Starting /dee2/code/volunteer_pipeline.sh SRR21853533 current disk space = 1550640852992 free memory = 1326024536 SRR21853533 SRAfilesize 13d0638f3f8fa5ed8468f38054d68fdb SRR21853533.sra SRR21853533.sra file validated SRR21853533 is single end SRR21853533 is conventional basespace SRR21853533 read1 length is 35-101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR21853533_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 35-101 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.274 37.0 37.0 37.0 37.0 37.0 2 35.1985 37.0 37.0 37.0 37.0 37.0 3 35.7285 37.0 37.0 37.0 37.0 37.0 4 35.842 37.0 37.0 37.0 37.0 37.0 5 35.8325 37.0 37.0 37.0 37.0 37.0 6 35.7555 37.0 37.0 37.0 37.0 37.0 7 35.791 37.0 37.0 37.0 37.0 37.0 8 35.8715 37.0 37.0 37.0 37.0 37.0 9 35.819 37.0 37.0 37.0 37.0 37.0 10-11 35.89025 37.0 37.0 37.0 37.0 37.0 12-13 35.96325 37.0 37.0 37.0 37.0 37.0 14-15 35.78775 37.0 37.0 37.0 37.0 37.0 16-17 35.90025 37.0 37.0 37.0 37.0 37.0 18-19 35.75575 37.0 37.0 37.0 37.0 37.0 20-21 35.92575 37.0 37.0 37.0 37.0 37.0 22-23 35.92 37.0 37.0 37.0 37.0 37.0 24-25 35.810249999999996 37.0 37.0 37.0 37.0 37.0 26-27 35.71275 37.0 37.0 37.0 37.0 37.0 28-29 35.789249999999996 37.0 37.0 37.0 37.0 37.0 30-31 35.76325 37.0 37.0 37.0 37.0 37.0 32-33 35.63575 37.0 37.0 37.0 37.0 37.0 34-35 35.635 37.0 37.0 37.0 37.0 37.0 36-37 35.65432716358179 37.0 37.0 37.0 37.0 37.0 38-39 35.62681340670335 37.0 37.0 37.0 37.0 37.0 40-41 35.610555277638824 37.0 37.0 37.0 37.0 37.0 42-43 35.6048024012006 37.0 37.0 37.0 37.0 37.0 44-45 35.571103665417894 37.0 37.0 37.0 37.0 37.0 46-47 35.529397047785835 37.0 37.0 37.0 37.0 37.0 48-49 35.54240680510382 37.0 37.0 37.0 37.0 37.0 50-51 35.58794095571679 37.0 37.0 37.0 37.0 37.0 52-53 35.56117087815862 37.0 37.0 37.0 37.0 37.0 54-55 35.57267950963222 37.0 37.0 37.0 37.0 37.0 56-57 35.46209657242932 37.0 37.0 37.0 37.0 37.0 58-59 35.454090567925945 37.0 37.0 37.0 37.0 37.0 60-61 35.5093820365274 37.0 37.0 37.0 37.0 37.0 62-63 35.47935951963973 37.0 37.0 37.0 37.0 37.0 64-65 35.56117087815862 37.0 37.0 37.0 37.0 37.0 66-67 35.32699524643483 37.0 37.0 37.0 31.0 37.0 68-69 35.39779834876157 37.0 37.0 37.0 37.0 37.0 70-71 35.40080060045034 37.0 37.0 37.0 31.0 37.0 72-73 35.29997498123593 37.0 37.0 37.0 31.0 37.0 74-75 35.42131598699024 37.0 37.0 37.0 37.0 37.0 76-77 35.39304478358769 37.0 37.0 37.0 37.0 37.0 78-79 35.29597197898424 37.0 37.0 37.0 31.0 37.0 80-81 35.461145972091686 37.0 37.0 37.0 37.0 37.0 82-83 35.462212212212215 37.0 37.0 37.0 37.0 37.0 84-85 35.29404404404404 37.0 37.0 37.0 31.0 37.0 86-87 35.34284284284284 37.0 37.0 37.0 37.0 37.0 88-89 35.3998998998999 37.0 37.0 37.0 37.0 37.0 90-91 35.34939451341204 37.0 37.0 37.0 37.0 37.0 92-93 35.36846057571965 37.0 37.0 37.0 31.0 37.0 94-95 35.360951188986235 37.0 37.0 37.0 37.0 37.0 96-97 35.251300553236476 37.0 37.0 37.0 37.0 37.0 98-99 35.21400761332457 37.0 37.0 37.0 31.0 37.0 100-101 35.26091964695627 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100-101 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 2.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 4.0 24 3.0 25 5.0 26 15.0 27 25.0 28 36.0 29 56.0 30 76.0 31 92.0 32 128.0 33 189.0 34 251.0 35 495.0 36 2162.0 37 461.