Starting /dee2/code/volunteer_pipeline.sh SRR21853529 current disk space = 1550636081152 free memory = 1597803704 SRR21853529 SRAfilesize 202ef5b41622c5efd1311be2fb05e48a SRR21853529.sra SRR21853529.sra file validated SRR21853529 is single end SRR21853529 is conventional basespace SRR21853529 read1 length is 35-101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR21853529_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 35-101 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.1605 37.0 37.0 37.0 25.0 37.0 2 34.9585 37.0 37.0 37.0 25.0 37.0 3 35.7345 37.0 37.0 37.0 37.0 37.0 4 35.8925 37.0 37.0 37.0 37.0 37.0 5 35.926 37.0 37.0 37.0 37.0 37.0 6 35.853 37.0 37.0 37.0 37.0 37.0 7 35.722 37.0 37.0 37.0 37.0 37.0 8 35.949 37.0 37.0 37.0 37.0 37.0 9 35.941 37.0 37.0 37.0 37.0 37.0 10-11 36.0245 37.0 37.0 37.0 37.0 37.0 12-13 35.8945 37.0 37.0 37.0 37.0 37.0 14-15 35.905 37.0 37.0 37.0 37.0 37.0 16-17 35.906000000000006 37.0 37.0 37.0 37.0 37.0 18-19 35.91625 37.0 37.0 37.0 37.0 37.0 20-21 35.89475 37.0 37.0 37.0 37.0 37.0 22-23 35.8755 37.0 37.0 37.0 37.0 37.0 24-25 35.788 37.0 37.0 37.0 37.0 37.0 26-27 35.695 37.0 37.0 37.0 37.0 37.0 28-29 35.7575 37.0 37.0 37.0 37.0 37.0 30-31 35.78 37.0 37.0 37.0 37.0 37.0 32-33 35.687 37.0 37.0 37.0 37.0 37.0 34-35 35.713 37.0 37.0 37.0 37.0 37.0 36-37 35.71917979494874 37.0 37.0 37.0 37.0 37.0 38-39 35.741185296324076 37.0 37.0 37.0 37.0 37.0 40-41 35.74968742185546 37.0 37.0 37.0 37.0 37.0 42-43 35.56939234808702 37.0 37.0 37.0 37.0 37.0 44-45 35.58864716179045 37.0 37.0 37.0 37.0 37.0 46-47 35.623655913978496 37.0 37.0 37.0 37.0 37.0 48-49 35.568642160540136 37.0 37.0 37.0 37.0 37.0 50-51 35.60915228807202 37.0 37.0 37.0 37.0 37.0 52-53 35.42360590147537 37.0 37.0 37.0 37.0 37.0 54-55 35.634408602150536 37.0 37.0 37.0 37.0 37.0 56-57 35.46561640410103 37.0 37.0 37.0 37.0 37.0 58-59 35.59264816204051 37.0 37.0 37.0 37.0 37.0 60-61 35.54938734683671 37.0 37.0 37.0 37.0 37.0 62-63 35.43414292792808 37.0 37.0 37.0 37.0 37.0 64-65 35.38694347173587 37.0 37.0 37.0 37.0 37.0 66-67 35.55702851425713 37.0 37.0 37.0 37.0 37.0 68-69 35.42996498249124 37.0 37.0 37.0 37.0 37.0 70-71 35.41495747873937 37.0 37.0 37.0 37.0 37.0 72-73 35.33541770885442 37.0 37.0 37.0 37.0 37.0 74-75 35.42771385692846 37.0 37.0 37.0 37.0 37.0 76-77 35.38969484742371 37.0 37.0 37.0 37.0 37.0 78-79 35.438469234617315 37.0 37.0 37.0 37.0 37.0 80-81 35.50825412706353 37.0 37.0 37.0 37.0 37.0 82-83 35.496248124062035 37.0 37.0 37.0 37.0 37.0 84-85 35.37243621810906 37.0 37.0 37.0 31.0 37.0 86-87 35.41170585292646 37.0 37.0 37.0 37.0 37.0 88-89 35.440720360180094 37.0 37.0 37.0 37.0 37.0 90-91 35.47248624312156 37.0 37.0 37.0 37.0 37.0 92-93 35.34392196098049 37.0 37.0 37.0 37.0 37.0 94-95 35.28589294647324 37.0 37.0 37.0 31.0 37.0 96-97 35.34229448388896 37.0 37.0 37.0 31.0 37.0 98-99 35.42327616221275 37.0 37.0 37.0 37.0 37.0 100-101 35.23887331093007 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100-101 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 19 1.0 20 1.0 21 0.0 22 0.0 23 0.0 24 5.0 25 8.0 26 10.0 27 26.0 28 41.0 29 47.0 30 66.0 31 96.0 32 145.0 33 180.0 34 248.0 35 465.0 36 2157.0 37 504.