Starting /dee2/code/volunteer_pipeline.sh SRR21853527 current disk space = 1550671577088 free memory = 1598827724 SRR21853527 SRAfilesize 05821d48420d713e4b9c1dfd8689cc5e SRR21853527.sra SRR21853527.sra file validated SRR21853527 is single end SRR21853527 is conventional basespace SRR21853527 read1 length is 55-101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR21853527_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 55-101 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.0765 37.0 37.0 37.0 25.0 37.0 2 35.1105 37.0 37.0 37.0 25.0 37.0 3 35.668 37.0 37.0 37.0 37.0 37.0 4 35.8105 37.0 37.0 37.0 37.0 37.0 5 35.8125 37.0 37.0 37.0 37.0 37.0 6 35.867 37.0 37.0 37.0 37.0 37.0 7 35.687 37.0 37.0 37.0 37.0 37.0 8 35.863 37.0 37.0 37.0 37.0 37.0 9 35.8305 37.0 37.0 37.0 37.0 37.0 10-11 35.91675 37.0 37.0 37.0 37.0 37.0 12-13 35.857 37.0 37.0 37.0 37.0 37.0 14-15 35.81575 37.0 37.0 37.0 37.0 37.0 16-17 35.85 37.0 37.0 37.0 37.0 37.0 18-19 35.817499999999995 37.0 37.0 37.0 37.0 37.0 20-21 35.90925 37.0 37.0 37.0 37.0 37.0 22-23 35.89325 37.0 37.0 37.0 37.0 37.0 24-25 35.7945 37.0 37.0 37.0 37.0 37.0 26-27 35.69525 37.0 37.0 37.0 37.0 37.0 28-29 35.72425 37.0 37.0 37.0 37.0 37.0 30-31 35.713750000000005 37.0 37.0 37.0 37.0 37.0 32-33 35.685500000000005 37.0 37.0 37.0 37.0 37.0 34-35 35.67 37.0 37.0 37.0 37.0 37.0 36-37 35.5945 37.0 37.0 37.0 37.0 37.0 38-39 35.68275 37.0 37.0 37.0 37.0 37.0 40-41 35.567499999999995 37.0 37.0 37.0 37.0 37.0 42-43 35.438500000000005 37.0 37.0 37.0 37.0 37.0 44-45 35.3955 37.0 37.0 37.0 37.0 37.0 46-47 35.606 37.0 37.0 37.0 37.0 37.0 48-49 35.367000000000004 37.0 37.0 37.0 37.0 37.0 50-51 35.47125 37.0 37.0 37.0 37.0 37.0 52-53 35.353750000000005 37.0 37.0 37.0 37.0 37.0 54-55 35.461749999999995 37.0 37.0 37.0 37.0 37.0 56-57 35.275568892223056 37.0 37.0 37.0 37.0 37.0 58-59 35.3633408352088 37.0 37.0 37.0 37.0 37.0 60-61 35.5328832208052 37.0 37.0 37.0 37.0 37.0 62-63 35.33608402100525 37.0 37.0 37.0 37.0 37.0 64-65 35.293823455863965 37.0 37.0 37.0 37.0 37.0 66-67 35.249562390597646 37.0 37.0 37.0 31.0 37.0 68-69 35.35708927231808 37.0 37.0 37.0 37.0 37.0 70-71 35.24856214053513 37.0 37.0 37.0 31.0 37.0 72-73 35.37584396099025 37.0 37.0 37.0 37.0 37.0 74-75 35.415853963490875 37.0 37.0 37.0 37.0 37.0 76-77 35.202550637659414 37.0 37.0 37.0 31.0 37.0 78-79 35.33358339584896 37.0 37.0 37.0 37.0 37.0 80-81 35.3953488372093 37.0 37.0 37.0 37.0 37.0 82-83 35.4048512128032 37.0 37.0 37.0 37.0 37.0 84-85 35.38159539884971 37.0 37.0 37.0 37.0 37.0 86-87 35.36209052263065 37.0 37.0 37.0 31.0 37.0 88-89 35.40810202550638 37.0 37.0 37.0 37.0 37.0 90-91 35.31307826956739 37.0 37.0 37.0 37.0 37.0 92-93 35.32658164541135 37.0 37.0 37.0 31.0 37.0 94-95 35.26234322462557 37.0 37.0 37.0 31.0 37.0 96-97 35.28374284739968 37.0 37.0 37.0 31.0 37.0 98-99 35.39035955919284 37.0 37.0 37.0 31.0 37.0 100-101 35.25864957644909 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100-101 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 23 6.0 24 8.0 25 11.0 26 16.0 27 18.0 28 43.0 29 55.0 30 76.0 31 114.0 32 145.0 33 186.0 34 251.0 35 443.0 36 2112.0 37 516.