Starting /dee2/code/volunteer_pipeline.sh SRR21853531 current disk space = 1550605639680 free memory = 1434034592 SRR21853531 SRAfilesize 45a8dbfff9ab438133b94ce0164651a4 SRR21853531.sra SRR21853531.sra file validated SRR21853531 is single end SRR21853531 is conventional basespace SRR21853531 read1 length is 61-101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR21853531_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 61-101 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.256 37.0 37.0 37.0 37.0 37.0 2 34.98775 37.0 37.0 37.0 25.0 37.0 3 35.6545 37.0 37.0 37.0 37.0 37.0 4 35.672 37.0 37.0 37.0 37.0 37.0 5 35.8515 37.0 37.0 37.0 37.0 37.0 6 35.944 37.0 37.0 37.0 37.0 37.0 7 35.794 37.0 37.0 37.0 37.0 37.0 8 35.759 37.0 37.0 37.0 37.0 37.0 9 35.8595 37.0 37.0 37.0 37.0 37.0 10-11 35.98625 37.0 37.0 37.0 37.0 37.0 12-13 35.84375 37.0 37.0 37.0 37.0 37.0 14-15 35.90025 37.0 37.0 37.0 37.0 37.0 16-17 35.876 37.0 37.0 37.0 37.0 37.0 18-19 35.86825 37.0 37.0 37.0 37.0 37.0 20-21 35.8515 37.0 37.0 37.0 37.0 37.0 22-23 35.791 37.0 37.0 37.0 37.0 37.0 24-25 35.682500000000005 37.0 37.0 37.0 37.0 37.0 26-27 35.640249999999995 37.0 37.0 37.0 37.0 37.0 28-29 35.67400000000001 37.0 37.0 37.0 37.0 37.0 30-31 35.6165 37.0 37.0 37.0 37.0 37.0 32-33 35.67 37.0 37.0 37.0 37.0 37.0 34-35 35.6115 37.0 37.0 37.0 37.0 37.0 36-37 35.6285 37.0 37.0 37.0 37.0 37.0 38-39 35.735 37.0 37.0 37.0 37.0 37.0 40-41 35.52175 37.0 37.0 37.0 37.0 37.0 42-43 35.55225 37.0 37.0 37.0 37.0 37.0 44-45 35.6105 37.0 37.0 37.0 37.0 37.0 46-47 35.59625 37.0 37.0 37.0 37.0 37.0 48-49 35.528999999999996 37.0 37.0 37.0 37.0 37.0 50-51 35.5135 37.0 37.0 37.0 37.0 37.0 52-53 35.472 37.0 37.0 37.0 37.0 37.0 54-55 35.60725 37.0 37.0 37.0 37.0 37.0 56-57 35.4825 37.0 37.0 37.0 37.0 37.0 58-59 35.55825 37.0 37.0 37.0 37.0 37.0 60-61 35.513000000000005 37.0 37.0 37.0 37.0 37.0 62-63 35.470867716929234 37.0 37.0 37.0 37.0 37.0 64-65 35.455613903475864 37.0 37.0 37.0 37.0 37.0 66-67 35.46136534133534 37.0 37.0 37.0 37.0 37.0 68-69 35.528132033008255 37.0 37.0 37.0 37.0 37.0 70-71 35.48137034258565 37.0 37.0 37.0 37.0 37.0 72-73 35.44361090272568 37.0 37.0 37.0 37.0 37.0 74-75 35.399099774943735 37.0 37.0 37.0 37.0 37.0 76-77 35.25759947991 37.0 37.0 37.0 31.0 37.0 78-79 35.407703851925966 37.0 37.0 37.0 37.0 37.0 80-81 35.37593796898449 37.0 37.0 37.0 37.0 37.0 82-83 35.368934467233615 37.0 37.0 37.0 37.0 37.0 84-85 35.30690345172586 37.0 37.0 37.0 31.0 37.0 86-87 35.397698849424714 37.0 37.0 37.0 37.0 37.0 88-89 35.31365682841421 37.0 37.0 37.0 37.0 37.0 90-91 35.28667867834343 37.0 37.0 37.0 37.0 37.0 92-93 35.356017012759565 37.0 37.0 37.0 37.0 37.0 94-95 35.38754065549162 37.0 37.0 37.0 37.0 37.0 96-97 35.10317607608358 37.0 37.0 37.0 25.0 37.0 98-99 35.29183916448331 37.0 37.0 37.0 31.0 37.0 100-101 35.21629600142859 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100-101 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 1.0 22 4.0 23 1.0 24 3.0 25 6.0 26 7.0 27 33.0 28 36.0 29 52.0 30 67.0 31 118.0 32 126.0 33 184.0 34 234.0 35 543.0 36 2130.0 37 455.