5 28.025 30.15 20.1 21.725 6 22.650000000000002 33.775 20.375 23.200000000000003 7 19.900000000000002 16.950000000000003 38.15 25.0 8 21.8 22.05 24.7 31.45 9 22.925 19.875 28.749999999999996 28.449999999999996 10-11 25.587500000000002 28.449999999999996 19.45 26.5125 12-13 23.3125 21.8625 26.625 28.199999999999996 14-15 23.45 24.4125 25.8125 26.325 16-17 24.65 24.1625 23.2375 27.950000000000003 18-19 23.474999999999998 24.15 25.137500000000003 27.237499999999997 20-21 25.362499999999997 24.837500000000002 23.925 25.874999999999996 22-23 25.2625 25.124999999999996 24.325 25.2875 24-25 25.0 24.1625 24.349999999999998 26.487500000000004 26-27 25.0125 25.4625 23.925 25.6 28-29 24.8125 24.637500000000003 23.8375 26.7125 30-31 23.9375 25.4375 24.675 25.95 32-33 23.8625 25.4375 24.4875 26.2125 34-35 25.424999999999997 24.375 23.724999999999998 26.474999999999998 36-37 23.775 25.4 25.0375 25.7875 38-39 24.7875 25.074999999999996 24.5 25.637500000000003 40-41 25.4625 24.5375 24.425 25.575 42-43 24.712500000000002 24.3625 24.3875 26.5375 44-45 25.05 24.5125 24.4125 26.025 46-47 25.5625 24.3125 24.525 25.6 48-49 25.074999999999996 23.375 25.0125 26.5375 50-51 25.575 24.5625 24.1875 25.674999999999997 52-53 25.025 24.3125 23.474999999999998 27.187499999999996 54-55 24.968742185546386 25.131282820705174 23.393348337084273 26.506626656664167 56-57 25.23130782695674 24.918729682420604 24.243560890222557 25.6064016004001 58-59 25.068767191797946 24.306076519129782 24.406101525381345 26.219054763690924 60-61 25.10627656914228 24.268567141785446 24.731182795698924 25.893973493373345 62-63 25.64391097774444 23.80595148787197 24.143535883970994 26.406601650412604 64-65 25.70642660665166 24.306076519129782 23.655913978494624 26.331582895723933 66-67 24.81870467616904 25.156289072268066 23.455863965991497 26.569142285571395 68-69 25.268817204301076 25.693923480870218 23.95598899724931 25.081270317579396 70-71 26.581645411352838 23.705926481620406 23.63090772693173 26.081520380095025 72-73 25.52526263131566 23.986993496748372 23.74937468734367 26.738369184592298 74-75 25.950475237618807 23.999499749874936 24.487243621810904 25.56278139069535 76-77 26.425712856428213 24.349674837418707 23.536768384192097 25.68784392196098 78-79 26.350675337668832 23.486743371685844 25.175087543771884 24.987493746873437 80-81 25.812906453226613 25.162581290645324 24.037018509254626 24.987493746873437 82-83 26.17558779389695 23.899449724862432 23.761880940470235 26.163081540770385 84-85 25.63781890945473 24.362181090545274 23.974487243621812 26.025512756378188 86-87 26.125562781390695 23.43671835917959 25.087543771885944 25.350175087543768 88-89 26.278924327704818 23.66479049405879 24.2151344590369 25.8411507191995 90-91 24.943707780835627 24.355766825118838 24.418313735301474 26.28221165874406 92-93 26.444833625218916 23.555166374781088 24.59344508381286 25.40655491618714 94-95 26.79509632224168 24.030522892169127 23.179884913685264 25.99449587190393 96-97 25.72608913370055 25.28793189784677 24.173760640961444 24.812218327491237 98-99 26.279602750190982 22.790934555640437 24.255156608097785 26.674306086070793 100-101 25.964579380139153 10.610373181530678 29.886148007590137 33.53889943074004 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1.0 1 1.5 2 1.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.5 8 0.5 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 1.0 18 1.0 19 0.0 20 0.0 21 1.0 22 1.5 23 0.5 24 0.5 25 0.5 26 1.0 27 3.0 28 2.5 29 4.5 30 7.5 31 9.0 32 13.0 33 18.5 34 24.5 35 28.0 36 43.0 37 61.0 38 70.0 39 86.0 40 108.5 41 128.5 42 162.0 43 164.0 44 150.5 45 174.0 46 191.5 47 193.5 48 170.5 49 146.5 50 143.0 51 133.5 52 120.0 53 111.5 54 116.0 55 98.5 56 76.5 57 82.0 58 81.5 59 79.5 60 78.5 61 71.5 62 65.5 63 68.0 64 60.5 65 60.0 66 69.5 67 56.5 68 59.0 69 70.0 70 57.0 71 53.5 72 53.5 73 42.0 74 29.5 75 24.0 76 18.5 77 14.5 78 14.0 79 10.0 80 6.0 81 3.5 82 3.5 83 2.0 84 1.0 85 0.5 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 1.25 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 53 1.0 54 0.0 55 0.0 56 0.0 57 0.0 58 0.0 59 0.0 60 0.0 61 0.0 62 0.0 63 0.0 64 0.0 65 0.0 66 0.0 67 0.0 68 0.0 69 0.0 70 0.0 71 1.