Starting /dee2/code/volunteer_pipeline.sh SRR21853530 current disk space = 1550602092544 free memory = 1597269632 SRR21853530 SRAfilesize f29cd145b32dd4f09431087ff14d833c SRR21853530.sra SRR21853530.sra file validated SRR21853530 is single end SRR21853530 is conventional basespace SRR21853530 read1 length is 88-101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR21853530_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 88-101 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.559 37.0 37.0 37.0 37.0 37.0 2 35.8335 37.0 37.0 37.0 37.0 37.0 3 36.047 37.0 37.0 37.0 37.0 37.0 4 35.9795 37.0 37.0 37.0 37.0 37.0 5 36.06 37.0 37.0 37.0 37.0 37.0 6 36.184 37.0 37.0 37.0 37.0 37.0 7 36.054 37.0 37.0 37.0 37.0 37.0 8 36.2055 37.0 37.0 37.0 37.0 37.0 9 36.1685 37.0 37.0 37.0 37.0 37.0 10-11 36.078 37.0 37.0 37.0 37.0 37.0 12-13 36.09925 37.0 37.0 37.0 37.0 37.0 14-15 36.09375 37.0 37.0 37.0 37.0 37.0 16-17 35.985 37.0 37.0 37.0 37.0 37.0 18-19 35.99575 37.0 37.0 37.0 37.0 37.0 20-21 35.886 37.0 37.0 37.0 37.0 37.0 22-23 35.98950000000001 37.0 37.0 37.0 37.0 37.0 24-25 35.94275 37.0 37.0 37.0 37.0 37.0 26-27 35.917 37.0 37.0 37.0 37.0 37.0 28-29 35.923500000000004 37.0 37.0 37.0 37.0 37.0 30-31 35.846999999999994 37.0 37.0 37.0 37.0 37.0 32-33 35.869749999999996 37.0 37.0 37.0 37.0 37.0 34-35 35.80625 37.0 37.0 37.0 37.0 37.0 36-37 35.782 37.0 37.0 37.0 37.0 37.0 38-39 35.8965 37.0 37.0 37.0 37.0 37.0 40-41 35.87375 37.0 37.0 37.0 37.0 37.0 42-43 35.80075 37.0 37.0 37.0 37.0 37.0 44-45 35.74525 37.0 37.0 37.0 37.0 37.0 46-47 35.831 37.0 37.0 37.0 37.0 37.0 48-49 35.78475 37.0 37.0 37.0 37.0 37.0 50-51 35.6965 37.0 37.0 37.0 37.0 37.0 52-53 35.69 37.0 37.0 37.0 37.0 37.0 54-55 35.70125 37.0 37.0 37.0 37.0 37.0 56-57 35.71625 37.0 37.0 37.0 37.0 37.0 58-59 35.663 37.0 37.0 37.0 37.0 37.0 60-61 35.667500000000004 37.0 37.0 37.0 37.0 37.0 62-63 35.73524999999999 37.0 37.0 37.0 37.0 37.0 64-65 35.747 37.0 37.0 37.0 37.0 37.0 66-67 35.792249999999996 37.0 37.0 37.0 37.0 37.0 68-69 35.66225 37.0 37.0 37.0 37.0 37.0 70-71 35.7305 37.0 37.0 37.0 37.0 37.0 72-73 35.6815 37.0 37.0 37.0 37.0 37.0 74-75 35.56325 37.0 37.0 37.0 37.0 37.0 76-77 35.6685 37.0 37.0 37.0 37.0 37.0 78-79 35.669250000000005 37.0 37.0 37.0 37.0 37.0 80-81 35.6205 37.0 37.0 37.0 37.0 37.0 82-83 35.49575 37.0 37.0 37.0 37.0 37.0 84-85 35.6185 37.0 37.0 37.0 37.0 37.0 86-87 35.557249999999996 37.0 37.0 37.0 37.0 37.0 88-89 35.51706989247312 37.0 37.0 37.0 37.0 37.0 90-91 35.581395348837205 37.0 37.0 37.0 37.0 37.0 92-93 35.45561390347587 37.0 37.0 37.0 37.0 37.0 94-95 35.53813453363341 37.0 37.0 37.0 37.0 37.0 96-97 35.54472605514272 37.0 37.0 37.0 37.0 37.0 98-99 35.61562502414688 37.0 37.0 37.0 37.0 37.0 100-101 35.479850533428575 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 2101 1 0.0 2101 2 0.0 2101 3 0.0 2101 4 0.0 2101 5 0.0 2101 6 0.0 2101 7 0.0 2101 8 0.0 2101 9 0.0 2101 10-11 0.0 2101 12-13 0.0 2101 14-15 0.0 2101 16-17 0.0 2101 18-19 0.0 2101 20-21 0.0 2101 22-23 0.0 2101 24-25 0.0 2101 26-27 0.0 2101 28-29 0.0 2101 30-31 0.0 2101 32-33 0.0 2101 34-35 0.0 2101 36-37 0.0 2101 38-39 0.0 2101 40-41 0.0 2101 42-43 0.0 2101 44-45 0.0 2101 46-47 0.0 2101 48-49 0.0 2101 50-51 0.0 2101 52-53 0.0 2101 54-55 0.0 2101 56-57 0.0 2101 58-59 0.0 2101 60-61 0.0 2101 62-63 0.0 2101 64-65 0.0 2101 66-67 0.0 2101 68-69 0.0 2101 70-71 0.0 2101 72-73 0.0 2101 74-75 0.0 2101 76-77 0.0 2101 78-79 0.0 2101 80-81 0.0 2101 82-83 0.0 2101 84-85 0.0 2101 86-87 0.0 2101 88-89 0.0 2101 90-91 0.0 2101 92-93 0.0 2101 94-95 0.0 2101 96-97 0.0 2101 98-99 0.0 2101 100-101 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 1.0 22 2.0 23 1.0 24 0.0 25 8.0 26 16.0 27 9.0 28 25.0 29 47.0 30 55.0 31 84.0 32 107.0 33 145.0 34 221.0 35 478.0 36 2271.0 37 530.