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 28.66433216608304 13.606803401700851 17.358679339669834 40.37018509254627 2 24.030226700251887 21.007556675062972 29.974811083123427 24.987405541561714 3 26.013006503251624 23.81190595297649 23.56178089044522 26.613306653326664 4 25.987993996998497 28.68934467233617 19.534767383691847 25.78789394697349 5 27.213606803401703 30.29014507253627 22.136068034017008 20.36018009004502 6 21.585792896448226 34.61730865432716 21.38569284642321 22.411205602801402 7 20.485242621310658 17.58379189594797 39.694847423711856 22.236118059029515 8 21.210605302651324 22.56128064032016 26.013006503251624 30.21510755377689 9 21.885942971485743 20.460230115057527 29.264632316158078 28.38919459729865 10-11 24.662331165582792 28.526763381690845 21.060530265132567 25.7503751875938 12-13 23.08654327163582 22.911455727863935 27.37618809404702 26.625812906453227 14-15 23.36168084042021 23.911955977988995 27.01350675337669 25.71285642821411 16-17 23.936968484242122 24.012006003001503 25.812906453226613 26.23811905952976 18-19 23.224112056028016 26.32566283141571 25.325162581290645 25.125062531265634 20-21 25.11255627813907 24.437218609304654 24.81240620310155 25.63781890945473 22-23 24.81240620310155 25.48774387193597 25.67533766883442 24.024512256128062 24-25 23.08654327163582 24.974987493746873 25.78789394697349 26.150575287643825 26-27 24.312156078039017 25.275137568784395 26.500750375187593 23.911955977988995 28-29 24.16208104052026 25.937968984492244 25.337668834417208 24.562281140570285 30-31 23.774387193596798 25.587793896948476 25.250125062531264 25.387693846923458 32-33 23.499249624812407 25.012506253126567 25.18759379689845 26.300650325162582 34-35 23.62431215607804 25.86293146573287 24.974987493746873 25.53776888444222 36-37 25.63781890945473 24.462231115557778 25.550275137568786 24.349674837418707 38-39 24.574787393696848 25.3751875937969 25.200100050025014 24.84992496248124 40-41 24.149574787393696 25.68784392196098 24.824912456228116 25.337668834417208 42-43 24.562281140570285 25.68784392196098 24.77488744372186 24.974987493746873 44-45 24.577861163227016 25.61601000625391 24.940587867417136 24.86554096310194 46-47 24.706029522141606 26.1195896922692 24.243182386790092 24.931198398799097 48-49 25.519139354515886 25.469101826369776 24.756067050287715 24.25569176882662 50-51 24.168126094570926 25.494120590442833 24.806104578433825 25.531648736552416 52-53 25.106329747310486 24.093069802351764 24.605954465849386 26.194645984488368 54-55 24.568426319739807 25.356517388041034 24.468351263447584 25.606705028771582 56-57 23.29246935201401 25.143857893420062 25.544158118588946 26.019514635976982 58-59 24.280710532899676 26.13209907430573 24.893670252689517 24.69352014010508 60-61 24.96872654490868 24.956217162872154 25.11883912934701 24.956217162872154 62-63 24.530898173630224 25.531648736552416 24.856142106579934 25.081310983237426 64-65 25.631723792844635 25.65674255691769 24.093069802351764 24.618463847885916 66-67 24.78108581436077 25.544158118588946 25.39404553415061 24.280710532899676 68-69 23.44258193645234 25.719289467100324 25.2064048036027 25.631723792844635 70-71 23.68026019514636 