Starting /dee2/code/volunteer_pipeline.sh SRR21853528 current disk space = 1550652534784 free memory = 1597885396 SRR21853528 SRAfilesize 443fc29d83b0b70acbc62da4d5a7fbff SRR21853528.sra SRR21853528.sra file validated SRR21853528 is single end SRR21853528 is conventional basespace SRR21853528 read1 length is 60-101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR21853528_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 60-101 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.26 37.0 37.0 37.0 37.0 37.0 2 34.7935 37.0 37.0 37.0 25.0 37.0 3 35.5165 37.0 37.0 37.0 37.0 37.0 4 35.733 37.0 37.0 37.0 37.0 37.0 5 35.937 37.0 37.0 37.0 37.0 37.0 6 35.8575 37.0 37.0 37.0 37.0 37.0 7 35.726 37.0 37.0 37.0 37.0 37.0 8 35.9915 37.0 37.0 37.0 37.0 37.0 9 35.8795 37.0 37.0 37.0 37.0 37.0 10-11 35.9945 37.0 37.0 37.0 37.0 37.0 12-13 35.932 37.0 37.0 37.0 37.0 37.0 14-15 35.891000000000005 37.0 37.0 37.0 37.0 37.0 16-17 35.944 37.0 37.0 37.0 37.0 37.0 18-19 35.923 37.0 37.0 37.0 37.0 37.0 20-21 36.068 37.0 37.0 37.0 37.0 37.0 22-23 35.9285 37.0 37.0 37.0 37.0 37.0 24-25 35.857 37.0 37.0 37.0 37.0 37.0 26-27 35.738 37.0 37.0 37.0 37.0 37.0 28-29 35.694 37.0 37.0 37.0 37.0 37.0 30-31 35.7495 37.0 37.0 37.0 37.0 37.0 32-33 35.658500000000004 37.0 37.0 37.0 37.0 37.0 34-35 35.754999999999995 37.0 37.0 37.0 37.0 37.0 36-37 35.717 37.0 37.0 37.0 37.0 37.0 38-39 35.8 37.0 37.0 37.0 37.0 37.0 40-41 35.6245 37.0 37.0 37.0 37.0 37.0 42-43 35.660250000000005 37.0 37.0 37.0 37.0 37.0 44-45 35.596500000000006 37.0 37.0 37.0 37.0 37.0 46-47 35.65825 37.0 37.0 37.0 37.0 37.0 48-49 35.59925 37.0 37.0 37.0 37.0 37.0 50-51 35.621750000000006 37.0 37.0 37.0 37.0 37.0 52-53 35.651250000000005 37.0 37.0 37.0 37.0 37.0 54-55 35.638 37.0 37.0 37.0 37.0 37.0 56-57 35.59325 37.0 37.0 37.0 37.0 37.0 58-59 35.66675 37.0 37.0 37.0 37.0 37.0 60-61 35.547883691845925 37.0 37.0 37.0 37.0 37.0 62-63 35.516008004002 37.0 37.0 37.0 37.0 37.0 64-65 35.49074537268635 37.0 37.0 37.0 37.0 37.0 66-67 35.51150575287644 37.0 37.0 37.0 37.0 37.0 68-69 35.55852926463231 37.0 37.0 37.0 37.0 37.0 70-71 35.43271635817909 37.0 37.0 37.0 37.0 37.0 72-73 35.450975487743875 37.0 37.0 37.0 37.0 37.0 74-75 35.39744872436218 37.0 37.0 37.0 37.0 37.0 76-77 35.482991495747875 37.0 37.0 37.0 37.0 37.0 78-79 35.549024512256125 37.0 37.0 37.0 37.0 37.0 80-81 35.54452226113057 37.0 37.0 37.0 37.0 37.0 82-83 35.579789894947474 37.0 37.0 37.0 37.0 37.0 84-85 35.4472236118059 37.0 37.0 37.0 37.0 37.0 86-87 35.48974487243622 37.0 37.0 37.0 37.0 37.0 88-89 35.317408704352175 37.0 37.0 37.0 37.0 37.0 90-91 35.42971485742872 37.0 37.0 37.0 37.0 37.0 92-93 35.46473236618309 37.0 37.0 37.0 37.0 37.0 94-95 35.34767383691846 37.0 37.0 37.0 31.0 37.0 96-97 35.28432159121845 37.0 37.0 37.0 31.0 37.0 98-99 35.385786800068345 37.0 37.0 37.0 37.0 37.0 100-101 35.29661330961909 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100-101 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 19 1.0 20 0.0 21 0.0 22 2.0 23 2.0 24 2.0 25 10.0 26 16.0 27 22.0 28 36.0 29 53.0 30 53.0 31 105.0 32 117.0 33 180.0 34 236.0 35 482.0 36 2182.0 37 501.