Starting /dee2/code/volunteer_pipeline.sh SRR21853532 current disk space = 1550625894400 free memory = 1598414204 SRR21853532 SRAfilesize 043da7b28cc7ef1c911f5fab391b0c21 SRR21853532.sra SRR21853532.sra file validated SRR21853532 is single end SRR21853532 is conventional basespace SRR21853532 read1 length is 95-101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR21853532_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 95-101 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.442 37.0 37.0 37.0 37.0 37.0 2 35.8005 37.0 37.0 37.0 37.0 37.0 3 36.059 37.0 37.0 37.0 37.0 37.0 4 35.8625 37.0 37.0 37.0 37.0 37.0 5 36.1035 37.0 37.0 37.0 37.0 37.0 6 36.0225 37.0 37.0 37.0 37.0 37.0 7 35.9685 37.0 37.0 37.0 37.0 37.0 8 36.063 37.0 37.0 37.0 37.0 37.0 9 35.933 37.0 37.0 37.0 37.0 37.0 10-11 36.0865 37.0 37.0 37.0 37.0 37.0 12-13 36.0715 37.0 37.0 37.0 37.0 37.0 14-15 35.967 37.0 37.0 37.0 37.0 37.0 16-17 35.96275 37.0 37.0 37.0 37.0 37.0 18-19 35.894999999999996 37.0 37.0 37.0 37.0 37.0 20-21 35.885999999999996 37.0 37.0 37.0 37.0 37.0 22-23 35.85775 37.0 37.0 37.0 37.0 37.0 24-25 35.920500000000004 37.0 37.0 37.0 37.0 37.0 26-27 35.7615 37.0 37.0 37.0 37.0 37.0 28-29 35.72325 37.0 37.0 37.0 37.0 37.0 30-31 35.697500000000005 37.0 37.0 37.0 37.0 37.0 32-33 35.730000000000004 37.0 37.0 37.0 37.0 37.0 34-35 35.804 37.0 37.0 37.0 37.0 37.0 36-37 35.73175 37.0 37.0 37.0 37.0 37.0 38-39 35.76 37.0 37.0 37.0 37.0 37.0 40-41 35.696749999999994 37.0 37.0 37.0 37.0 37.0 42-43 35.74275 37.0 37.0 37.0 37.0 37.0 44-45 35.695 37.0 37.0 37.0 37.0 37.0 46-47 35.67225 37.0 37.0 37.0 37.0 37.0 48-49 35.670500000000004 37.0 37.0 37.0 37.0 37.0 50-51 35.679500000000004 37.0 37.0 37.0 37.0 37.0 52-53 35.6495 37.0 37.0 37.0 37.0 37.0 54-55 35.58325 37.0 37.0 37.0 37.0 37.0 56-57 35.655249999999995 37.0 37.0 37.0 37.0 37.0 58-59 35.6025 37.0 37.0 37.0 37.0 37.0 60-61 35.603750000000005 37.0 37.0 37.0 37.0 37.0 62-63 35.667 37.0 37.0 37.0 37.0 37.0 64-65 35.53875 37.0 37.0 37.0 37.0 37.0 66-67 35.611000000000004 37.0 37.0 37.0 37.0 37.0 68-69 35.62575 37.0 37.0 37.0 37.0 37.0 70-71 35.66675 37.0 37.0 37.0 37.0 37.0 72-73 35.582499999999996 37.0 37.0 37.0 37.0 37.0 74-75 35.48225 37.0 37.0 37.0 37.0 37.0 76-77 35.504999999999995 37.0 37.0 37.0 37.0 37.0 78-79 35.552499999999995 37.0 37.0 37.0 37.0 37.0 80-81 35.44125 37.0 37.0 37.0 37.0 37.0 82-83 35.55975 37.0 37.0 37.0 37.0 37.0 84-85 35.483000000000004 37.0 37.0 37.0 37.0 37.0 86-87 35.342 37.0 37.0 37.0 37.0 37.0 88-89 35.329750000000004 37.0 37.0 37.0 37.0 37.0 90-91 35.429249999999996 37.0 37.0 37.0 37.0 37.0 92-93 35.36325 37.0 37.0 37.0 37.0 37.0 94-95 35.341499999999996 37.0 37.0 37.0 37.0 37.0 96-97 35.39703719157446 37.0 37.0 37.0 37.0 37.0 98-99 35.31143999203329 37.0 37.0 37.0 37.0 37.0 100-101 35.23562162730798 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 2101 1 0.0 2101 2 0.0 2101 3 0.0 2101 4 0.0 2101 5 0.0 2101 6 0.0 2101 7 0.0 2101 8 0.0 2101 9 0.0 2101 10-11 0.0 2101 12-13 0.0 2101 14-15 0.0 2101 16-17 0.0 2101 18-19 0.0 2101 20-21 0.0 2101 22-23 0.0 2101 24-25 0.0 2101 26-27 0.0 2101 28-29 0.0 2101 30-31 0.0 2101 32-33 0.0 2101 34-35 0.0 2101 36-37 0.0 2101 38-39 0.0 2101 40-41 0.0 2101 42-43 0.0 2101 44-45 0.0 2101 46-47 0.0 2101 48-49 0.0 2101 50-51 0.0 2101 52-53 0.0 2101 54-55 0.0 2101 56-57 0.0 2101 58-59 0.0 2101 60-61 0.0 2101 62-63 0.0 2101 64-65 0.0 2101 66-67 0.0 2101 68-69 0.0 2101 70-71 0.0 2101 72-73 0.0 2101 74-75 0.0 2101 76-77 0.0 2101 78-79 0.0 2101 80-81 0.0 2101 82-83 0.0 2101 84-85 0.0 2101 86-87 0.0 2101 88-89 0.0 2101 90-91 0.0 2101 92-93 0.0 2101 94-95 0.0 2101 96-97 0.0 2101 98-99 0.0 2101 100-101 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 19 1.0 20 2.0 21 1.0 22 2.0 23 3.0 24 4.0 25 6.0 26 16.0 27 21.0 28 37.0 29 45.0 30 61.0 31 94.0 32 115.0 33 152.0 34 225.0 35 463.0 36 2188.0 37 564.