25.39404553415061 24.756067050287715 26.169627220415308 72-73 24.73104828621466 25.181386039529645 25.30647985989492 24.78108581436077 74-75 25.243932949712285 24.706029522141606 25.01876407305479 25.03127345509132 76-77 25.39404553415061 25.25644233174881 25.181386039529645 24.168126094570926 78-79 24.718538904178132 25.168876657493122 25.143857893420062 24.96872654490868 80-81 23.72075566120355 25.059426998623795 25.622419617165022 25.59739772300763 82-83 23.823823823823822 25.462962962962965 25.06256256256256 25.650650650650654 84-85 23.71121121121121 25.58808808808809 25.05005005005005 25.650650650650654 86-87 25.0 25.25025025025025 25.13763763763764 24.61211211211211 88-89 24.512012012012015 24.737237237237235 25.312812812812812 25.43793793793794 90-91 24.727818796145666 25.040670754598928 25.929170316606182 24.30234013264923 92-93 24.380475594493117 24.96871088861076 25.269086357947433 25.381727158948685 94-95 24.593241551939926 25.15644555694618 25.619524405506883 24.63078848560701 96-97 24.0511086057873 25.153451083552547 25.566829512714516 25.228610797945635 98-99 24.0540196203338 24.856669639444515 25.773983946999618 25.315326793222066 100-101 25.258141382049242 11.723590150913424 31.660047656870532 31.3582208101668 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 2.0 1 1.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.0 20 0.0 21 0.5 22 1.5 23 2.0 24 1.0 25 0.5 26 1.5 27 2.5 28 3.5 29 6.5 30 10.5 31 16.5 32 20.0 33 18.5 34 28.5 35 45.0 36 49.5 37 64.0 38 84.0 39 101.5 40 115.0 41 130.5 42 158.5 43 164.0 44 178.0 45 185.0 46 191.5 47 205.0 48 191.5 49 180.0 50 168.5 51 160.5 52 146.5 53 128.0 54 112.5 55 93.0 56 88.0 57 92.0 58 87.5 59 77.5 60 71.5 61 67.5 62 55.5 63 46.5 64 45.0 65 46.0 66 46.0 67 45.0 68 48.0 69 41.0 70 34.5 71 32.0 72 22.0 73 17.0 74 17.0 75 13.0 76 10.0 77 11.0 78 7.0 79 5.5 80 5.0 81 2.5 82 2.0 83 1.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.05 2 0.75 3 0.05 4 0.05 5 0.05 6 0.05 7 0.05 8 0.05 9 0.05 10-11 0.05 12-13 0.05 14-15 0.05 16-17 0.05 18-19 0.05 20-21 0.05 22-23 0.05 24-25 0.05 26-27 0.05 28-29 0.05 30-31 0.05 32-33 0.05 34-35 0.05 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 34-35 2.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 1.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 1.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 1.0 92-93 0.0 94-95 1.0 96-97 33.0 98-99 351.0 100-101 3610.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.27499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 92.14305066377675 85.02499999999999 2 7.39636954754809 13.65 3 0.40639393118396094 1.125 4 0.0541858574911948 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.025 74-75 0.0 0.0 0.0 0.0 0.025 76-77 0.0 0.0 0.0 0.0 0.025 78-79 0.0 0.0 0.0 0.0 0.025 80-81 0.0 0.0 0.0 0.0 0.025 82-83 0.0 0.0 0.0 0.0 0.025 84-85 0.0 0.0 0.0 0.0 0.025 86-87 0.0 0.0 0.0 0.0 0.025 88-89 0.0 0.0 0.0 0.0 0.025 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 692777 spots for SRR21853533.sra Written 692777 spots for SRR21853533.sra Read 692777 spots for SRR21853533.sra Written 692777 spots for SRR21853533.sra Read 692777 spots for SRR21853533.sra Written 692777 spots