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 30.625000000000004 12.075 17.150000000000002 40.150000000000006 2 25.508130081300813 20.27439024390244 29.496951219512198 24.72052845528455 3 25.05 25.074999999999996 22.475 27.400000000000002 4 27.775 29.599999999999998 17.375 25.25 5 29.075 29.75 20.349999999999998 20.825 6 20.65 32.95 20.925 25.474999999999998 7 21.425 15.75 37.1 25.724999999999998 8 24.224999999999998 20.4 23.225 32.15 9 23.0 20.200000000000003 27.700000000000003 29.099999999999998 10-11 26.437500000000004 27.4125 19.3 26.85 12-13 23.6125 21.1625 26.25 28.975 14-15 24.9125 23.0375 25.0125 27.037499999999998 16-17 25.8 23.2125 24.2875 26.700000000000003 18-19 24.887500000000003 24.0625 24.15 26.900000000000002 20-21 25.374999999999996 23.45 23.9375 27.237499999999997 22-23 25.974999999999998 23.775 23.7875 26.4625 24-25 25.2125 24.474999999999998 23.4875 26.825 26-27 25.374999999999996 23.549999999999997 24.55 26.525 28-29 25.05 24.15 23.375 27.425 30-31 25.224999999999998 23.974999999999998 24.1625 26.637499999999996 32-33 24.8 23.6875 24.8 26.7125 34-35 25.2 24.349999999999998 23.2875 27.1625 36-37 24.637500000000003 24.212500000000002 22.9875 28.1625 38-39 25.674999999999997 24.85 23.1875 26.2875 40-41 26.487500000000004 23.5375 23.6875 26.2875 42-43 26.075 23.25 24.2625 26.4125 44-45 26.187500000000004 24.474999999999998 23.5875 25.75 46-47 25.525 24.025 23.474999999999998 26.974999999999998 48-49 25.7375 22.9625 25.25 26.05 50-51 25.124999999999996 24.0125 24.825 26.0375 52-53 25.424999999999997 24.4125 23.0875 27.075 54-55 25.662499999999998 23.1625 23.7875 27.3875 56-57 26.650000000000002 23.9375 23.525 25.887500000000003 58-59 25.900000000000002 23.3 24.349999999999998 26.450000000000003 60-61 25.10627656914228 23.943485871467868 23.168292073018254 27.781945486371594 62-63 25.3751875937969 23.986993496748372 24.599799899949975 26.038019009504755 64-65 25.987993996998497 24.337168584292147 22.811405702851424 26.863431715857928 66-67 25.60030015007504 23.936968484242122 23.024012006003 27.43871935967984 68-69 26.013006503251624 24.374687343671837 24.049524762381193 25.56278139069535 70-71 25.975487743871934 23.92446223111556 23.499249624812407 26.600800400200097 72-73 25.325162581290645 24.487243621810904 22.798899449724864 27.388694347173587 74-75 26.25062531265633 24.72486243121561 23.461730865432717 25.56278139069535 76-77 25.987993996998497 22.648824412206103 24.69984992496248 26.663331665832917 78-79 27.07603801900951 23.17408704352176 23.274137068534266 26.475737868934466 80-81 26.988494247123562 23.32416208104052 24.299649824912457 25.387693846923458 82-83 25.700350175087543 24.462231115557778 22.461230615307652 27.37618809404702 84-85 26.675837918959477 24.412206103051524 22.698849424712357 26.21310655327664 86-87 26.713356678339167 