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 29.4 12.950000000000001 17.925 39.725 2 24.775 19.475 31.45 24.3 3 26.424999999999997 24.75 23.150000000000002 25.674999999999997 4 27.375 29.325000000000003 18.95 24.349999999999998 5 26.025 31.674999999999997 20.95 21.349999999999998 6 21.425 33.15 21.224999999999998 24.2 7 19.55 15.65 38.425 26.375 8 21.7 20.7 25.874999999999996 31.724999999999998 9 22.7 21.45 27.875 27.975 10-11 24.9 28.1875 20.525 26.387500000000003 12-13 23.3375 22.675 26.1625 27.825 14-15 24.0125 23.7 26.05 26.237500000000004 16-17 24.95 23.9125 24.6875 26.450000000000003 18-19 24.4375 25.1 24.675 25.7875 20-21 25.074999999999996 24.962500000000002 25.1 24.8625 22-23 24.349999999999998 24.5375 23.974999999999998 27.1375 24-25 23.95 25.275 23.6125 27.1625 26-27 24.2375 24.875 24.175 26.7125 28-29 25.374999999999996 24.474999999999998 23.6125 26.5375 30-31 23.825 25.674999999999997 23.8125 26.687499999999996 32-33 24.2 25.8125 24.349999999999998 25.637500000000003 34-35 24.0375 24.95 24.2 26.8125 36-37 23.9125 25.2875 24.762500000000003 26.0375 38-39 24.5 24.587500000000002 24.9875 25.924999999999997 40-41 24.762500000000003 24.5375 24.4125 26.2875 42-43 25.337500000000002 24.962500000000002 23.7625 25.937500000000004 44-45 24.5125 25.974999999999998 24.15 25.362499999999997 46-47 25.2375 24.55 24.0375 26.174999999999997 48-49 24.75 24.4375 24.6625 26.150000000000002 50-51 24.6125 25.662499999999998 24.6625 25.0625 52-53 25.05 25.937500000000004 22.8375 26.174999999999997 54-55 24.0625 25.0625 24.25 26.625 56-57 25.162499999999998 24.425 24.762500000000003 25.650000000000002 58-59 24.9375 25.900000000000002 23.5625 25.6 60-61 24.45 25.5625 25.1875 24.8 62-63 25.624999999999996 24.825 24.4375 25.112499999999997 64-65 24.8125 25.0625 23.8625 26.2625 66-67 24.887500000000003 25.35 24.1375 25.624999999999996 68-69 24.5375 24.975 25.174999999999997 25.3125 70-71 24.775 24.725 24.7875 25.7125 72-73 25.887500000000003 25.324999999999996 23.125 25.662499999999998 74-75 25.224999999999998 24.462500000000002 24.525 25.7875 76-77 25.6 24.2 24.3125 25.887500000000003 78-79 26.3 24.15 24.2 25.35 80-81 25.7375 24.837500000000002 24.637500000000003 24.7875 82-83 24.4375 25.35 24.175 26.0375 84-85 25.25 23.8125 24.15 26.787499999999998 86-87 25.2125 24.712500000000002 24.474999999999998 25.6 88-89 24.778097262157768 25.703212901612705 23.340417552194022 26.178272284035504 90-91 25.056264066016503 24.868717179294826 24.118529632408105 25.95648912228057 92-93 25.93148287071768 24.543635908977244 24.15603900975244 25.36884221055264 94-95 25.468867216804203 23.55588897224306 24.23105776444111 26.744186046511626 96-97 24.283748279744778 24.69660953334167 25.159514575253343 25.860127611660204 98-99 25.171276325805632 22.976401928444556 24.42273534635879 27.429586399391013 100-101 26.7814820666772 10.2385842945173 30.857955443197977 32.12197819560752 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 0.5 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 0.5 23 1.0 24 1.0 25 1.0 26 2.5 27 3.0 28 4.0 29 6.0 30 7.5 31 8.0 32 9.5 33 13.5 34 23.5 35 37.0 36 43.5 37 48.0 38 65.5 39 91.5 40 110.5 41 132.0 42 151.0 43 170.0 44 184.5 45 189.0 46 203.0 47 193.0 48 166.0 49 151.5 50 133.5 51 134.0 52 143.5 53 123.5 54 102.0 55 91.5 56 95.5 57 107.0 58 87.5 59 68.0 60 76.5 61 80.5 62 71.5 63 60.0 64 61.5 65 65.5 66 57.5 67 57.5 68 57.5 69 44.5 70 41.5 71 42.5 72 36.5 73 31.5 74 25.0 75 17.0 76 12.5 77 19.5 78 18.0 79 7.5 80 4.0 81 3.5 82 3.0 83 1.0 84 1.0 85 1.