Starting /dee2/code/volunteer_pipeline.sh SRR21853526 current disk space = 1550703783936 free memory = 1599819300 SRR21853526 SRAfilesize 87e1683cfa7a60219dd9e31f651395be SRR21853526.sra SRR21853526.sra file validated SRR21853526 is single end SRR21853526 is conventional basespace SRR21853526 read1 length is 62-101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR21853526_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 62-101 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.525 37.0 37.0 37.0 37.0 37.0 2 35.7 37.0 37.0 37.0 37.0 37.0 3 35.9915 37.0 37.0 37.0 37.0 37.0 4 35.907 37.0 37.0 37.0 37.0 37.0 5 35.9695 37.0 37.0 37.0 37.0 37.0 6 36.112 37.0 37.0 37.0 37.0 37.0 7 36.0235 37.0 37.0 37.0 37.0 37.0 8 36.1935 37.0 37.0 37.0 37.0 37.0 9 36.077 37.0 37.0 37.0 37.0 37.0 10-11 36.06125 37.0 37.0 37.0 37.0 37.0 12-13 36.08775 37.0 37.0 37.0 37.0 37.0 14-15 35.98175 37.0 37.0 37.0 37.0 37.0 16-17 36.01825 37.0 37.0 37.0 37.0 37.0 18-19 36.007000000000005 37.0 37.0 37.0 37.0 37.0 20-21 35.9765 37.0 37.0 37.0 37.0 37.0 22-23 36.022999999999996 37.0 37.0 37.0 37.0 37.0 24-25 35.918000000000006 37.0 37.0 37.0 37.0 37.0 26-27 35.891999999999996 37.0 37.0 37.0 37.0 37.0 28-29 35.832 37.0 37.0 37.0 37.0 37.0 30-31 35.742999999999995 37.0 37.0 37.0 37.0 37.0 32-33 35.80325 37.0 37.0 37.0 37.0 37.0 34-35 35.8575 37.0 37.0 37.0 37.0 37.0 36-37 35.874 37.0 37.0 37.0 37.0 37.0 38-39 35.84825 37.0 37.0 37.0 37.0 37.0 40-41 35.8245 37.0 37.0 37.0 37.0 37.0 42-43 35.70975 37.0 37.0 37.0 37.0 37.0 44-45 35.7065 37.0 37.0 37.0 37.0 37.0 46-47 35.7915 37.0 37.0 37.0 37.0 37.0 48-49 35.587500000000006 37.0 37.0 37.0 37.0 37.0 50-51 35.70525 37.0 37.0 37.0 37.0 37.0 52-53 35.67825 37.0 37.0 37.0 37.0 37.0 54-55 35.584500000000006 37.0 37.0 37.0 37.0 37.0 56-57 35.657 37.0 37.0 37.0 37.0 37.0 58-59 35.52075 37.0 37.0 37.0 37.0 37.0 60-61 35.66075 37.0 37.0 37.0 37.0 37.0 62-63 35.68659771192799 37.0 37.0 37.0 37.0 37.0 64-65 35.67941985496374 37.0 37.0 37.0 37.0 37.0 66-67 35.65716429107277 37.0 37.0 37.0 37.0 37.0 68-69 35.65266316579145 37.0 37.0 37.0 37.0 37.0 70-71 35.64991247811953 37.0 37.0 37.0 37.0 37.0 72-73 35.73418354588647 37.0 37.0 37.0 37.0 37.0 74-75 35.59639909977494 37.0 37.0 37.0 37.0 37.0 76-77 35.65091272818205 37.0 37.0 37.0 37.0 37.0 78-79 35.596149037259316 37.0 37.0 37.0 37.0 37.0 80-81 35.65466366591648 37.0 37.0 37.0 37.0 37.0 82-83 35.686171542885724 37.0 37.0 37.0 37.0 37.0 84-85 35.585396349087276 37.0 37.0 37.0 37.0 37.0 86-87 35.62815703925982 37.0 37.0 37.0 37.0 37.0 88-89 35.42085521380345 37.0 37.0 37.0 37.0 37.0 90-91 35.639909977494376 37.0 37.0 37.0 37.0 37.0 92-93 35.555638909727435 37.0 37.0 37.0 37.0 37.0 94-95 35.48912228057014 37.0 37.0 37.0 37.0 37.0 96-97 35.5209356366105 37.0 37.0 37.0 37.0 37.0 98-99 35.505671191553546 37.0 37.0 37.0 37.0 37.0 100-101 35.49537082555549 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 2101 1 0.0 