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 26.75 14.2 18.825 40.225 2 25.124999999999996 19.125 30.225 25.525 3 25.525 23.575 25.3 25.6 4 26.325 28.499999999999996 19.575 25.6 5 27.175 29.95 20.474999999999998 22.400000000000002 6 20.974999999999998 34.175 21.9 22.95 7 19.0 17.5 39.85 23.65 8 21.65 22.3 26.375 29.675 9 22.3 20.974999999999998 28.525 28.199999999999996 10-11 25.9625 28.95 20.65 24.4375 12-13 23.150000000000002 23.3875 26.474999999999998 26.987499999999997 14-15 24.075 25.0125 25.387500000000003 25.525 16-17 24.0625 25.1875 25.2625 25.4875 18-19 23.8875 25.937500000000004 25.5625 24.6125 20-21 24.099999999999998 25.025 25.174999999999997 25.7 22-23 23.7 25.887500000000003 25.587500000000002 24.825 24-25 23.4125 25.9625 24.75 25.874999999999996 26-27 24.8125 26.200000000000003 24.6 24.3875 28-29 23.45 26.400000000000002 25.5625 24.587500000000002 30-31 23.6125 26.400000000000002 24.762500000000003 25.224999999999998 32-33 24.8 25.087500000000002 25.55 24.5625 34-35 24.5125 25.7625 24.3 25.424999999999997 36-37 23.825 25.4625 26.075 24.637500000000003 38-39 24.6875 25.137500000000003 24.15 26.025 40-41 23.849999999999998 25.674999999999997 25.2625 25.2125 42-43 24.4125 24.525 25.8625 25.2 44-45 24.75 25.8 25.137500000000003 24.3125 46-47 24.5 25.15 25.474999999999998 24.875 48-49 24.0625 24.7875 25.387500000000003 25.7625 50-51 24.7 24.3 25.7 25.3 52-53 24.3 24.6125 26.337500000000002 24.75 54-55 24.2625 26.224999999999998 25.2375 24.275 56-57 24.075 26.025 24.349999999999998 25.55 58-59 25.4 25.374999999999996 25.2875 23.9375 60-61 24.3 25.387500000000003 25.362499999999997 24.95 62-63 24.212500000000002 24.75 25.650000000000002 25.387500000000003 64-65 23.8625 26.775 25.8 23.5625 66-67 23.7875 25.174999999999997 25.3 25.7375 68-69 25.087500000000002 24.75 25.374999999999996 24.7875 70-71 24.925 25.3 25.35 24.425 72-73 24.1125 25.7125 25.124999999999996 25.05 74-75 25.224999999999998 24.275 24.9 25.6 76-77 24.275 25.162499999999998 25.2 25.362499999999997 78-79 23.674999999999997 26.0125 24.55 25.7625 80-81 24.25 26.7625 24.4125 24.575 82-83 25.0375 25.387500000000003 24.775 24.8 84-85 24.2625 25.474999999999998 25.4 24.8625 86-87 24.125 24.962500000000002 25.85 25.0625 88-89 24.55 24.7875 25.837500000000002 24.825 90-91 24.4125 25.25 25.5625 24.775 92-93 24.2 26.1125 25.4375 24.25 94-95 23.9875 25.85 24.5 25.662499999999998 96-97 24.04857285928893 25.037556334501755 26.139208813219827 24.774661992989483 98-99 25.564864178725564 22.88651942117289 26.415333841076418 25.133282559025133 100-101 25.198098256735342 11.521394611727418 32.31378763866878 30.96671949286846 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 2.0 1 1.5 2 1.0 3 0.5 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 0.5 21 0.5 22 0.5 23 1.0 24 1.5 25 1.0 26 1.0 27 2.0 28 3.5 29 9.0 30 16.5 31 18.0 32 19.0 33 26.0 34 28.0 35 33.5 36 55.5 37 77.0 38 78.5 39 87.0 40 120.5 41 140.5 42 153.5 43 192.0 44 203.0 45 181.5 46 197.5 47 199.5 48 173.0 49 177.5 50 160.5 51 140.5 52 125.5 53 114.0 54 105.5 55 93.0 56 106.5 57 103.0 58 81.5 59 82.5 60 75.5 61 54.5 62 56.5 63 53.0 64 45.0 65 46.0 66 44.5 67 42.5 68 41.0 69 39.5 70 32.5 71 25.0 72 25.0 73 25.0 74 18.5 75 9.5 76 10.0 77 12.5 78 14.5 79 9.5 80 2.5 81 1.0 82 0.5 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.5 96 0.5 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 95 3.0 96 6.0 97 18.0 98 68.0 99 281.0 100 938.0 101 2686.