23.149074537268636 23.88694347173587 26.25062531265633 88-89 27.163581790895446 23.449224612306153 23.12406203101551 26.263131565782892 90-91 26.550775387693847 23.861930965482742 23.424212106053027 26.163081540770385 92-93 25.625312656328163 24.112056028014006 23.74937468734367 26.513256628314156 94-95 26.688344172086044 24.037018509254626 22.861430715357677 26.413206603301653 96-97 26.079339256663747 24.18971342760606 23.61406582405206 26.11688149167814 98-99 26.243654822335028 23.02030456852792 24.111675126903553 26.624365482233504 100-101 28.580372515260606 9.500704335576772 28.486461105024258 33.43246204413836 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.5 3 1.5 4 1.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 0.5 23 0.0 24 0.0 25 1.0 26 2.5 27 2.0 28 1.0 29 6.0 30 9.0 31 10.0 32 14.5 33 17.5 34 22.5 35 29.0 36 34.0 37 45.0 38 69.0 39 88.0 40 91.5 41 101.0 42 114.0 43 127.5 44 145.0 45 157.5 46 161.0 47 169.0 48 173.0 49 142.5 50 122.5 51 118.0 52 123.5 53 136.5 54 131.0 55 119.0 56 110.5 57 102.0 58 91.0 59 87.0 60 84.0 61 83.5 62 89.5 63 91.5 64 85.0 65 78.0 66 69.5 67 59.0 68 58.5 69 61.5 70 59.5 71 64.0 72 59.5 73 46.5 74 32.0 75 23.0 76 22.5 77 19.5 78 17.5 79 10.0 80 4.5 81 3.0 82 1.0 83 1.0 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 1.6 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 60 2.0 61 0.0 62 0.0 63 0.0 64 0.0 65 0.0 66 0.0 67 0.0 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 1.0 96 3.0 97 20.0 98 68.0 99 273.0 100 877.0 101 2756.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.675 #Duplication Level Percentage of deduplicated Percentage of total 1 91.764385055904 84.125 2 7.444777747477501 13.65 3 0.7362967002999727 2.025 4 0.0545404963185165 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1173943 spots for SRR21853528.sra Written 1173943 spots for SRR21853528.sra Read 1173943 spots for SRR21853528.sra Written 1173943 spots for SRR21853528.sra Read 1173943 spots for SRR21853528.sra Written 1173943 spots for SRR21853528.sra Read 1173943 spots for SRR21853528.sra Written 1173943 spots for SRR21853528.sra Read 1173943 spots for SRR21853528.sra Written 1173943 spots for SRR21853528.sra Read 1173943 spots for SRR21853528.sra Written 1173943 spots for SRR21853528.sra Read 1173943 spots for SRR21853528.sra Written 1173943 spots for SRR21853528.sra Read 1173943 spots for SRR21853528.sra Written 1173943 spots for SRR21853528.sra Read 1173943 spots for SRR21853528.sra Written 1173943 spots for SRR21853528.sra Read 1173943 spots for SRR21853528.sra Written 1173943 spots for SRR21853528.sra Read 1173943 spots for SRR21853528.sra Written 1173943 spots for SRR21853528.sra Read 1173943 spots for SRR21853528.sra Written 1173943 spots for SRR21853528.sra Read 1173943 spots for SRR21853528.sra Written 1173943 spots for SRR21853528.sra Read 1173943 spots for SRR21853528.sra Written 1173943 spots for SRR21853528.sra Read 1173943 spots for SRR21853528.sra