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 28.799999999999997 12.775 15.825 42.6 2 25.656565656565654 19.82323232323232 31.035353535353533 23.484848484848484 3 26.150000000000002 23.925 22.25 27.675 4 27.500000000000004 28.425 18.2 25.874999999999996 5 28.1 29.825000000000003 19.6 22.475 6 22.1 32.324999999999996 21.075 24.5 7 20.150000000000002 15.925 38.925 25.0 8 23.45 21.05 24.575 30.925000000000004 9 21.3 20.875 27.575 30.25 10-11 25.974999999999998 27.287499999999998 19.575 27.1625 12-13 24.8625 21.25 25.374999999999996 28.512500000000003 14-15 24.075 23.175 25.087500000000002 27.6625 16-17 25.087500000000002 24.425 22.55 27.9375 18-19 25.25 24.1375 23.2375 27.375 20-21 25.412499999999998 24.825 23.599999999999998 26.1625 22-23 26.35 23.025000000000002 23.9875 26.637499999999996 24-25 24.087500000000002 24.2875 24.25 27.375 26-27 25.4625 24.0375 23.849999999999998 26.650000000000002 28-29 26.0375 23.7 24.3125 25.95 30-31 24.2625 24.2875 24.4 27.05 32-33 24.3875 25.162499999999998 24.5125 25.937500000000004 34-35 25.650000000000002 24.1125 23.6375 26.6 36-37 25.76894223555889 23.893473368342086 24.406101525381345 25.93148287071768 38-39 25.331332833208304 24.868717179294826 22.893223305826456 26.906726681670417 40-41 25.531382845711427 24.18104526131533 23.243310827706924 27.04426106526632 42-43 25.18129532383096 24.256064016004 24.143535883970994 26.419104776194047 44-45 25.868967241810452 23.48087021755439 23.330832708177045 27.319329832458116 46-47 25.568892223055762 23.78094523630908 22.85571392848212 27.79444861215304 48-49 25.081270317579396 24.76869217304326 23.25581395348837 26.894223555888974 50-51 25.618904726181547 23.843460865216304 23.605901475368842 26.93173293323331 52-53 26.806701675418854 23.818454613653415 23.1807951987997 26.19404851212803 54-55 24.756189047261813 24.10602650662666 23.755938984746187 27.38184546136534 56-57 25.256314078519633 24.381095273818453 23.58089522380595 26.78169542385596 58-59 26.544136034008503 23.593398349587396 23.34333583395849 26.51912978244561 60-61 24.90622655663916 23.63090772693173 25.44386096524131 26.019004751187797 62-63 25.57208953357509 24.0090033762661 23.846442415905962 26.572464674252842 64-65 26.075537768884445 24.499749874937468 23.736868434217108 25.68784392196098 66-67 26.113056528264135 24.074537268634316 23.74937468734367 26.063031515757878 68-69 25.387693846923458 25.15007503751876 23.24912456228114 26.21310655327664 70-71 26.32566283141571 24.099549774887443 23.374187093546773 26.20060030015007 72-73 25.975487743871934 24.337168584292147 23.67433716858429 26.013006503251624 74-75 25.887943971985994 24.68734367183592 23.74937468734367 25.67533766883442 76-77 26.588294147073537 23.28664332166083 23.71185592796398 26.413206603301653 78-79 26.263131565782892 22.63631815907954 23.961980990495245 27.138569284642323 80-81 24.987493746873437 24.12456228114057 24.599799899949975 26.28814407203602 82-83 25.65032516258129 23.43671835917959 24.23711855927964 26.675837918959477 84-85 26.100550275137568 23.21160580290145 23.949474737368686 26.738369184592298 86-87 26.225612806403202 23.28664332166083 24.19959979989995 26.28814407203602 88-89 26.21310655327664 23.911955977988995 23.611805902951478 26.263131565782892 90-91 26.088044022011005 24.037018509254626 23.499249624812407 26.375687843921963 92-93 25.987993996998497 24.662331165582792 23.424212106053027 25.925462731365684 94-95 26.625812906453227 24.099549774887443 23.386693346673336 25.887943971985994 96-97 25.735386155964452 24.821629740893727 23.48228814620103 25.960695956940793 98-99 25.680142384947878 23.340961098398168 24.243579964403764 26.735316552250193 100-101 28.16109896971589 10.084295972525757 29.86262878551358 31.891976272244772 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.5 13 0.5 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.0 20 0.5 21 0.5 22 0.0 23 1.0 24 1.0 25 0.0 26 0.5 27 1.0 28 2.0 29 3.5 30 5.5 31 9.0 32 14.5 33 17.5 34 18.5 35 19.5 36 32.0 37 58.0 38 76.0 39 82.0 40 100.5 41 123.0 42 141.5 43 144.5 44 142.5 45 157.5 46 150.5 47 148.5 48 160.5 49 149.0 50 140.0 51 144.0 52 133.5 53 121.0 54 116.5 55 104.0 56 100.5 57 97.5 58 83.0 59 83.5 60 92.5 61 83.0 62 85.5 63 86.5 64 70.0 65 76.5 66 79.5 67 80.0 68 79.5 69 62.0 70 49.5 71 54.5 72 53.0 73 43.5 74 33.5 75 24.5 76 20.5 77 14.5 78 12.5 79 8.5 80 4.0 81 3.0 82 1.5 83 0.0 84 0.5 85 0.5 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 1.