2101 2 0.0 2101 3 0.0 2101 4 0.0 2101 5 0.0 2101 6 0.0 2101 7 0.0 2101 8 0.0 2101 9 0.0 2101 10-11 0.0 2101 12-13 0.0 2101 14-15 0.0 2101 16-17 0.0 2101 18-19 0.0 2101 20-21 0.0 2101 22-23 0.0 2101 24-25 0.0 2101 26-27 0.0 2101 28-29 0.0 2101 30-31 0.0 2101 32-33 0.0 2101 34-35 0.0 2101 36-37 0.0 2101 38-39 0.0 2101 40-41 0.0 2101 42-43 0.0 2101 44-45 0.0 2101 46-47 0.0 2101 48-49 0.0 2101 50-51 0.0 2101 52-53 0.0 2101 54-55 0.0 2101 56-57 0.0 2101 58-59 0.0 2101 60-61 0.0 2101 62-63 0.0 2101 64-65 0.0 2101 66-67 0.0 2101 68-69 0.0 2101 70-71 0.0 2101 72-73 0.0 2101 74-75 0.0 2101 76-77 0.0 2101 78-79 0.0 2101 80-81 0.0 2101 82-83 0.0 2101 84-85 0.0 2101 86-87 0.0 2101 88-89 0.0 2101 90-91 0.0 2101 92-93 0.0 2101 94-95 0.0 2101 96-97 0.0 2101 98-99 0.0 2101 100-101 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 1.0 22 1.0 23 1.0 24 2.0 25 8.0 26 12.0 27 13.0 28 30.0 29 44.0 30 70.0 31 88.0 32 123.0 33 162.0 34 203.0 35 471.0 36 2061.0 37 710.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 31.05 12.0 15.525 41.425 2 25.6 19.950000000000003 30.25 24.2 3 26.05 24.224999999999998 22.85 26.875 4 26.950000000000003 28.7 18.05 26.3 5 27.525 29.425 20.825 22.225 6 22.400000000000002 32.25 20.849999999999998 24.5 7 19.900000000000002 15.375 37.525 27.200000000000003 8 23.1 21.5 23.799999999999997 31.6 9 22.775000000000002 19.400000000000002 27.525 30.3 10-11 26.875 26.5875 19.400000000000002 27.1375 12-13 24.9125 21.987499999999997 25.45 27.650000000000002 14-15 23.6125 23.5 25.074999999999996 27.8125 16-17 25.0375 23.962500000000002 23.150000000000002 27.85 18-19 24.887500000000003 24.212500000000002 23.474999999999998 27.425 20-21 25.5125 23.0375 24.712500000000002 26.737499999999997 22-23 24.6625 24.925 23.799999999999997 26.6125 24-25 25.074999999999996 23.925 24.5625 26.437500000000004 26-27 25.8 23.2875 23.5 27.4125 28-29 25.5 23.4125 23.6625 27.425 30-31 24.887500000000003 23.5 24.212500000000002 27.400000000000002 32-33 25.25 24.837500000000002 22.9375 26.974999999999998 34-35 25.4875 23.962500000000002 22.8875 27.6625 36-37 24.9875 23.799999999999997 23.6875 27.525 38-39 25.900000000000002 23.825 23.75 26.525 40-41 26.05 25.4375 22.7375 25.775 42-43 25.275 24.55 23.0625 27.1125 44-45 25.974999999999998 23.95 23.425 26.650000000000002 46-47 26.450000000000003 23.799999999999997 23.0875 26.6625 48-49 25.15 23.4875 24.525 26.8375 50-51 25.8 23.4375 23.8125 26.950000000000003 52-53 26.3 24.325 22.037499999999998 27.3375 54-55 25.9625 24.2375 23.875 25.924999999999997 56-57 26.1 23.0125 23.6125 27.275 58-59 26.05 24.5 22.7125 26.737499999999997 60-61 25.887500000000003 23.7 24.275 26.137500000000003 62-63 26.090761345168147 23.540442555319416 24.028003500437556 26.340792599074884 64-65 25.95648912228057 23.418354588647162 23.443360840210055 27.181795448862218 66-67 26.93173293323331 22.593148287071767 23.593398349587396 26.881720430107524 68-69 25.668917229307326 