Written 1173943 spots for SRR21853528.sra Read 1173943 spots for SRR21853528.sra Written 1173943 spots for SRR21853528.sra Read 1173943 spots for SRR21853528.sra Written 1173943 spots for SRR21853528.sra Read 1173961 spots for SRR21853528.sra Written 1173961 spots for SRR21853528.sra Read 1173943 spots for SRR21853528.sra Written 1173943 spots for SRR21853528.sra Read 1173943 spots for SRR21853528.sra Written 1173943 spots for SRR21853528.sra SRR ids: ['SRR21853528.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_q0b204ne SRR21853528.sra spots: 23478878 blocks: [[1, 1173943], [1173944, 2347886], [2347887, 3521829], [3521830, 4695772], [4695773, 5869715], [5869716, 7043658], [7043659, 8217601], [8217602, 9391544], [9391545, 10565487], [10565488, 11739430], [11739431, 12913373], [12913374, 14087316], [14087317, 15261259], [15261260, 16435202], [16435203, 17609145], [17609146, 18783088], [18783089, 19957031], [19957032, 21130974], [21130975, 22304917], [22304918, 23478878]] SRR21853528 file size 6328031 SRR21853528 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR21853528 SRR21853528_1.fastq Input file: SRR21853528_1.fastq trimmed: SRR21853528-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Fri Dec 6 17:06:57 2024 >> started Fri Dec 6 17:07:10 2024 >> done (12.316s) 23478878 reads processed; of these: 12 ( 0.00%) short reads filtered out after trimming by size control 48821 ( 0.21%) empty reads filtered out after trimming by size control 23430045 (99.79%) reads available; of these: 449 ( 0.00%) trimmed reads available after processing 23429596 (100.00%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 19 1 0.00% 20 4 0.00% 21 1 0.00% 22 4 0.00% 23 2 0.00% 24 2 0.00% 25 6 0.00% 26 2 0.00% 27 4 0.00% 28 8 0.00% 29 4 0.00% 30 2 0.00% 31 11 0.00% 32 2 0.00% 33 10 0.00% 34 7 0.00% 35 93 0.00% 36 92 0.00% 37 113 0.00% 38 89 0.00% 39 98 0.00% 40 98 0.00% 41 129 0.00% 42 92 0.00% 43 116 0.00% 44 100 0.00% 45 102 0.00% 46 92 0.00% 47 98 0.00% 48 124 0.00% 49 124 0.00% 50 110 0.00% 51 153 0.00% 52 155 0.00% 53 148 0.00% 54 149 0.00% 55 154 0.00% 56 162 0.00% 57 177 0.00% 58 154 0.00% 59 168 0.00% 60 205 0.00% 61 188 0.00% 62 154 0.00% 63 207 0.00% 64 191 0.00% 65 175 0.00% 66 215 0.00% 67 219 0.00% 68 199 0.00% 69 216 0.00% 70 227 0.00% 71 244 0.00% 72 247 0.00% 73 240 0.00% 74 258 0.00% 75 256 0.00% 76 265 0.00% 77 282 0.00% 78 314 0.00% 79 309 0.00% 80 376 0.00% 81 355 0.00% 82 367 0.00% 83 394 0.00% 84 425 0.00% 85 437 0.00% 86 480 0.00% 87 495 0.00% 88 468 0.00% 89 575 0.00% 90 669 0.00% 91 1940 0.01% 92 869 0.00% 93 1091 0.00% 94 1875 0.01% 95 5994 0.03% 96 30960 0.13% 97 103184 0.44% 98 407672 1.74% 99 1566573 6.69% 100 5186140 22.13% 101 16110935 68.76% 23430045 reads passed initial QC criterion=sequence-density sequence-density=0.22 sequence-density-rank=1 fanout-score=2.14 fanout-score-rank=17 prefix-density=0.22 prefix-fanout=2.1 sequence=TGCATGCAGGTGTGGCCGATCGAGGGCATCAAGAAGTTCGAGACCCTCTC criterion=fanout-score