Starting /dee2/code/volunteer_pipeline.sh SRR21853534 current disk space = 1550648573952 free memory = 1599776936 SRR21853534 SRAfilesize 9613863741f5a3db359e62d2898354db SRR21853534.sra SRR21853534.sra file validated SRR21853534 is single end SRR21853534 is conventional basespace SRR21853534 read1 length is 91-101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR21853534_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 91-101 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.421 37.0 37.0 37.0 37.0 37.0 2 35.735 37.0 37.0 37.0 37.0 37.0 3 36.031 37.0 37.0 37.0 37.0 37.0 4 35.935 37.0 37.0 37.0 37.0 37.0 5 36.0755 37.0 37.0 37.0 37.0 37.0 6 35.98 37.0 37.0 37.0 37.0 37.0 7 36.0935 37.0 37.0 37.0 37.0 37.0 8 36.0905 37.0 37.0 37.0 37.0 37.0 9 36.1355 37.0 37.0 37.0 37.0 37.0 10-11 36.08525 37.0 37.0 37.0 37.0 37.0 12-13 36.068 37.0 37.0 37.0 37.0 37.0 14-15 36.026250000000005 37.0 37.0 37.0 37.0 37.0 16-17 36.01475 37.0 37.0 37.0 37.0 37.0 18-19 36.0675 37.0 37.0 37.0 37.0 37.0 20-21 35.9465 37.0 37.0 37.0 37.0 37.0 22-23 36.07475 37.0 37.0 37.0 37.0 37.0 24-25 35.9075 37.0 37.0 37.0 37.0 37.0 26-27 35.852000000000004 37.0 37.0 37.0 37.0 37.0 28-29 35.85325 37.0 37.0 37.0 37.0 37.0 30-31 35.877250000000004 37.0 37.0 37.0 37.0 37.0 32-33 35.914500000000004 37.0 37.0 37.0 37.0 37.0 34-35 35.789 37.0 37.0 37.0 37.0 37.0 36-37 35.804 37.0 37.0 37.0 37.0 37.0 38-39 35.89075 37.0 37.0 37.0 37.0 37.0 40-41 35.7545 37.0 37.0 37.0 37.0 37.0 42-43 35.7275 37.0 37.0 37.0 37.0 37.0 44-45 35.68025 37.0 37.0 37.0 37.0 37.0 46-47 35.731750000000005 37.0 37.0 37.0 37.0 37.0 48-49 35.587 37.0 37.0 37.0 37.0 37.0 50-51 35.6555 37.0 37.0 37.0 37.0 37.0 52-53 35.65875 37.0 37.0 37.0 37.0 37.0 54-55 35.72325 37.0 37.0 37.0 37.0 37.0 56-57 35.568 37.0 37.0 37.0 37.0 37.0 58-59 35.673 37.0 37.0 37.0 37.0 37.0 60-61 35.62375 37.0 37.0 37.0 37.0 37.0 62-63 35.5655 37.0 37.0 37.0 37.0 37.0 64-65 35.666 37.0 37.0 37.0 37.0 37.0 66-67 35.59725 37.0 37.0 37.0 37.0 37.0 68-69 35.58525 37.0 37.0 37.0 37.0 37.0 70-71 35.4425 37.0 37.0 37.0 37.0 37.0 72-73 35.5695 37.0 37.0 37.0 37.0 37.0 74-75 35.48875 37.0 37.0 37.0 37.0 37.0 76-77 35.5965 37.0 37.0 37.0 37.0 37.0 78-79 35.53275 37.0 37.0 37.0 37.0 37.0 80-81 35.58525 37.0 37.0 37.0 37.0 37.0 82-83 35.62375 37.0 37.0 37.0 37.0 37.0 84-85 35.6425 37.0 37.0 37.0 37.0 37.0 86-87 35.564750000000004 37.0 37.0 37.0 37.0 37.0 88-89 35.48225 37.0 37.0 37.0 37.0 37.0 90-91 35.57175 37.0 37.0 37.0 37.0 37.0 92-93 35.551387846961745 37.0 37.0 37.0 37.0 37.0 94-95 35.52238059514879 37.0 37.0 37.0 37.0 37.0 96-97 35.5832898914387 37.0 37.0 37.0 37.0 37.0 98-99 35.51446826628096 37.0 37.0 37.0 37.0 37.0 100-101 35.34723706753949 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 2101 1 0.0 2101 2 0.0 2101 3 0.0 2101 4 0.0 2101 5 0.0 2101 6 0.0 2101 7 0.0 2101 8 0.0 2101 9 0.0 2101 10-11 0.0 2101 12-13 0.0 2101 14-15 0.0 2101 16-17 0.0 2101 18-19 0.0 2101 20-21 0.0 2101 22-23 0.0 2101 24-25 0.0 2101 26-27 0.0 2101 28-29 0.0 2101 30-31 0.0 2101 32-33 0.0 2101 34-35 0.0 2101 36-37 0.0 2101 38-39 0.0 2101 40-41 0.0 2101 42-43 0.0 2101 44-45 0.0 2101 46-47 0.0 2101 48-49 0.0 2101 50-51 0.0 2101 52-53 0.0 2101 54-55 0.0 2101 56-57 0.0 2101 