24.06851712928232 23.193298324581146 27.069267316829208 70-71 26.694173543385848 23.95598899724931 22.893223305826456 26.456614153538382 72-73 26.86921730432608 24.431107776944234 23.3183295823956 25.381345336334082 74-75 26.356589147286826 23.393348337084273 23.48087021755439 26.76919229807452 76-77 26.156539134783696 23.3183295823956 23.030757689422355 27.494373593398347 78-79 26.16904226056514 24.268567141785446 23.85596399099775 25.70642660665166 80-81 24.918729682420604 24.718679669917478 22.80570142535634 27.556889222305575 82-83 26.406601650412604 23.018254563640912 23.968492123030757 26.60665166291573 84-85 26.069017254313575 24.343585896474117 22.893223305826456 26.694173543385848 86-87 26.65666416604151 23.568392098024507 23.50587646911728 26.269067266816705 88-89 26.006501625406354 23.393348337084273 24.01850462615654 26.581645411352838 90-91 26.04401100275069 23.518379594898725 23.243310827706924 27.19429857464366 92-93 25.868967241810452 23.55588897224306 23.34333583395849 27.231807951987996 94-95 27.131782945736433 23.193298324581146 23.80595148787197 25.868967241810452 96-97 26.20982868575716 23.62135800925347 23.50881580592722 26.65999749906215 98-99 26.732673267326735 23.254633155623257 23.165778116273167 26.84691546077685 100-101 27.666562402252108 11.072880825774163 28.088833281201126 33.1717234907726 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.0 21 0.0 22 0.0 23 0.5 24 1.5 25 2.5 26 2.5 27 1.5 28 3.5 29 5.5 30 8.0 31 13.0 32 14.5 33 13.0 34 20.0 35 29.0 36 39.0 37 54.0 38 66.0 39 80.5 40 101.5 41 119.5 42 131.0 43 139.5 44 155.5 45 162.5 46 144.0 47 156.0 48 167.0 49 147.5 50 131.5 51 116.0 52 115.5 53 111.5 54 110.5 55 106.5 56 99.5 57 90.5 58 83.0 59 80.0 60 76.0 61 75.5 62 74.0 63 79.5 64 70.5 65 73.0 66 84.0 67 76.0 68 72.0 69 70.5 70 68.0 71 65.5 72 59.0 73 46.5 74 37.0 75 34.0 76 26.5 77 24.5 78 21.0 79 13.0 80 10.5 81 8.5 82 4.5 83 3.0 84 2.0 85 1.5 86 1.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 62 1.0 63 0.0 64 0.0 65 0.0 66 0.0 67 0.0 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 1.0 97 20.0 98 78.0 99 253.0 100 900.0 101 2747.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.7 #Duplication Level Percentage of deduplicated Percentage of total 1 91.93020719738277 84.3 2 7.197382769901854 13.200000000000001 3 0.7633587786259541 2.1 4 0.10905125408942204 0.4 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 253316 spots for SRR21853526.sra Written 253316 spots for SRR21853526.sra Read 253316 spots for SRR21853526.sra Written 253316 spots for SRR21853526.sra Read 253316 spots for SRR21853526.sra Written 253316 spots for SRR21853526.sra Read 253316 spots for SRR21853526.sra Written 253316 spots for SRR21853526.sra Read 253316 spots for SRR21853526.sra Written 253316 spots for SRR21853526.sra Read 253316 spots for SRR21853526.sra Written 253316 spots for SRR21853526.sra Read 253316 spots for SRR21853526.sra Written 