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 29.575000000000003 12.775 15.7 41.949999999999996 2 26.3727959697733 19.848866498740556 29.571788413098236 24.206549118387912 3 26.275 23.95 22.175 27.6 4 27.05 29.025000000000002 17.7 26.224999999999998 5 26.950000000000003 30.475 20.275000000000002 22.3 6 23.075000000000003 31.1 20.525 25.3 7 18.725 16.325 38.550000000000004 26.400000000000002 8 23.974999999999998 21.025 25.124999999999996 29.875 9 22.5 19.175 28.275 30.049999999999997 10-11 25.7 28.0875 19.6375 26.575 12-13 23.962500000000002 21.5375 26.525 27.975 14-15 24.75 24.3125 24.55 26.387500000000003 16-17 25.85 23.974999999999998 22.35 27.825 18-19 24.85 23.625 24.087500000000002 27.437499999999996 20-21 24.6125 24.8 24.349999999999998 26.237500000000004 22-23 25.337500000000002 24.525 23.5625 26.575 24-25 24.6875 24.525 23.3125 27.474999999999998 26-27 25.75 24.025 23.200000000000003 27.025 28-29 25.5 24.325 23.4125 26.7625 30-31 24.6 24.3625 23.3 27.737499999999997 32-33 25.137500000000003 25.3 22.85 26.7125 34-35 25.275 24.099999999999998 23.150000000000002 27.474999999999998 36-37 25.3125 24.3625 23.375 26.950000000000003 38-39 25.55 23.724999999999998 23.375 27.35 40-41 25.587500000000002 23.974999999999998 23.8875 26.55 42-43 25.374999999999996 24.025 23.724999999999998 26.875 44-45 24.762500000000003 24.0125 23.400000000000002 27.825 46-47 25.624999999999996 24.05 23.05 27.275 48-49 26.0 23.1 23.6625 27.237499999999997 50-51 24.9875 24.087500000000002 25.0 25.924999999999997 52-53 26.887499999999996 23.35 22.975 26.787499999999998 54-55 26.1125 23.6875 23.3375 26.8625 56-57 25.006251562890725 24.99374843710928 23.3183295823956 26.6816704176044 58-59 26.03150787696924 24.356089022255563 23.455863965991497 26.156539134783696 60-61 25.85646411602901 23.43085771442861 23.63090772693173 27.081770442610654 62-63 25.44386096524131 23.568392098024507 23.968492123030757 27.019254813703427 64-65 26.85671417854464 23.48087021755439 23.118279569892472 26.544136034008503 66-67 25.63140785196299 24.18104526131533 23.280820205051263 26.906726681670417 68-69 26.019004751187797 24.781195298824706 22.95573893473368 26.244061015253813 70-71 26.60665166291573 24.568642160540136 23.018254563640912 25.806451612903224 72-73 26.04401100275069 24.268567141785446 23.330832708177045 26.356589147286826 74-75 25.668917229307326 23.518379594898725 23.718429607401852 27.094273568392097 76-77 26.11902975743936 23.655913978494624 23.018254563640912 27.206801700425103 78-79 25.618904726181547 24.118529632408105 23.168292073018254 27.094273568392097 80-81 26.669167291822955 23.655913978494624 23.380845211302827 26.294073518379594 82-83 27.28182045511378 23.305826456614152 22.66816704176044 26.744186046511626 84-85 27.38184546136534 23.43085771442861 22.705676419104776 26.481620405101275 86-87 26.11902975743936 24.431107776944234 22.61815453863466 26.831707926981746 88-89 26.819204801200303 24.593648412103025 22.755688922230558 25.831457864466117 90-91 24.893723430857715 24.256064016004 23.755938984746187 27.094273568392097 92-93 26.806701675418854 23.680920230057513 23.418354588647162 26.094023505876468 94-95 26.597474052769787 22.821057896711267 23.196198574465424 27.38526947605352 96-97 26.307230422817113 23.892919689767325 22.842131598699027 26.957718288716535 98-99 27.373877860665065 21.583006701226452 23.9221140472879 27.12100139082058 100-101 28.36261856631939 10.387187062665216 28.020525579225623 33.22966879178977 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 1.0 20 1.0 21 0.0 22 0.0 23 0.5 24 1.0 25 1.5 26 1.0 27 2.0 28 5.0 29 4.0 30 3.0 31 5.5 32 16.0 33 25.5 34 23.5 35 22.5 36 37.5 37 54.0 38 60.5 39 65.0 40 85.5 41 113.5 42 138.5 43 146.0 44 138.0 45 145.5 46 161.0 47 154.5 48 134.0 49 148.5 50 159.0 51 146.0 52 133.5 53 128.0 54 121.5 55 100.5 56 92.0 57 97.5 58 96.0 59 94.0 60 87.0 61 81.5 62 79.0 63 73.0 64 76.0 65 81.0 66 77.0 67 66.5 68 70.5 69 69.0 70 66.0 71 65.5 72 50.5 73 41.5 74 32.5 75 24.5 76 23.0 77 22.5 78 18.5 79 14.5 80 11.5 81 6.0 82 2.5 83 1.0 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.75 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 55 1.0 56 0.0 57 0.0 58 0.0 59 0.0 60 0.0 61 0.0 62 0.0 63 0.0 64 0.0 65 0.0 66 0.0 67 0.0 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 1.0 95 0.0 96 2.0 97 14.0 98 55.0 99 246.0 100 931.0 101 2750.