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 34-35 1.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 1.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 1.0 96-97 22.0 98-99 338.0 100-101 3637.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.45 #Duplication Level Percentage of deduplicated Percentage of total 1 92.29313142239049 85.32499999999999 2 7.274202271498107 13.450000000000001 3 0.40562466197944835 1.125 4 0.027041644131963225 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 916180 spots for SRR21853529.sra Written 916180 spots for SRR21853529.sra Read 916180 spots for SRR21853529.sra Written 916180 spots for SRR21853529.sra Read 916180 spots for SRR21853529.sra Written 916180 spots for SRR21853529.sra Read 916180 spots for SRR21853529.sra Written 916180 spots for SRR21853529.sra Read 916180 spots for SRR21853529.sra Written 916180 spots for SRR21853529.sra Read 916180 spots for SRR21853529.sra Written 916180 spots for SRR21853529.sra Read 916187 spots for SRR21853529.sra Written 916187 spots for SRR21853529.sra Read 916180 spots for SRR21853529.sra Written 916180 spots for SRR21853529.sra Read 916180 spots for SRR21853529.sra Written 916180 spots for SRR21853529.sra Read 916180 spots for SRR21853529.sra Written 916180 spots for SRR21853529.sra Read 916180 spots for SRR21853529.sra Written 916180 spots for SRR21853529.sra Read 916180 spots for SRR21853529.sra Written 916180 spots for SRR21853529.sra Read 916180 spots for SRR21853529.sra Written 916180 spots for SRR21853529.sra Read 916180 spots for SRR21853529.sra Written 916180 spots for SRR21853529.sra Read 916180 spots for SRR21853529.sra Written 916180 spots for SRR21853529.sra Read 916180 spots for SRR21853529.sra Written 916180 spots for SRR21853529.sra Read 916180 spots for SRR21853529.sra Written 916180 spots for SRR21853529.sra Read 916180 spots for SRR21853529.sra Written 916180 spots for SRR21853529.sra Read 916180 spots for SRR21853529.sra Written 916180 spots for SRR21853529.sra Read 916180 spots for SRR21853529.sra Written 916180 spots for SRR21853529.sra SRR ids: ['SRR21853529.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_we4xrbvu SRR21853529.sra spots: 18323607 blocks: [[1, 916180], [916181, 1832360], [1832361, 2748540], [2748541, 3664720], [3664721, 4580900], [4580901, 5497080], [5497081, 6413260], [6413261, 7329440], [7329441, 8245620], [8245621, 9161800], [9161801, 10077980], [10077981, 10994160], [10994161, 11910340], [11910341, 12826520], [12826521, 13742700], [13742701, 14658880], [14658881, 15575060], [15575061, 16491240], [16491241, 17407420], [17407421, 18323607]] SRR21853529 file size 4935867 SRR21853529 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR21853529 SRR21853529_1.fastq Input file: SRR21853529_1.fastq trimmed: SRR21853529-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Fri Dec 6 17:09:58 2024 >> started Fri Dec 6 17:10:07 2024 >> done (9.648s) 18323607 reads processed; of these: 27 ( 0.00%) short reads filtered out after trimming by size control 29468 ( 0.16%) empty reads filtered out after trimming by size control 18294112 (99.84%) reads available; of these: 410 ( 0.00%) trimmed reads available after processing 18293702 (100.00%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 2 0.00% 20 1 0.00% 21 0 0.00% 22 5 0.00% 23 2 0.00% 24 4 0.00% 25 2 0.00% 26 4 0.00% 27 4 0.00% 28 8 0.00% 29 3 0.00% 30 7 0.00% 31 8 0.00% 32 3 0.00% 33 6 0.00% 34 6 0.00% 35 103 0.00% 36 102 0.00% 37 106 0.00% 38 122 0.00% 39 105 0.00% 40 106 0.00% 41 89 