for SRR21853533.sra Read 692777 spots for SRR21853533.sra Written 692777 spots for SRR21853533.sra Read 692777 spots for SRR21853533.sra Written 692777 spots for SRR21853533.sra Read 692777 spots for SRR21853533.sra Written 692777 spots for SRR21853533.sra Read 692777 spots for SRR21853533.sra Written 692777 spots for SRR21853533.sra Read 692777 spots for SRR21853533.sra Written 692777 spots for SRR21853533.sra Read 692777 spots for SRR21853533.sra Written 692777 spots for SRR21853533.sra Read 692777 spots for SRR21853533.sra Written 692777 spots for SRR21853533.sra Read 692777 spots for SRR21853533.sra Written 692777 spots for SRR21853533.sra Read 692786 spots for SRR21853533.sra Written 692786 spots for SRR21853533.sra Read 692777 spots for SRR21853533.sra Written 692777 spots for SRR21853533.sra Read 692777 spots for SRR21853533.sra Written 692777 spots for SRR21853533.sra Read 692777 spots for SRR21853533.sra Written 692777 spots for SRR21853533.sra Read 692777 spots for SRR21853533.sra Written 692777 spots for SRR21853533.sra Read 692777 spots for SRR21853533.sra Written 692777 spots for SRR21853533.sra Read 692777 spots for SRR21853533.sra Written 692777 spots for SRR21853533.sra Read 692777 spots for SRR21853533.sra Written 692777 spots for SRR21853533.sra Read 692777 spots for SRR21853533.sra Written 692777 spots for SRR21853533.sra SRR ids: ['SRR21853533.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_khv1jk50 SRR21853533.sra spots: 13855549 blocks: [[1, 692777], [692778, 1385554], [1385555, 2078331], [2078332, 2771108], [2771109, 3463885], [3463886, 4156662], [4156663, 4849439], [4849440, 5542216], [5542217, 6234993], [6234994, 6927770], [6927771, 7620547], [7620548, 8313324], [8313325, 9006101], [9006102, 9698878], [9698879, 10391655], [10391656, 11084432], [11084433, 11777209], [11777210, 12469986], [12469987, 13162763], [13162764, 13855549]] SRR21853533 file size 3729192 SRR21853533 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR21853533 SRR21853533_1.fastq Input file: SRR21853533_1.fastq trimmed: SRR21853533-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Fri Dec 6 17:19:11 2024 >> started Fri Dec 6 17:19:18 2024 >> done (7.189s) 13855549 reads processed; of these: 14 ( 0.00%) short reads filtered out after trimming by size control 31211 ( 0.23%) empty reads filtered out after trimming by size control 13824324 (99.77%) reads available; of these: 325 ( 0.00%) trimmed reads available after processing 13823999 (100.00%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 20 1 0.00% 21 0 0.00% 22 2 0.00% 23 1 0.00% 24 2 0.00% 25 3 0.00% 26 4 0.00% 27 3 0.00% 28 4 0.00% 29 8 0.00% 30 7 0.00% 31 2 0.00% 32 2 0.00% 33 8 0.00% 34 6 0.00% 35 46 0.00% 36 65 0.00% 37 49 0.00% 38 94 0.00% 39 62 0.00% 40 68 0.00% 41 76 0.00% 42 68 0.00% 43 62 0.00% 44 82 0.00% 45 81 0.00% 46 93 0.00% 47 98 0.00% 48 93 0.00% 49 96 0.00% 50 91 0.00% 51 95 0.00% 52 101 0.00% 53 95 0.00% 54 95 0.00% 55 104 0.00% 56 104 0.00% 57 138 0.00% 58 112 0.00% 59 128 0.00% 60 120 0.00% 61 117 0.00% 62 123 0.00% 63 130 0.00% 64 107 0.00% 65 124 0.00% 66 147 0.00% 67 131 0.00% 68 148 0.00% 69 140 0.00% 70 136 0.00% 71 156 0.00% 72 143 0.00% 73 187 0.00% 74 