58-59 0.0 2101 60-61 0.0 2101 62-63 0.0 2101 64-65 0.0 2101 66-67 0.0 2101 68-69 0.0 2101 70-71 0.0 2101 72-73 0.0 2101 74-75 0.0 2101 76-77 0.0 2101 78-79 0.0 2101 80-81 0.0 2101 82-83 0.0 2101 84-85 0.0 2101 86-87 0.0 2101 88-89 0.0 2101 90-91 0.0 2101 92-93 0.0 2101 94-95 0.0 2101 96-97 0.0 2101 98-99 0.0 2101 100-101 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 1.0 23 1.0 24 6.0 25 7.0 26 7.0 27 17.0 28 26.0 29 42.0 30 63.0 31 101.0 32 123.0 33 144.0 34 222.0 35 484.0 36 2179.0 37 577.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 26.950000000000003 12.725 16.725 43.6 2 26.1 18.625 29.575000000000003 25.7 3 27.05 21.325 23.7 27.925 4 26.900000000000002 27.075 18.775 27.250000000000004 5 29.175 28.9 20.3 21.625 6 23.05 32.925 20.599999999999998 23.425 7 21.55 18.775 36.5 23.175 8 22.975 22.6 24.85 29.575000000000003 9 21.9 21.375 28.199999999999996 28.525 10-11 25.3125 27.462500000000002 20.1625 27.0625 12-13 24.175 21.9 25.4375 28.487499999999997 14-15 23.6875 24.474999999999998 24.7375 27.1 16-17 25.424999999999997 23.1875 23.7125 27.675 18-19 25.2 23.549999999999997 24.7375 26.5125 20-21 24.712500000000002 24.1875 24.775 26.325 22-23 25.124999999999996 24.637500000000003 24.1625 26.075 24-25 24.15 24.3625 23.724999999999998 27.762500000000003 26-27 24.637500000000003 23.925 23.5 27.9375 28-29 25.6 23.7 24.025 26.674999999999997 30-31 24.0375 23.95 24.3125 27.700000000000003 32-33 23.8375 25.2375 24.6625 26.2625 34-35 24.4875 24.3125 24.325 26.875 36-37 25.85 24.1375 23.875 26.137500000000003 38-39 23.9 24.2375 24.275 27.5875 40-41 25.362499999999997 23.7875 23.2125 27.6375 42-43 24.3 24.95 24.575 26.174999999999997 44-45 25.337500000000002 23.3 25.074999999999996 26.2875 46-47 26.2875 23.8375 23.6625 26.2125 48-49 25.025 23.6125 25.174999999999997 26.187500000000004 50-51 24.5125 24.0625 24.625 26.8 52-53 24.9 23.3625 23.65 28.0875 54-55 25.924999999999997 23.575 24.3125 26.187500000000004 56-57 24.8 24.625 24.0 26.575 58-59 24.8 23.799999999999997 25.5 25.900000000000002 60-61 24.7375 24.4125 23.95 26.900000000000002 62-63 25.5125 24.275 23.9 26.3125 64-65 25.7625 23.799999999999997 24.0625 26.375 66-67 24.5125 24.8625 23.95 26.674999999999997 68-69 25.662499999999998 25.112499999999997 23.5 25.724999999999998 70-71 26.337500000000002 23.1875 24.125 26.35 72-73 26.775 22.975 23.5125 26.737499999999997 74-75 26.174999999999997 25.0125 23.4375 25.374999999999996 76-77 26.3625 23.925 23.474999999999998 26.237500000000004 78-79 25.924999999999997 23.1875 23.95 26.937499999999996 80-81 25.7125 24.3 23.3375 26.650000000000002 82-83 27.1125 23.7375 23.325000000000003 25.825 84-85 25.837500000000002 24.3625 23.1 26.700000000000003 86-87 26.137500000000003 23.9125 23.7 26.25 88-89 26.2125 24.7875 23.3375 25.662499999999998 90-91 25.85 24.087500000000002 23.549999999999997 26.5125 92-93 25.406351587896975 24.3935983995999 23.493373343335833 26.70667666916729 94-95 26.006501625406354 23.568392098024507 24.281070267566893 26.144036009002253 96-97 25.46933667083855 24.918648310387987 23.11639549436796 26.495619524405505 98-99 26.4732086037928 23.01132747868143 24.11862033855161 26.39684357897416 100-101 28.43339141454142 10.327894820212261 