0.00% 42 91 0.00% 43 125 0.00% 44 121 0.00% 45 122 0.00% 46 130 0.00% 47 129 0.00% 48 127 0.00% 49 130 0.00% 50 138 0.00% 51 120 0.00% 52 109 0.00% 53 101 0.00% 54 144 0.00% 55 135 0.00% 56 161 0.00% 57 150 0.00% 58 169 0.00% 59 139 0.00% 60 167 0.00% 61 177 0.00% 62 164 0.00% 63 173 0.00% 64 166 0.00% 65 176 0.00% 66 205 0.00% 67 177 0.00% 68 170 0.00% 69 195 0.00% 70 188 0.00% 71 201 0.00% 72 204 0.00% 73 193 0.00% 74 231 0.00% 75 209 0.00% 76 190 0.00% 77 225 0.00% 78 257 0.00% 79 265 0.00% 80 266 0.00% 81 307 0.00% 82 282 0.00% 83 303 0.00% 84 320 0.00% 85 359 0.00% 86 364 0.00% 87 333 0.00% 88 371 0.00% 89 434 0.00% 90 532 0.00% 91 1211 0.01% 92 551 0.00% 93 687 0.00% 94 1323 0.01% 95 4598 0.03% 96 24432 0.13% 97 82215 0.45% 98 321821 1.76% 99 1221357 6.68% 100 4066018 22.23% 101 12558954 68.65% 18294112 reads passed initial QC criterion=sequence-density sequence-density=0.23 sequence-density-rank=1 fanout-score=2.20 fanout-score-rank=19 prefix-density=0.27 prefix-fanout=1.9 sequence=GCTCCTTTCCAGGG criterion=fanout-score sequence-density=0.01 sequence-density-rank=34 fanout-score=33.75 fanout-score-rank=1 prefix-density=0.04 prefix-fanout=4.4 sequence=CAATGTCGACCGCCGCGGCCAACTGGTGCTACGCAACCGTCGCGCCCCGCGCTAAGAGCGTCGTCGTCGCCAGCCTCGGCACCCCGGCCCCGTCCTCTTCCGGCAGCTTCCGGCCCAGGCTCATCAGGAACGCCCCCGTCCAGGCCGCGCCCGTCGCGCCCGCATTGATGGACGCCGCCGTGGAGCGCCTCAAGACCGGGTTCGAGAAGTTCAAGACCGAGGTCTACGACAAGAAGCCGGATGTCTTCGAGCCGCTCAAGGCCGGCCAG Started job on | Dec 06 17:10:25 Started mapping on | Dec 06 17:10:25 Finished on | Dec 06 17:10:51 Mapping speed, Million of reads per hour | 2533.03 Number of input reads | 18294112 Average input read length | 100 UNIQUE READS: Uniquely mapped reads number | 16389781 Uniquely mapped reads % | 89.59% Average mapped length | 100.23 Number of splices: Total | 5747535 Number of splices: Annotated (sjdb) | 5456567 Number of splices: GT/AG | 5667111 Number of splices: GC/AG | 67599 Number of splices: AT/AC | 3034 Number of splices: Non-canonical | 9791 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.01% Deletion average length | 2.30 Insertion rate per base | 0.01% Insertion average length | 2.04 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 814400 % of reads mapped to multiple loci | 4.45% Number of reads mapped to too many loci | 764202 % of reads mapped to too many loci | 4.18% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.17% % of reads unmapped: other | 0.61% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1089931 1089931 1089931 N_multimapping 814400 814400 814400 N_noFeature 641631 8414017 8398877 N_ambiguous 248282 14955 16739 UnstrandedReadsAssigned:15499868 PositiveStrandReadsAssigned:7960809 NegativeStrandReadsAssigned:7974165 Dataset is classified unstranded MeadianReadLen=101 20thPercentileLength=100 echo kmer=95 SRR21853529 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR21853529-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 18,294,112 reads, 16,079,694 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,098 rounds 52973 SRR21853529.ke.tsv 35125 SRR21853529.se.tsv 88098 total ==> SRR21853529.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 28.7441 3.50371 PNS24247 1044 945 56.4358 6.09296 PNS24249 1928 1829 125.823 7.01864 PNS24246 1044 945 56.4358 6.09296 PNS24248 1044 945 56.4358 6.09296 PNS24244 1471 1372 24.1253 1.794 PNS24243 293 194 3 1.5777 KQK14069 1603 1504 2333.67 158.306 KQK14071 474 375 403.102 109.67 ==> SRR21853529.se.tsv <== BRADI_1g14170v3 2960 BRADI_1g53295v3 72 BRADI_1g59795v3 197 BRADI_1g07683v3 0 BRADI_1g00485v3 74 BRADI_1g20270v3 1639 BRADI_1g74790v3 173 BRADI_1g09890v3 6 BRADI_1g77505v3 236 BRADI_1g48960v3 0 SRR21853529 completed mapping pipeline successfully