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.45 #Duplication Level Percentage of deduplicated Percentage of total 1 90.79601990049751 82.125 2 8.208955223880597 14.85 3 0.8568269762299612 2.325 4 0.055279159756771695 0.2 5 0.027639579878385848 0.125 6 0.027639579878385848 0.15 7 0.0 0.0 8 0.0 0.0 9 0.027639579878385848 0.22499999999999998 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACTCCGGAGAATCTCGGTT 9 0.22499999999999998 TruSeq Adapter, Index 6 (97% over 36bp) GATCGGAAGAGCACACGTCTGAACTCCAGTCACTCCGGAGAATCTCGTTT 6 0.15 TruSeq Adapter, Index 6 (97% over 36bp) GTTGAGGATGTCGAGGTAAAGCCCAACAGACGCCCAAATGTACTCGTCAT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 696315 spots for SRR21853527.sra Written 696315 spots for SRR21853527.sra Read 696315 spots for SRR21853527.sra Written 696315 spots for SRR21853527.sra Read 696315 spots for SRR21853527.sra Written 696315 spots for SRR21853527.sra Read 696315 spots for SRR21853527.sra Written 696315 spots for SRR21853527.sra Read 696315 spots for SRR21853527.sra Written 696315 spots for SRR21853527.sra Read 696315 spots for SRR21853527.sra Written 696315 spots for SRR21853527.sra Read 696317 spots for SRR21853527.sra Written 696317 spots for SRR21853527.sra Read 696315 spots for SRR21853527.sra Written 696315 spots for SRR21853527.sra Read 696315 spots for SRR21853527.sra Written 696315 spots for SRR21853527.sra Read 696315 spots for SRR21853527.sra Written 696315 spots for SRR21853527.sra Read 696315 spots for SRR21853527.sra Written 696315 spots for SRR21853527.sra Read 696315 spots for SRR21853527.sra Written 696315 spots for SRR21853527.sra Read 696315 spots for SRR21853527.sra Written 696315 spots for SRR21853527.sra Read 696315 spots for SRR21853527.sra Written 696315 spots for SRR21853527.sra Read 696315 spots for SRR21853527.sra Written 696315 spots for SRR21853527.sra Read 696315 spots for SRR21853527.sra Written 696315 spots for SRR21853527.sra Read 696315 spots for SRR21853527.sra Written 696315 spots for SRR21853527.sra Read 696315 spots for SRR21853527.sra Written 696315 spots for SRR21853527.sra Read 696315 spots for SRR21853527.sra Written 696315 spots for SRR21853527.sra Read 696315 spots for SRR21853527.sra Written 696315 spots for SRR21853527.sra SRR ids: ['SRR21853527.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_22gog81l SRR21853527.sra spots: 13926302 blocks: [[1, 696315], [696316, 1392630], [1392631, 2088945], [2088946, 2785260], [2785261, 3481575], [3481576, 4177890], [4177891, 4874205], [4874206, 5570520], [5570521, 6266835], [6266836, 6963150], [6963151, 7659465], [7659466, 8355780], [8355781, 9052095], [9052096, 9748410], [9748411, 10444725], [10444726, 11141040], [11141041, 11837355], [11837356, 12533670], [12533671, 13229985], [13229986, 13926302]] SRR21853527 file size 3748958 SRR21853527 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR21853527 SRR21853527_1.fastq Input file: SRR21853527_1.fastq trimmed: SRR21853527-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Fri Dec 6 17:05:58 2024 >> started Fri Dec 6 17:06:11 2024 >> done (13.251s) 13926302 reads processed; of these: 8 ( 0.00%) short reads filtered out after trimming by size control 75942 ( 0.55%) empty reads filtered out after trimming by size control 13850352 (99.45%) reads available; of these: 271 ( 0.00%) trimmed reads available after processing 13850081 (100.00%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 0 0.00% 20 1 0.00% 21 2 0.00% 22 3 0.00% 23 1 0.00% 24 3 