28.734357674639632 32.504356090606684 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 1.0 21 0.5 22 0.0 23 0.0 24 1.5 25 2.0 26 1.0 27 2.5 28 4.0 29 6.0 30 9.5 31 12.0 32 14.5 33 22.0 34 31.0 35 33.5 36 36.0 37 49.0 38 65.5 39 82.5 40 98.0 41 119.5 42 137.0 43 142.0 44 148.5 45 157.0 46 165.0 47 159.5 48 158.5 49 163.5 50 157.0 51 135.5 52 121.0 53 117.0 54 112.0 55 111.5 56 100.5 57 92.5 58 81.5 59 79.5 60 79.5 61 86.5 62 87.0 63 74.5 64 74.5 65 74.5 66 72.0 67 63.5 68 60.0 69 48.5 70 54.5 71 53.5 72 32.5 73 35.5 74 46.5 75 38.5 76 26.0 77 19.0 78 16.0 79 13.0 80 5.0 81 2.5 82 4.0 83 4.0 84 1.0 85 1.0 86 1.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 91 1.0 92 0.0 93 0.0 94 0.0 95 1.0 96 6.0 97 20.0 98 87.0 99 261.0 100 935.0 101 2689.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.925 #Duplication Level Percentage of deduplicated Percentage of total 1 92.22192004351373 84.775 2 7.397334783791135 13.600000000000001 3 0.24476475387544194 0.675 4 0.08158825129181398 0.3 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.027196083763937992 0.22499999999999998 >10 0.027196083763937992 0.42500000000000004 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACATTACTCGATCTCGTAT 17 0.42500000000000004 TruSeq Adapter, Index 27 (97% over 39bp) GATCGGAAGAGCACACGTCTGAACTCCAGTCACATTACTCGATCGCGTAT 9 0.22499999999999998 TruSeq Adapter, Index 27 (97% over 39bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AGCAGAA 15 6.236253E-4 94.637505 5 GCAGAAT 15 6.236253E-4 94.637505 6 GAATCAG 15 6.236253E-4 94.637505 9 CGGCAGC 15 6.236253E-4 94.637505 1 GGCAGCA 15 6.236253E-4 94.637505 2 CAGCAGA 20 0.0019552114 70.97813 4 AGAATCA 20 0.0019552114 70.97813 8 TCAAGTG 15 0.0048302957 56.924812 94-95 CAAGTGT 15 0.0048302957 56.924812 94-95 CAGAATC 25 0.0047353236 56.782497 7 TATCAAG 15 0.009614144 47.91772 92-93 GCAGCAG 30 0.009740727 47.318752 3 >>END_MODULE Read 270921 spots for SRR21853534.sra Written 270921 spots for SRR21853534.sra Read 270921 spots for SRR21853534.sra Written 270921 spots for SRR21853534.sra Read 270921 spots for SRR21853534.sra Written 270921 spots for SRR21853534.sra Read 270921 spots for SRR21853534.sra Written 270921 spots for SRR21853534.sra Read 270921 spots for SRR21853534.sra Written 270921 spots for SRR21853534.sra Read 270921 spots for SRR21853534.sra Written 270921 spots for SRR21853534.sra Read 270923 spots for SRR21853534.sra Written 270923 spots for SRR21853534.sra Read 270921 spots for SRR21853534.sra Written 270921 spots for SRR21853534.sra Read 270921 spots for SRR21853534.sra Written 270921 spots for SRR21853534.sra Read 270921 spots for SRR21853534.sra Written 270921 spots for SRR21853534.sra Read 270921 spots for SRR21853534.sra Written 270921 spots for SRR21853534.sra Read 270921 spots for SRR21853534.sra Written 270921 spots for SRR21853534.sra Read 270921 spots for SRR21853534.sra Written 270921 spots for SRR21853534.sra Read 270921 spots for SRR21853534.sra Written 270921 spots for SRR21853534.sra Read 270921 spots for SRR21853534.sra Written 270921 spots for SRR21853534.sra Read 270921 spots for SRR21853534.sra Written 270921 spots for SRR21853534.sra Read 270921 spots for SRR21853534.sra Written 270921 spots for SRR21853534.sra Read 270921 spots for SRR21853534.sra Written 270921 spots for SRR21853534.sra Read 270921 spots for SRR21853534.sra Written 270921 spots for SRR21853534.sra Read 270921 spots for SRR21853534.sra Written 270921 spots for SRR21853534.sra SRR ids: ['SRR21853534.