253316 spots for SRR21853526.sra Read 253316 spots for SRR21853526.sra Written 253316 spots for SRR21853526.sra Read 253316 spots for SRR21853526.sra Written 253316 spots for SRR21853526.sra Read 253316 spots for SRR21853526.sra Written 253316 spots for SRR21853526.sra Read 253316 spots for SRR21853526.sra Written 253316 spots for SRR21853526.sra Read 253316 spots for SRR21853526.sra Written 253316 spots for SRR21853526.sra Read 253316 spots for SRR21853526.sra Written 253316 spots for SRR21853526.sra Read 253316 spots for SRR21853526.sra Written 253316 spots for SRR21853526.sra Read 253316 spots for SRR21853526.sra Written 253316 spots for SRR21853526.sra Read 253316 spots for SRR21853526.sra Written 253316 spots for SRR21853526.sra Read 253316 spots for SRR21853526.sra Written 253316 spots for SRR21853526.sra Read 253316 spots for SRR21853526.sra Written 253316 spots for SRR21853526.sra Read 253316 spots for SRR21853526.sra Written 253316 spots for SRR21853526.sra Read 253327 spots for SRR21853526.sra Written 253327 spots for SRR21853526.sra SRR ids: ['SRR21853526.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_hsncdxgd SRR21853526.sra spots: 5066331 blocks: [[1, 253316], [253317, 506632], [506633, 759948], [759949, 1013264], [1013265, 1266580], [1266581, 1519896], [1519897, 1773212], [1773213, 2026528], [2026529, 2279844], [2279845, 2533160], [2533161, 2786476], [2786477, 3039792], [3039793, 3293108], [3293109, 3546424], [3546425, 3799740], [3799741, 4053056], [4053057, 4306372], [4306373, 4559688], [4559689, 4813004], [4813005, 5066331]] SRR21853526 file size 1361891 SRR21853526 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR21853526 SRR21853526_1.fastq Input file: SRR21853526_1.fastq trimmed: SRR21853526-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Fri Dec 6 17:04:51 2024 >> started Fri Dec 6 17:04:53 2024 >> done (2.650s) 5066331 reads processed; of these: 4 ( 0.00%) short reads filtered out after trimming by size control 21727 ( 0.43%) empty reads filtered out after trimming by size control 5044600 (99.57%) reads available; of these: 161 ( 0.00%) trimmed reads available after processing 5044439 (100.00%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 20 1 0.00% 21 0 0.00% 22 0 0.00% 23 2 0.00% 24 0 0.00% 25 0 0.00% 26 0 0.00% 27 1 0.00% 28 1 0.00% 29 1 0.00% 30 1 0.00% 31 3 0.00% 32 1 0.00% 33 6 0.00% 34 2 0.00% 35 9 0.00% 36 12 0.00% 37 9 0.00% 38 6 0.00% 39 10 0.00% 40 9 0.00% 41 16 0.00% 42 10 0.00% 43 18 0.00% 44 9 0.00% 45 6 0.00% 46 19 0.00% 47 4 0.00% 48 4 0.00% 49 20 0.00% 50 25 0.00% 51 20 0.00% 52 9 0.00% 53 16 0.00% 54 11 0.00% 55 13 0.00% 56 10 0.00% 57 18 0.00% 58 21 0.00% 59 22 0.00% 60 17 0.00% 61 22 0.00% 62 22 0.00% 63 27 0.00% 64 28 0.00% 65 11 0.00% 66 27 0.00% 67 32 0.00% 68 23 0.00% 69 19 0.00% 70 22 0.00% 71 33 0.00% 72 28 0.00% 73 42 0.00% 74 34 0.00% 75 38 0.00% 76 43 0.00% 77 57 0.00% 78 38 0.00% 79 47 0.00% 80 38 