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 1.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 6.0 97 25.0 98 78.0 99 288.0 100 876.0 101 2724.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.325 #Duplication Level Percentage of deduplicated Percentage of total 1 92.66179258055782 85.55 2 6.6341727592743025 12.25 3 0.6227998916869754 1.725 4 0.027078256160303276 0.1 5 0.027078256160303276 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.027078256160303276 0.25 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACTCCGGAGAATCTCGGTT 10 0.25 TruSeq Adapter, Index 6 (97% over 36bp) GATCGGAAGAGCACACGTCTGAACTCCAGTCACTCCGGAGAATCGCGGTT 5 0.125 TruSeq Adapter, Index 6 (97% over 36bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 812456 spots for SRR21853525.sra Written 812456 spots for SRR21853525.sra Read 812456 spots for SRR21853525.sra Written 812456 spots for SRR21853525.sra Read 812456 spots for SRR21853525.sra Written 812456 spots for SRR21853525.sra Read 812456 spots for SRR21853525.sra Written 812456 spots for SRR21853525.sra Read 812456 spots for SRR21853525.sra Written 812456 spots for SRR21853525.sra Read 812456 spots for SRR21853525.sra Written 812456 spots for SRR21853525.sra Read 812456 spots for SRR21853525.sra Written 812456 spots for SRR21853525.sra Read 812456 spots for SRR21853525.sra Written 812456 spots for SRR21853525.sra Read 812456 spots for SRR21853525.sra Written 812456 spots for SRR21853525.sra Read 812456 spots for SRR21853525.sra Written 812456 spots for SRR21853525.sra Read 812474 spots for SRR21853525.sra Written 812474 spots for SRR21853525.sra Read 812456 spots for SRR21853525.sra Written 812456 spots for SRR21853525.sra Read 812456 spots for SRR21853525.sra Written 812456 spots for SRR21853525.sra Read 812456 spots for SRR21853525.sra Written 812456 spots for SRR21853525.sra Read 812456 spots for SRR21853525.sra Written 812456 spots for SRR21853525.sra Read 812456 spots for SRR21853525.sra Written 812456 spots for SRR21853525.sra Read 812456 spots for SRR21853525.sra Written 812456 spots for SRR21853525.sra Read 812456 spots for SRR21853525.sra Written 812456 spots for SRR21853525.sra Read 812456 spots for SRR21853525.sra Written 812456 spots for SRR21853525.sra Read 812456 spots for SRR21853525.sra Written 812456 spots for SRR21853525.sra SRR ids: ['SRR21853525.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_gq4v5ppl SRR21853525.sra spots: 16249138 blocks: [[1, 812456], [812457, 1624912], [1624913, 2437368], [2437369, 3249824], [3249825, 4062280], [4062281, 4874736], [4874737, 5687192], [5687193, 6499648], [6499649, 7312104], [7312105, 8124560], [8124561, 8937016], [8937017, 9749472], [9749473, 10561928], [10561929, 11374384], [11374385, 12186840], [12186841, 12999296], [12999297, 13811752], [13811753, 14624208], [14624209, 15436664], [15436665, 16249138]] SRR21853525 file size 4375851 SRR21853525 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR21853525 SRR21853525_1.fastq Input file: SRR21853525_1.fastq trimmed: SRR21853525-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Fri Dec 6 17:04:48 2024 >> started Fri Dec 6 17:04:57 2024 >> done (9.022s) 16249138 reads processed; of these: 9 ( 0.00%) short reads filtered out after trimming by size control 94778 ( 0.58%) empty reads filtered out after trimming by size control 16154351 (99.42%) reads available; of these: 402 ( 0.00%) trimmed reads available after