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 88 1.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 1.0 96 3.0 97 15.0 98 78.0 99 271.0 100 933.0 101 2698.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.0 #Duplication Level Percentage of deduplicated Percentage of total 1 91.92934782608695 84.575 2 7.554347826086956 13.900000000000002 3 0.43478260869565216 1.2 4 0.05434782608695652 0.2 5 0.02717391304347826 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CCGGCGGGTAGTCATAAGCCATAACAGATAGAACAGTGGAGATGACAAGC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 315966 spots for SRR21853530.sra Written 315966 spots for SRR21853530.sra Read 315966 spots for SRR21853530.sra Written 315966 spots for SRR21853530.sra Read 315966 spots for SRR21853530.sra Written 315966 spots for SRR21853530.sra Read 315978 spots for SRR21853530.sra Written 315978 spots for SRR21853530.sra Read 315966 spots for SRR21853530.sra Written 315966 spots for SRR21853530.sra Read 315966 spots for SRR21853530.sra Written 315966 spots for SRR21853530.sra Read 315966 spots for SRR21853530.sra Written 315966 spots for SRR21853530.sra Read 315966 spots for SRR21853530.sra Written 315966 spots for SRR21853530.sra Read 315966 spots for SRR21853530.sra Written 315966 spots for SRR21853530.sra Read 315966 spots for SRR21853530.sra Written 315966 spots for SRR21853530.sra Read 315966 spots for SRR21853530.sra Written 315966 spots for SRR21853530.sra Read 315966 spots for SRR21853530.sra Written 315966 spots for SRR21853530.sra Read 315966 spots for SRR21853530.sra Written 315966 spots for SRR21853530.sra Read 315966 spots for SRR21853530.sra Written 315966 spots for SRR21853530.sra Read 315966 spots for SRR21853530.sra Written 315966 spots for SRR21853530.sra Read 315966 spots for SRR21853530.sra Written 315966 spots for SRR21853530.sra Read 315966 spots for SRR21853530.sra Written 315966 spots for SRR21853530.sra Read 315966 spots for SRR21853530.sra Written 315966 spots for SRR21853530.sra Read 315966 spots for SRR21853530.sra Written 315966 spots for SRR21853530.sra Read 315966 spots for SRR21853530.sra Written 315966 spots for SRR21853530.sra SRR ids: ['SRR21853530.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_zwwinwfa SRR21853530.sra spots: 6319332 blocks: [[1, 315966], [315967, 631932], [631933, 947898], [947899, 1263864], [1263865, 1579830], [1579831, 1895796], [1895797, 2211762], [2211763, 2527728], [2527729, 2843694], [2843695, 3159660], [3159661, 3475626], [3475627, 3791592], [3791593, 4107558], [4107559, 4423524], [4423525, 4739490], [4739491, 5055456], [5055457, 5371422], [5371423, 5687388], [5687389, 6003354], [6003355, 6319332]] SRR21853530 file size 1698833 SRR21853530 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR21853530 SRR21853530_1.fastq Input file: SRR21853530_1.fastq trimmed: SRR21853530-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Fri Dec 6 17:12:30 2024 >> started Fri Dec 6 17:12:33 2024 >> done (3.391s) 6319332 reads processed; of these: 2 ( 0.00%) short reads filtered out after trimming by size control 3968 ( 0.06%) empty reads filtered out after trimming by size control 6315362 (99.94%) reads available; of these: 224 ( 0.00%) trimmed reads available after processing 6315138 (100.00%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 26 1 0.00% 27 0 0.00% 28 0 