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.45 #Duplication Level Percentage of deduplicated Percentage of total 1 92.53650621957816 85.55 2 6.7874526771227695 12.55 3 0.6489994591671173 1.7999999999999998 4 0.027041644131963225 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 275244 spots for SRR21853532.sra Written 275244 spots for SRR21853532.sra Read 275246 spots for SRR21853532.sra Written 275246 spots for SRR21853532.sra Read 275244 spots for SRR21853532.sra Written 275244 spots for SRR21853532.sra Read 275244 spots for SRR21853532.sra Written 275244 spots for SRR21853532.sra Read 275244 spots for SRR21853532.sra Written 275244 spots for SRR21853532.sra Read 275244 spots for SRR21853532.sra Written 275244 spots for SRR21853532.sra Read 275244 spots for SRR21853532.sra Written 275244 spots for SRR21853532.sra Read 275244 spots for SRR21853532.sra Written 275244 spots for SRR21853532.sra Read 275244 spots for SRR21853532.sra Written 275244 spots for SRR21853532.sra Read 275244 spots for SRR21853532.sra Written 275244 spots for SRR21853532.sra Read 275244 spots for SRR21853532.sra Written 275244 spots for SRR21853532.sra Read 275244 spots for SRR21853532.sra Written 275244 spots for SRR21853532.sra Read 275244 spots for SRR21853532.sra Written 275244 spots for SRR21853532.sra Read 275244 spots for SRR21853532.sra Written 275244 spots for SRR21853532.sra Read 275244 spots for SRR21853532.sra Written 275244 spots for SRR21853532.sra Read 275244 spots for SRR21853532.sra Written 275244 spots for SRR21853532.sra Read 275244 spots for SRR21853532.sra Written 275244 spots for SRR21853532.sra Read 275244 spots for SRR21853532.sra Written 275244 spots for SRR21853532.sra Read 275244 spots for SRR21853532.sra Written 275244 spots for SRR21853532.sra Read 275244 spots for SRR21853532.sra Written 275244 spots for SRR21853532.sra SRR ids: ['SRR21853532.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_967ztt46 SRR21853532.sra spots: 5504882 blocks: [[1, 275244], [275245, 550488], [550489, 825732], [825733, 1100976], [1100977, 1376220], [1376221, 1651464], [1651465, 1926708], [1926709, 2201952], [2201953, 2477196], [2477197, 2752440], [2752441, 3027684], [3027685, 3302928], [3302929, 3578172], [3578173, 3853416], [3853417, 4128660], [4128661, 4403904], [4403905, 4679148], [4679149, 4954392], [4954393, 5229636], [5229637, 5504882]] SRR21853532 file size 1479598 SRR21853532 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR21853532 SRR21853532_1.fastq Input file: SRR21853532_1.fastq trimmed: SRR21853532-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Fri Dec 6 17:13:55 2024 >> started Fri Dec 6 17:13:58 2024 >> done (3.089s) 5504882 reads processed; of these: 1 ( 0.00%) short reads filtered out after trimming by size control 8487 ( 0.15%) empty reads filtered out after trimming by size control 5496394 (99.85%) reads available; of these: 185 ( 0.00%) trimmed reads available after processing 5496209 (100.00%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 26 1 0.00% 27 0 0.00% 28 0 0.00% 29 2 0.00% 30 0 0.00% 31 5 0.00% 32 3 0.00% 33 8 0.00% 34 2 0.00% 