177 0.00% 75 187 0.00% 76 158 0.00% 77 178 0.00% 78 193 0.00% 79 191 0.00% 80 205 0.00% 81 186 0.00% 82 221 0.00% 83 224 0.00% 84 214 0.00% 85 219 0.00% 86 220 0.00% 87 217 0.00% 88 253 0.00% 89 307 0.00% 90 400 0.00% 91 860 0.01% 92 358 0.00% 93 503 0.00% 94 842 0.01% 95 3042 0.02% 96 18555 0.13% 97 68139 0.49% 98 257890 1.87% 99 931367 6.74% 100 3279087 23.72% 101 9255773 66.95% 13824324 reads passed initial QC criterion=sequence-density sequence-density=0.21 sequence-density-rank=1 fanout-score=1.97 fanout-score-rank=30 prefix-density=0.20 prefix-fanout=2.0 sequence=CCGTCAATTCCTTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=33 fanout-score=9.87 fanout-score-rank=1 prefix-density=0.02 prefix-fanout=3.0 sequence=GACCAAGGAGTCTGACATGCGTGCGAGTCGACGGGTTCTGAAACCTGGGATGCGCAAGGAAGCTGACGAGCGGGAGGCCCTCACGGGCCGCACCGCTGGCCGACCCTGATCTTCTGTGAAGGGTTCGAGTTGGAGCACGCCTGTCGGGACCCGAAAGATGGTGAACTATGCCTGAGCGGGGCGAAGCCAGAGGAA Started job on | Dec 06 17:19:43 Started mapping on | Dec 06 17:19:43 Finished on | Dec 06 17:20:02 Mapping speed, Million of reads per hour | 2619.35 Number of input reads | 13824324 Average input read length | 100 UNIQUE READS: Uniquely mapped reads number | 12117275 Uniquely mapped reads % | 87.65% Average mapped length | 100.26 Number of splices: Total | 4594817 Number of splices: Annotated (sjdb) | 4345832 Number of splices: GT/AG | 4533395 Number of splices: GC/AG | 53566 Number of splices: AT/AC | 2847 Number of splices: Non-canonical | 5009 Mismatch rate per base, % | 0.29% Deletion rate per base | 0.00% Deletion average length | 1.60 Insertion rate per base | 0.00% Insertion average length | 1.32 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 670311 % of reads mapped to multiple loci | 4.85% Number of reads mapped to too many loci | 749505 % of reads mapped to too many loci | 5.42% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.21% % of reads unmapped: other | 0.87% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1036738 1036738 1036738 N_multimapping 670311 670311 670311 N_noFeature 845578 6498916 6311177 N_ambiguous 176010 11530 12809 UnstrandedReadsAssigned:11095687 PositiveStrandReadsAssigned:5606829 NegativeStrandReadsAssigned:5793289 Dataset is classified unstranded MeadianReadLen=101 20thPercentileLength=100 echo kmer=95 SRR21853533 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR21853533-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,824,324 reads, 11,548,818 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,162 rounds 52973 SRR21853533.ke.tsv 35125 SRR21853533.se.tsv 88098 total ==> SRR21853533.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 18.5279 3.46373 PNS24247 1044 945 33.7345 5.58579 PNS24249 1928 1829 54.2688 4.64279 PNS24246 1044 945 33.7345 5.58579 PNS24248 1044 945 33.7345 5.58579 PNS24244 1471 1372 0 0 PNS24243 293 194 40 32.2628 KQK14069 1603 1504 2553.18 265.629 KQK14071 474 375 152.48 63.6247 ==> SRR21853533.se.tsv <== BRADI_1g14170v3 2819 BRADI_1g53295v3 62 BRADI_1g59795v3 239 BRADI_1g07683v3 0 BRADI_1g00485v3 59 BRADI_1g20270v3 529 BRADI_1g74790v3 127 BRADI_1g09890v3 0 BRADI_1g77505v3 125 BRADI_1g48960v3 0 SRR21853533 completed mapping pipeline successfully