sequence-density=0.06 sequence-density-rank=27 fanout-score=7.97 fanout-score-rank=1 prefix-density=0.29 prefix-fanout=1.7 sequence=CTCCAAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGGAAGCCGGGTTACGGTGCCCAACTGCGCGCTAACCTAGAACCCACAAAGGGTGTTGGTCGATTAAGACAGCAGGACGGTGGTCATGGAAGTCGAAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATCAACTAGCCCCGAAAATGGATGGCGCTAAAGCGCGCGACCCACACCCGGCCATCTGGGCGAGCGCCATGCCCCGATGAGTAGGAGGGCGCGGCGGCCGCTGCAAAACCCGGGGCGCGAGCCCGGGCGGAGCGGCCGTCGGTGCAGATCTTGGTGGTAGTAGCAAATATTCAAATGAGAACTTTGAAGGCCGAAGAGGAGAAAGGTTCCATGTGAACGGCACTTGCACATGGGTAAGCCGATCCTAAGGGACGGGGTAACCCCGGCAGATAGCGCGATCACGCGTATCCCCCGAAAGGGAATCGGGTTAAGATTTCCCGAGCCGGGATG Started job on | Dec 06 17:07:27 Started mapping on | Dec 06 17:07:27 Finished on | Dec 06 17:08:07 Mapping speed, Million of reads per hour | 2108.70 Number of input reads | 23430045 Average input read length | 100 UNIQUE READS: Uniquely mapped reads number | 20533784 Uniquely mapped reads % | 87.64% Average mapped length | 100.21 Number of splices: Total | 7075006 Number of splices: Annotated (sjdb) | 6717873 Number of splices: GT/AG | 6975457 Number of splices: GC/AG | 83611 Number of splices: AT/AC | 3726 Number of splices: Non-canonical | 12212 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.01% Deletion average length | 2.26 Insertion rate per base | 0.01% Insertion average length | 2.00 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1181424 % of reads mapped to multiple loci | 5.04% Number of reads mapped to too many loci | 1249811 % of reads mapped to too many loci | 5.33% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.25% % of reads unmapped: other | 0.74% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1714837 1714837 1714837 N_multimapping 1181424 1181424 1181424 N_noFeature 819642 10534526 10534639 N_ambiguous 323471 20427 21293 UnstrandedReadsAssigned:19390671 PositiveStrandReadsAssigned:9978831 NegativeStrandReadsAssigned:9977852 Dataset is classified unstranded MeadianReadLen=101 20thPercentileLength=100 echo kmer=95 SRR21853528 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR21853528-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 23,430,045 reads, 20,223,134 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,136 rounds 52973 SRR21853528.ke.tsv 35125 SRR21853528.se.tsv 88098 total ==> SRR21853528.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 14.067 1.33292 PNS24247 1044 945 55.9894 4.69894 PNS24249 1928 1829 198.987 8.62852 PNS24246 1044 945 55.9894 4.69894 PNS24248 1044 945 55.9894 4.69894 PNS24244 1471 1372 50.9783 2.94684 PNS24243 293 194 4 1.63525 KQK14069 1603 1504 2153.56 113.562 KQK14071 474 375 534.39 113.019 ==> SRR21853528.se.tsv <== BRADI_1g14170v3 2987 BRADI_1g53295v3 95 BRADI_1g59795v3 271 BRADI_1g07683v3 0 BRADI_1g00485v3 80 BRADI_1g20270v3 2030 BRADI_1g74790v3 213 BRADI_1g09890v3 14 BRADI_1g77505v3 299 BRADI_1g48960v3 0 SRR21853528 completed mapping pipeline successfully