0.00% 29 1 0.00% 30 0 0.00% 31 1 0.00% 32 4 0.00% 33 9 0.00% 34 2 0.00% 35 23 0.00% 36 11 0.00% 37 6 0.00% 38 19 0.00% 39 13 0.00% 40 15 0.00% 41 13 0.00% 42 9 0.00% 43 16 0.00% 44 15 0.00% 45 18 0.00% 46 19 0.00% 47 12 0.00% 48 18 0.00% 49 17 0.00% 50 22 0.00% 51 13 0.00% 52 19 0.00% 53 20 0.00% 54 25 0.00% 55 9 0.00% 56 25 0.00% 57 15 0.00% 58 14 0.00% 59 17 0.00% 60 25 0.00% 61 18 0.00% 62 21 0.00% 63 21 0.00% 64 19 0.00% 65 21 0.00% 66 29 0.00% 67 24 0.00% 68 25 0.00% 69 24 0.00% 70 32 0.00% 71 29 0.00% 72 35 0.00% 73 23 0.00% 74 27 0.00% 75 21 0.00% 76 26 0.00% 77 39 0.00% 78 31 0.00% 79 49 0.00% 80 26 0.00% 81 29 0.00% 82 46 0.00% 83 54 0.00% 84 47 0.00% 85 38 0.00% 86 36 0.00% 87 42 0.00% 88 45 0.00% 89 64 0.00% 90 83 0.00% 91 208 0.00% 92 65 0.00% 93 97 0.00% 94 355 0.01% 95 1469 0.02% 96 8733 0.14% 97 29466 0.47% 98 115638 1.83% 99 424095 6.72% 100 1440999 22.82% 101 4292767 67.97% 6315362 reads passed initial QC criterion=sequence-density sequence-density=0.24 sequence-density-rank=1 fanout-score=2.23 fanout-score-rank=19 prefix-density=0.29 prefix-fanout=1.9 sequence=GCTCCTTTCCAGGG criterion=fanout-score sequence-density=0.10 sequence-density-rank=14 fanout-score=189.62 fanout-score-rank=1 prefix-density=0.79 prefix-fanout=23.2 sequence=CGCCGCCGCCGC Started job on | Dec 06 17:12:54 Started mapping on | Dec 06 17:12:54 Finished on | Dec 06 17:13:03 Mapping speed, Million of reads per hour | 2526.14 Number of input reads | 6315362 Average input read length | 100 UNIQUE READS: Uniquely mapped reads number | 6043101 Uniquely mapped reads % | 95.69% Average mapped length | 100.24 Number of splices: Total | 2168610 Number of splices: Annotated (sjdb) | 2061205 Number of splices: GT/AG | 2139128 Number of splices: GC/AG | 25230 Number of splices: AT/AC | 1216 Number of splices: Non-canonical | 3036 Mismatch rate per base, % | 0.33% Deletion rate per base | 0.01% Deletion average length | 2.23 Insertion rate per base | 0.01% Insertion average length | 1.95 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 134629 % of reads mapped to multiple loci | 2.13% Number of reads mapped to too many loci | 61578 % of reads mapped to too many loci | 0.98% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.07% % of reads unmapped: other | 0.14% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 137632 137632 137632 N_multimapping 134629 134629 134629 N_noFeature 247432 3106370 3103954 N_ambiguous 92046 6583 5923 UnstrandedReadsAssigned:5703623 PositiveStrandReadsAssigned:2930148 NegativeStrandReadsAssigned:2933224 Dataset is classified unstranded MeadianReadLen=101 20thPercentileLength=100 echo kmer=95 SRR21853530 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR21853530-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 6,315,362 reads, 5,860,683 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,168 rounds 52973 SRR21853530.ke.tsv 35125 SRR21853530.se.tsv 88098 total ==> SRR21853530.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 0.931855 0.330859 PNS24247 1044 945 23.3932 7.3566 PNS24249 1928 1829 57.7845 9.38896 PNS24246 1044 945 23.3932 7.3566 PNS24248 1044 945 23.3932 7.3566 PNS24244 1471 1372 4.10407 0.888955 PNS24243 293 194 3 4.59557 KQK14069 1603 1504 577.555 114.121 KQK14071 474 375 73.9367 58.5934 ==> SRR21853530.se.tsv <== BRADI_1g14170v3 726 BRADI_1g53295v3 28 BRADI_1g59795v3 70 BRADI_1g07683v3 0 BRADI_1g00485v3 23 BRADI_1g20270v3 626 BRADI_1g74790v3 54 BRADI_1g09890v3 1 BRADI_1g77505v3 92 BRADI_1g48960v3 0 SRR21853530 completed mapping pipeline successfully