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 30.25 13.375 16.35 40.025 2 23.803494555583693 20.967333502152442 32.18536338313497 23.04380855912889 3 25.224999999999998 25.275 23.474999999999998 26.025 4 25.900000000000002 30.349999999999998 18.575 25.174999999999997 5 26.775 31.125000000000004 21.099999999999998 21.0 6 20.825 32.35 22.475 24.349999999999998 7 21.125 15.15 39.025 24.7 8 23.599999999999998 20.674999999999997 25.35 30.375000000000004 9 21.875 20.025000000000002 28.175 29.925 10-11 25.05 28.0875 20.837500000000002 26.025 12-13 24.087500000000002 22.7375 25.7625 27.4125 14-15 23.7375 24.1125 26.337500000000002 25.8125 16-17 24.9125 24.65 24.087500000000002 26.35 18-19 23.7875 24.9375 24.65 26.625 20-21 24.3875 24.4375 25.1875 25.9875 22-23 25.4375 24.4 23.549999999999997 26.6125 24-25 25.2125 25.275 23.8625 25.650000000000002 26-27 24.4125 25.412499999999998 24.3125 25.8625 28-29 25.3 25.05 24.474999999999998 25.174999999999997 30-31 23.974999999999998 25.0625 24.349999999999998 26.6125 32-33 23.925 25.412499999999998 25.474999999999998 25.1875 34-35 25.75 24.25 24.2875 25.7125 36-37 24.6125 24.6125 24.2875 26.487500000000004 38-39 24.887500000000003 24.925 25.137500000000003 25.05 40-41 24.9875 23.549999999999997 24.175 27.287499999999998 42-43 24.7875 24.1375 24.2875 26.787499999999998 44-45 24.7375 25.424999999999997 24.725 25.112499999999997 46-47 25.55 25.05 24.462500000000002 24.9375 48-49 24.1875 24.725 24.375 26.7125 50-51 24.3875 25.45 24.625 25.5375 52-53 25.162499999999998 24.6 24.0625 26.174999999999997 54-55 23.4625 25.5125 24.4 26.625 56-57 24.65 24.05 25.837500000000002 25.4625 58-59 24.925 24.45 24.0625 26.5625 60-61 24.7 24.7375 24.2625 26.3 62-63 24.081020255063766 24.406101525381345 25.11877969492373 26.39409852463116 64-65 25.056264066016503 24.781195298824706 24.50612653163291 25.656414103525883 66-67 25.218804701175294 24.10602650662666 24.031007751937985 26.644161040260066 68-69 25.30632658164541 23.95598899724931 26.069017254313575 24.668667166791696 70-71 25.056264066016503 24.74368592148037 24.831207801950487 25.36884221055264 72-73 25.743935983995996 24.36859214803701 24.118529632408105 25.76894223555889 74-75 25.143785946486624 24.36859214803701 24.956239059764943 25.531382845711427 76-77 25.63461297986745 25.159434788045516 24.746780042515944 24.45917218957109 78-79 25.850425212606304 23.3991995997999 24.84992496248124 25.900450225112557 80-81 25.050025012506254 24.73736868434217 24.012006003001503 26.20060030015007 82-83 24.81240620310155 24.474737368684345 23.799399699849925 26.91345672836418 84-85 24.574787393696848 25.72536268134067 23.111555777888945 26.588294147073537 86-87 25.850425212606304 25.52526263131566 23.524262131065534 25.100050025012504 88-89 26.038019009504755 24.524762381190595 24.049524762381193 25.387693846923458 90-91 25.278298936835526 24.690431519699814 23.952470293933708 26.07879924953096 92-93 25.344008006004504 25.281461095821868 24.093069802351764 25.281461095821868 94-95 24.931198398799097 25.23142356767576 23.667750813109834 26.169627220415308 96-97 24.94365138993238 23.40345604808415 24.993739043325817 26.659153518657654 98-99 25.063548551093035 24.466192170818506 24.758515505846468 25.71174377224199 100-101 27.265500794912562 10.28616852146264 30.015898251192368 32.432432432432435 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1.0 1 1.0 2 1.0 3 0.5 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.5 24 1.0 25 1.0 26 3.0 27 4.5 28 7.0 29 8.0 30 6.5 31 15.5 32 23.5 33 21.5 34 20.0 35 29.0 36 40.0 37 53.0 38 70.0 39 88.0 40 111.0 41 132.0 42 156.5 43 162.0 44 169.0 45 173.0 46 168.5 47 180.5 48 180.0 49 176.5 50 157.5 51 134.5 52 129.0 53 115.5 54 107.0 55 105.5 56 95.5 57 80.0 58 83.0 59 91.5 60 81.0 61 67.5 62 58.5 63 62.5 64 62.5 65 52.5 66 60.5 67 60.0 68 51.0 69 54.5 70 54.0 71 44.5 72 39.5 73 36.0 74 29.5 75 25.0 76 19.0 77 13.5 78 7.5 79 6.5 80 5.0 81 3.0 82 3.5 83 2.5 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 1.275 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 61 1.0 62 0.0 63 0.0 64 0.0 65 0.0 66 0.0 67 0.0 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 1.