35 9 0.00% 36 14 0.00% 37 18 0.00% 38 12 0.00% 39 15 0.00% 40 13 0.00% 41 14 0.00% 42 6 0.00% 43 12 0.00% 44 16 0.00% 45 10 0.00% 46 12 0.00% 47 13 0.00% 48 18 0.00% 49 13 0.00% 50 23 0.00% 51 16 0.00% 52 10 0.00% 53 12 0.00% 54 13 0.00% 55 13 0.00% 56 14 0.00% 57 21 0.00% 58 21 0.00% 59 22 0.00% 60 34 0.00% 61 27 0.00% 62 25 0.00% 63 27 0.00% 64 24 0.00% 65 20 0.00% 66 40 0.00% 67 18 0.00% 68 40 0.00% 69 32 0.00% 70 36 0.00% 71 39 0.00% 72 43 0.00% 73 28 0.00% 74 38 0.00% 75 29 0.00% 76 32 0.00% 77 37 0.00% 78 32 0.00% 79 32 0.00% 80 36 0.00% 81 47 0.00% 82 31 0.00% 83 38 0.00% 84 45 0.00% 85 46 0.00% 86 48 0.00% 87 44 0.00% 88 42 0.00% 89 65 0.00% 90 87 0.00% 91 259 0.00% 92 96 0.00% 93 170 0.00% 94 317 0.01% 95 1137 0.02% 96 7271 0.13% 97 27183 0.49% 98 102293 1.86% 99 370607 6.74% 100 1306535 23.77% 101 3678983 66.93% 5496394 reads passed initial QC criterion=sequence-density sequence-density=0.21 sequence-density-rank=1 fanout-score=1.98 fanout-score-rank=29 prefix-density=0.20 prefix-fanout=2.0 sequence=CCGTCAATTCCTTT criterion=fanout-score sequence-density=0.07 sequence-density-rank=19 fanout-score=191.93 fanout-score-rank=1 prefix-density=0.55 prefix-fanout=23.3 sequence=CGCCGCCGCCGC Started job on | Dec 06 17:14:15 Started mapping on | Dec 06 17:14:15 Finished on | Dec 06 17:14:27 Mapping speed, Million of reads per hour | 1648.92 Number of input reads | 5496394 Average input read length | 100 UNIQUE READS: Uniquely mapped reads number | 4802166 Uniquely mapped reads % | 87.37% Average mapped length | 100.27 Number of splices: Total | 1811671 Number of splices: Annotated (sjdb) | 1713961 Number of splices: GT/AG | 1787400 Number of splices: GC/AG | 21406 Number of splices: AT/AC | 1104 Number of splices: Non-canonical | 1761 Mismatch rate per base, % | 0.25% Deletion rate per base | 0.00% Deletion average length | 1.54 Insertion rate per base | 0.00% Insertion average length | 1.31 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 265458 % of reads mapped to multiple loci | 4.83% Number of reads mapped to too many loci | 311444 % of reads mapped to too many loci | 5.67% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.29% % of reads unmapped: other | 0.85% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 428770 428770 428770 N_multimapping 265458 265458 265458 N_noFeature 338953 2582631 2497903 N_ambiguous 69813 4513 5146 UnstrandedReadsAssigned:4393400 PositiveStrandReadsAssigned:2215022 NegativeStrandReadsAssigned:2299117 Dataset is classified unstranded MeadianReadLen=101 20thPercentileLength=100 echo kmer=95 SRR21853532 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR21853532-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 5,496,394 reads, 4,572,230 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,016 rounds 52973 SRR21853532.ke.tsv 35125 SRR21853532.se.tsv 88098 total ==> SRR21853532.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 0 0 PNS24247 1044 945 11.5984 4.87824 PNS24249 1928 1829 26.817 5.82765 PNS24246 1044 945 11.5984 4.87824 PNS24248 1044 945 11.5984 4.87824 PNS24244 1471 1372 11.3879 3.29903 PNS24243 293 194 11 22.5366 KQK14069 1603 1504 974.141 257.437 KQK14071 474 375 23.0343 24.4141 ==> SRR21853532.se.tsv <== BRADI_1g14170v3 1045 BRADI_1g53295v3 28 BRADI_1g59795v3 73 BRADI_1g07683v3 0 BRADI_1g00485v3 17 BRADI_1g20270v3 190 BRADI_1g74790v3 49 BRADI_1g09890v3 0 BRADI_1g77505v3 71 BRADI_1g48960v3 0 SRR21853532 completed mapping pipeline successfully