0.00% 25 0 0.00% 26 1 0.00% 27 1 0.00% 28 1 0.00% 29 3 0.00% 30 2 0.00% 31 3 0.00% 32 2 0.00% 33 2 0.00% 34 8 0.00% 35 62 0.00% 36 56 0.00% 37 48 0.00% 38 62 0.00% 39 51 0.00% 40 54 0.00% 41 60 0.00% 42 73 0.00% 43 51 0.00% 44 71 0.00% 45 79 0.00% 46 70 0.00% 47 80 0.00% 48 67 0.00% 49 69 0.00% 50 81 0.00% 51 90 0.00% 52 79 0.00% 53 76 0.00% 54 82 0.00% 55 99 0.00% 56 100 0.00% 57 91 0.00% 58 114 0.00% 59 120 0.00% 60 127 0.00% 61 123 0.00% 62 116 0.00% 63 116 0.00% 64 150 0.00% 65 126 0.00% 66 142 0.00% 67 123 0.00% 68 121 0.00% 69 170 0.00% 70 146 0.00% 71 145 0.00% 72 144 0.00% 73 163 0.00% 74 168 0.00% 75 170 0.00% 76 211 0.00% 77 238 0.00% 78 200 0.00% 79 248 0.00% 80 265 0.00% 81 253 0.00% 82 312 0.00% 83 304 0.00% 84 302 0.00% 85 336 0.00% 86 348 0.00% 87 381 0.00% 88 401 0.00% 89 415 0.00% 90 559 0.00% 91 981 0.01% 92 634 0.00% 93 747 0.01% 94 1323 0.01% 95 3730 0.03% 96 18699 0.14% 97 62345 0.45% 98 244583 1.77% 99 925125 6.68% 100 3069359 22.16% 101 9513882 68.69% 13850352 reads passed initial QC criterion=sequence-density sequence-density=0.20 sequence-density-rank=1 fanout-score=2.80 fanout-score-rank=19 prefix-density=0.29 prefix-fanout=2.0 sequence=CCTTTCCAGGGCCTCAAGTCCACCGCCGGCCTCCCC criterion=fanout-score sequence-density=0.10 sequence-density-rank=25 fanout-score=236.53 fanout-score-rank=1 prefix-density=0.92 prefix-fanout=24.7 sequence=GCCGCCGCCACCCT Started job on | Dec 06 17:06:26 Started mapping on | Dec 06 17:06:27 Finished on | Dec 06 17:06:50 Mapping speed, Million of reads per hour | 2167.88 Number of input reads | 13850352 Average input read length | 100 UNIQUE READS: Uniquely mapped reads number | 12590138 Uniquely mapped reads % | 90.90% Average mapped length | 100.23 Number of splices: Total | 4319202 Number of splices: Annotated (sjdb) | 4100126 Number of splices: GT/AG | 4258424 Number of splices: GC/AG | 51049 Number of splices: AT/AC | 2340 Number of splices: Non-canonical | 7389 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.01% Deletion average length | 2.28 Insertion rate per base | 0.01% Insertion average length | 2.00 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 522888 % of reads mapped to multiple loci | 3.78% Number of reads mapped to too many loci | 495979 % of reads mapped to too many loci | 3.58% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.23% % of reads unmapped: other | 0.51% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 737326 737326 737326 N_multimapping 522888 522888 522888 N_noFeature 484380 6442161 6464444 N_ambiguous 194056 14671 12869 UnstrandedReadsAssigned:11911702 PositiveStrandReadsAssigned:6133306 NegativeStrandReadsAssigned:6112825 Dataset is classified unstranded MeadianReadLen=101 20thPercentileLength=100 echo kmer=95 SRR21853527 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR21853527-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,850,352 reads, 12,330,372 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,234 rounds 52973 SRR21853527.ke.tsv 35125 SRR21853527.se.tsv 88098 total ==> SRR21853527.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 0.00598768 0.000953611 PNS24247 1044 945 45.3259 6.3937 PNS24249 1928 1829 124.357 9.06346 PNS24246 1044 945 45.3259 6.3937 PNS24248 1044 945 45.3259 6.3937 PNS24244 1471 1372 35.6596 3.46466 PNS24243 293 194 2 1.37425 KQK14069 1603 1504 2059.1 182.502 KQK14071 474 375 367.905 130.78 ==> SRR21853527.se.tsv <== BRADI_1g14170v3 2614 BRADI_1g53295v3 68 BRADI_1g59795v3 156 BRADI_1g07683v3 0 BRADI_1g00485v3 58 BRADI_1g20270v3 1465 BRADI_1g74790v3 105 BRADI_1g09890v3 4 BRADI_1g77505v3 199 BRADI_1g48960v3 0 SRR21853527 completed mapping pipeline successfully