processing 16153949 (100.00%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 19 1 0.00% 20 1 0.00% 21 2 0.00% 22 0 0.00% 23 2 0.00% 24 4 0.00% 25 2 0.00% 26 0 0.00% 27 3 0.00% 28 2 0.00% 29 4 0.00% 30 2 0.00% 31 5 0.00% 32 5 0.00% 33 4 0.00% 34 6 0.00% 35 83 0.00% 36 89 0.00% 37 62 0.00% 38 84 0.00% 39 76 0.00% 40 61 0.00% 41 69 0.00% 42 62 0.00% 43 78 0.00% 44 83 0.00% 45 91 0.00% 46 87 0.00% 47 95 0.00% 48 86 0.00% 49 102 0.00% 50 94 0.00% 51 130 0.00% 52 103 0.00% 53 97 0.00% 54 116 0.00% 55 96 0.00% 56 102 0.00% 57 116 0.00% 58 123 0.00% 59 118 0.00% 60 152 0.00% 61 157 0.00% 62 139 0.00% 63 130 0.00% 64 139 0.00% 65 151 0.00% 66 166 0.00% 67 127 0.00% 68 163 0.00% 69 172 0.00% 70 191 0.00% 71 161 0.00% 72 175 0.00% 73 159 0.00% 74 155 0.00% 75 205 0.00% 76 186 0.00% 77 168 0.00% 78 195 0.00% 79 205 0.00% 80 220 0.00% 81 241 0.00% 82 255 0.00% 83 249 0.00% 84 293 0.00% 85 280 0.00% 86 280 0.00% 87 285 0.00% 88 367 0.00% 89 373 0.00% 90 437 0.00% 91 817 0.01% 92 419 0.00% 93 538 0.00% 94 1147 0.01% 95 4204 0.03% 96 22631 0.14% 97 75756 0.47% 98 295165 1.83% 99 1086001 6.72% 100 3672950 22.74% 101 10985801 68.01% 16154351 reads passed initial QC criterion=sequence-density sequence-density=0.23 sequence-density-rank=1 fanout-score=2.74 fanout-score-rank=21 prefix-density=0.33 prefix-fanout=1.9 sequence=CCTTTCCAGGGCCTCAAGTCCACCGCCGGCCTCCCC criterion=fanout-score sequence-density=0.07 sequence-density-rank=21 fanout-score=219.99 fanout-score-rank=1 prefix-density=0.73 prefix-fanout=22.2 sequence=CCGCCGCCGCCA Started job on | Dec 06 17:05:17 Started mapping on | Dec 06 17:05:17 Finished on | Dec 06 17:05:41 Mapping speed, Million of reads per hour | 2423.15 Number of input reads | 16154351 Average input read length | 100 UNIQUE READS: Uniquely mapped reads number | 15264628 Uniquely mapped reads % | 94.49% Average mapped length | 100.23 Number of splices: Total | 5387223 Number of splices: Annotated (sjdb) | 5109529 Number of splices: GT/AG | 5312701 Number of splices: GC/AG | 63298 Number of splices: AT/AC | 2969 Number of splices: Non-canonical | 8255 Mismatch rate per base, % | 0.39% Deletion rate per base | 0.01% Deletion average length | 2.25 Insertion rate per base | 0.01% Insertion average length | 2.00 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 407448 % of reads mapped to multiple loci | 2.52% Number of reads mapped to too many loci | 240192 % of reads mapped to too many loci | 1.49% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.26% % of reads unmapped: other | 0.24% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 482275 482275 482275 N_multimapping 407448 407448 407448 N_noFeature 609414 7840826 7826344 N_ambiguous 236108 15501 15413 UnstrandedReadsAssigned:14419106 PositiveStrandReadsAssigned:7408301 NegativeStrandReadsAssigned:7422871 Dataset is classified unstranded MeadianReadLen=101 20thPercentileLength=100 echo kmer=95 SRR21853525 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR21853525-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,154,351 reads, 14,839,445 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,167 rounds 52973 SRR21853525.ke.tsv 35125 SRR21853525.se.tsv 88098 total ==> SRR21853525.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 42.4709 5.93282 PNS24247 1044 945 43.4168 5.37182 PNS24249 1928 1829 114.24 7.30297 PNS24246 1044 945 43.4168 5.37182 PNS24248 1044 945 43.4168 5.37182 PNS24244 1471 1372 26.0385 2.219 PNS24243 293 194 11 6.62958 KQK14069 1603 1504 2806.5 218.179 KQK14071 474 375 314.063 97.922 ==> SRR21853525.se.tsv <== BRADI_1g14170v3 3417 BRADI_1g53295v3 103 BRADI_1g59795v3 202 BRADI_1g07683v3 0 BRADI_1g00485v3 72 BRADI_1g20270v3 1721 BRADI_1g74790v3 108 BRADI_1g09890v3 6 BRADI_1g77505v3 219 BRADI_1g48960v3 0 SRR21853525 completed mapping pipeline successfully