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 1.0 91 0.0 92 0.0 93 0.0 94 0.0 95 2.0 96 4.0 97 15.0 98 84.0 99 284.0 100 926.0 101 2682.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.8 #Duplication Level Percentage of deduplicated Percentage of total 1 91.80283224400871 84.275 2 7.516339869281046 13.8 3 0.6263616557734205 1.725 4 0.054466230936819175 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0125 80-81 0.0 0.0 0.0 0.0 0.025 82-83 0.0 0.0 0.0 0.0 0.025 84-85 0.0 0.0 0.0 0.0 0.025 86-87 0.0 0.0 0.0 0.0 0.025 88-89 0.0 0.0 0.0125 0.0 0.025 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 707700 spots for SRR21853531.sra Written 707700 spots for SRR21853531.sra Read 707700 spots for SRR21853531.sra Written 707700 spots for SRR21853531.sra Read 707700 spots for SRR21853531.sra Written 707700 spots for SRR21853531.sra Read 707700 spots for SRR21853531.sra Written 707700 spots for SRR21853531.sra Read 707700 spots for SRR21853531.sra Written 707700 spots for SRR21853531.sra Read 707700 spots for SRR21853531.sra Written 707700 spots for SRR21853531.sra Read 707700 spots for SRR21853531.sra Written 707700 spots for SRR21853531.sra Read 707700 spots for SRR21853531.sra Written 707700 spots for SRR21853531.sra Read 707700 spots for SRR21853531.sra Written 707700 spots for SRR21853531.sra Read 707700 spots for SRR21853531.sra Written 707700 spots for SRR21853531.sra Read 707700 spots for SRR21853531.sra Written 707700 spots for SRR21853531.sra Read 707700 spots for SRR21853531.sra Written 707700 spots for SRR21853531.sra Read 707700 spots for SRR21853531.sra Written 707700 spots for SRR21853531.sra Read 707700 spots for SRR21853531.sra Written 707700 spots for SRR21853531.sra Read 707700 spots for SRR21853531.sra Written 707700 spots for SRR21853531.sra Read 707700 spots for SRR21853531.sra Written 707700 spots for SRR21853531.sra Read 707700 spots for SRR21853531.sra Written 707700 spots for SRR21853531.sra Read 707700 spots for SRR21853531.sra Written 707700 spots for SRR21853531.sra Read 707708 spots for SRR21853531.sra Written 707708 spots for SRR21853531.sra Read 707700 spots for SRR21853531.sra Written 707700 spots for SRR21853531.sra SRR ids: ['SRR21853531.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_gqj8y1j_ SRR21853531.sra spots: 14154008 blocks: [[1, 707700], [707701, 1415400], [1415401, 2123100], [2123101, 2830800], [2830801, 3538500], [3538501, 4246200], [4246201, 4953900], [4953901, 5661600], [5661601, 6369300], [6369301, 7077000], [7077001, 7784700], [7784701, 8492400], [8492401, 9200100], [9200101, 9907800], [9907801, 10615500], [10615501, 11323200], [11323201, 12030900], [12030901, 12738600], [12738601, 13446300], [13446301, 14154008]] SRR21853531 file size 3810165 SRR21853531 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR21853531 SRR21853531_1.fastq Input file: SRR21853531_1.fastq trimmed: SRR21853531-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Fri Dec 6 17:13:05 2024 >> started Fri Dec 6 17:13:12 2024 >> done (7.926s) 14154008 reads processed; of these: 11 ( 0.00%) short reads filtered out after trimming by size control 13453 ( 0.10%) empty reads filtered out after trimming by size control 14140544 (99.90%) reads available; of these: 328 ( 0.00%) trimmed reads available after processing 14140216 (100.00%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 19 2 0.00% 20 0 0.00% 21 2 0.00% 22 0 0.00% 23 0 0.00% 24 3 0.00% 25 4 0.00% 26 0 0.00% 27 3 0.00% 28 5 0.00% 29 3 