0.00% 81 58 0.00% 82 66 0.00% 83 64 0.00% 84 66 0.00% 85 70 0.00% 86 89 0.00% 87 84 0.00% 88 75 0.00% 89 86 0.00% 90 135 0.00% 91 289 0.01% 92 138 0.00% 93 185 0.00% 94 380 0.01% 95 1313 0.03% 96 6808 0.13% 97 22093 0.44% 98 88040 1.75% 99 335027 6.64% 100 1115115 22.11% 101 3473426 68.85% 5044600 reads passed initial QC criterion=sequence-density sequence-density=0.16 sequence-density-rank=1 fanout-score=2.25 fanout-score-rank=26 prefix-density=0.19 prefix-fanout=2.0 sequence=GCTCCTTTCCAGGG criterion=fanout-score sequence-density=0.10 sequence-density-rank=20 fanout-score=232.49 fanout-score-rank=1 prefix-density=0.94 prefix-fanout=24.6 sequence=GCCGCCGCCACCCT Started job on | Dec 06 17:05:09 Started mapping on | Dec 06 17:05:09 Finished on | Dec 06 17:05:17 Mapping speed, Million of reads per hour | 2270.07 Number of input reads | 5044600 Average input read length | 100 UNIQUE READS: Uniquely mapped reads number | 4589894 Uniquely mapped reads % | 90.99% Average mapped length | 100.25 Number of splices: Total | 1563883 Number of splices: Annotated (sjdb) | 1485385 Number of splices: GT/AG | 1541989 Number of splices: GC/AG | 18585 Number of splices: AT/AC | 808 Number of splices: Non-canonical | 2501 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.01% Deletion average length | 2.30 Insertion rate per base | 0.01% Insertion average length | 2.01 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 187619 % of reads mapped to multiple loci | 3.72% Number of reads mapped to too many loci | 182834 % of reads mapped to too many loci | 3.62% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.17% % of reads unmapped: other | 0.50% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 267087 267087 267087 N_multimapping 187619 187619 187619 N_noFeature 176397 2352129 2353204 N_ambiguous 70424 5361 4615 UnstrandedReadsAssigned:4343073 PositiveStrandReadsAssigned:2232404 NegativeStrandReadsAssigned:2232075 Dataset is classified unstranded MeadianReadLen=101 20thPercentileLength=100 echo kmer=95 SRR21853526 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR21853526-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 5,044,600 reads, 4,494,339 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,134 rounds 52973 SRR21853526.ke.tsv 35125 SRR21853526.se.tsv 88098 total ==> SRR21853526.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 7.21042 3.15868 PNS24247 1044 945 8.75 3.39506 PNS24249 1928 1829 52.1734 10.4594 PNS24246 1044 945 8.75 3.39506 PNS24248 1044 945 8.75 3.39506 PNS24244 1471 1372 4.36615 1.16685 PNS24243 293 194 1 1.89003 KQK14069 1603 1504 802.422 195.626 KQK14071 474 375 104.842 102.512 ==> SRR21853526.se.tsv <== BRADI_1g14170v3 969 BRADI_1g53295v3 23 BRADI_1g59795v3 55 BRADI_1g07683v3 0 BRADI_1g00485v3 15 BRADI_1g20270v3 526 BRADI_1g74790v3 43 BRADI_1g09890v3 1 BRADI_1g77505v3 86 BRADI_1g48960v3 0 SRR21853526 completed mapping pipeline successfully