0.00% 30 1 0.00% 31 6 0.00% 32 6 0.00% 33 4 0.00% 34 5 0.00% 35 62 0.00% 36 54 0.00% 37 54 0.00% 38 86 0.00% 39 58 0.00% 40 72 0.00% 41 68 0.00% 42 72 0.00% 43 62 0.00% 44 77 0.00% 45 76 0.00% 46 81 0.00% 47 76 0.00% 48 73 0.00% 49 76 0.00% 50 95 0.00% 51 82 0.00% 52 83 0.00% 53 99 0.00% 54 87 0.00% 55 92 0.00% 56 106 0.00% 57 90 0.00% 58 96 0.00% 59 82 0.00% 60 118 0.00% 61 114 0.00% 62 114 0.00% 63 113 0.00% 64 113 0.00% 65 106 0.00% 66 120 0.00% 67 128 0.00% 68 126 0.00% 69 130 0.00% 70 116 0.00% 71 139 0.00% 72 128 0.00% 73 134 0.00% 74 134 0.00% 75 148 0.00% 76 138 0.00% 77 155 0.00% 78 144 0.00% 79 164 0.00% 80 173 0.00% 81 188 0.00% 82 173 0.00% 83 186 0.00% 84 191 0.00% 85 202 0.00% 86 206 0.00% 87 218 0.00% 88 209 0.00% 89 235 0.00% 90 318 0.00% 91 578 0.00% 92 285 0.00% 93 373 0.00% 94 919 0.01% 95 3441 0.02% 96 19738 0.14% 97 65878 0.47% 98 260129 1.84% 99 951892 6.73% 100 3223263 22.79% 101 9607164 67.94% 14140544 reads passed initial QC criterion=sequence-density sequence-density=0.25 sequence-density-rank=1 fanout-score=2.23 fanout-score-rank=20 prefix-density=0.29 prefix-fanout=1.9 sequence=GCTCCTTTCCAGGG criterion=fanout-score sequence-density=0.09 sequence-density-rank=16 fanout-score=187.96 fanout-score-rank=1 prefix-density=0.78 prefix-fanout=22.5 sequence=CGCCGCCGCCGC Started job on | Dec 06 17:13:33 Started mapping on | Dec 06 17:13:34 Finished on | Dec 06 17:13:52 Mapping speed, Million of reads per hour | 2828.11 Number of input reads | 14140544 Average input read length | 100 UNIQUE READS: Uniquely mapped reads number | 13520064 Uniquely mapped reads % | 95.61% Average mapped length | 100.23 Number of splices: Total | 4868356 Number of splices: Annotated (sjdb) | 4625520 Number of splices: GT/AG | 4801278 Number of splices: GC/AG | 57016 Number of splices: AT/AC | 2704 Number of splices: Non-canonical | 7358 Mismatch rate per base, % | 0.39% Deletion rate per base | 0.01% Deletion average length | 2.24 Insertion rate per base | 0.01% Insertion average length | 1.96 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 304423 % of reads mapped to multiple loci | 2.15% Number of reads mapped to too many loci | 131621 % of reads mapped to too many loci | 0.93% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.16% % of reads unmapped: other | 0.15% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 316057 316057 316057 N_multimapping 304423 304423 304423 N_noFeature 547420 6942581 6946268 N_ambiguous 205011 14315 13577 UnstrandedReadsAssigned:12767633 PositiveStrandReadsAssigned:6563168 NegativeStrandReadsAssigned:6560219 Dataset is classified unstranded MeadianReadLen=101 20thPercentileLength=100 echo kmer=95 SRR21853531 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR21853531-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,140,544 reads, 13,110,052 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,208 rounds 52973 SRR21853531.ke.tsv 35125 SRR21853531.se.tsv 88098 total ==> SRR21853531.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 0 0 PNS24247 1044 945 37.4015 5.23387 PNS24249 1928 1829 140.426 10.1531 PNS24246 1044 945 37.4015 5.23387 PNS24248 1044 945 37.4015 5.23387 PNS24244 1471 1372 25.3698 2.44528 PNS24243 293 194 6 4.08993 KQK14069 1603 1504 1330.22 116.961 KQK14071 474 375 185.614 65.4552 ==> SRR21853531.se.tsv <== BRADI_1g14170v3 1646 BRADI_1g53295v3 82 BRADI_1g59795v3 184 BRADI_1g07683v3 0 BRADI_1g00485v3 53 BRADI_1g20270v3 1484 BRADI_1g74790v3 123 BRADI_1g09890v3 4 BRADI_1g77505v3 173 BRADI_1g48960v3 0 SRR21853531 completed mapping pipeline successfully