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ax37cv83 SRR21853534.sra spots: 5418422 blocks: [[1, 270921], [270922, 541842], [541843, 812763], [812764, 1083684], [1083685, 1354605], [1354606, 1625526], [1625527, 1896447], [1896448, 2167368], [2167369, 2438289], [2438290, 2709210], [2709211, 2980131], [2980132, 3251052], [3251053, 3521973], [3521974, 3792894], [3792895, 4063815], [4063816, 4334736], [4334737, 4605657], [4605658, 4876578], [4876579, 5147499], [5147500, 5418422]] SRR21853534 file size 1456647 SRR21853534 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR21853534 SRR21853534_1.fastq Input file: SRR21853534_1.fastq trimmed: SRR21853534-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Fri Dec 6 17:17:33 2024 >> started Fri Dec 6 17:17:36 2024 >> done (3.045s) 5418422 reads processed; of these: 2 ( 0.00%) short reads filtered out after trimming by size control 44679 ( 0.82%) empty reads filtered out after trimming by size control 5373741 (99.18%) reads available; of these: 220 ( 0.00%) trimmed reads available after processing 5373521 (100.00%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 26 1 0.00% 27 0 0.00% 28 2 0.00% 29 1 0.00% 30 0 0.00% 31 3 0.00% 32 2 0.00% 33 5 0.00% 34 2 0.00% 35 10 0.00% 36 7 0.00% 37 11 0.00% 38 9 0.00% 39 13 0.00% 40 7 0.00% 41 6 0.00% 42 19 0.00% 43 9 0.00% 44 13 0.00% 45 19 0.00% 46 6 0.00% 47 16 0.00% 48 9 0.00% 49 14 0.00% 50 10 0.00% 51 10 0.00% 52 12 0.00% 53 11 0.00% 54 14 0.00% 55 23 0.00% 56 11 0.00% 57 19 0.00% 58 12 0.00% 59 17 0.00% 60 17 0.00% 61 20 0.00% 62 17 0.00% 63 20 0.00% 64 17 0.00% 65 26 0.00% 66 21 0.00% 67 24 0.00% 68 22 0.00% 69 20 0.00% 70 28 0.00% 71 26 0.00% 72 32 0.00% 73 16 0.00% 74 27 0.00% 75 32 0.00% 76 35 0.00% 77 30 0.00% 78 28 0.00% 79 34 0.00% 80 31 0.00% 81 31 0.00% 82 37 0.00% 83 27 0.00% 84 44 0.00% 85 39 0.00% 86 29 0.00% 87 48 0.00% 88 41 0.00% 89 66 0.00% 90 95 0.00% 91 223 0.00% 92 83 0.00% 93 104 0.00% 94 296 0.01% 95 1249 0.02% 96 6904 0.13% 97 24461 0.46% 98 94361 1.76% 99 354109 6.59% 100 1207489 22.47% 101 3683159 68.54% 5373741 reads passed initial QC criterion=sequence-density sequence-density=0.18 sequence-density-rank=1 fanout-score=1.96 fanout-score-rank=36 prefix-density=0.18 prefix-fanout=2.0 sequence=CCGTCAATTCCTTT criterion=fanout-score sequence-density=0.08 sequence-density-rank=20 fanout-score=305.47 fanout-score-rank=1 prefix-density=0.91 prefix-fanout=25.4 sequence=CGCCGCCGCCGG Started job on | Dec 06 17:17:53 Started mapping on | Dec 06 17:17:53 Finished on | Dec 06 17:18:01 Mapping speed, Million of reads per hour | 2418.18 Number of input reads | 5373741 Average input read length | 100 UNIQUE READS: Uniquely mapped reads number | 4775263 Uniquely mapped reads % | 88.86% Average mapped length | 100.31 Number of splices: Total | 1632091 Number of splices: Annotated (sjdb) | 1539808 Number of splices: GT/AG | 1610326 Number of splices: GC/AG | 18873 Number of splices: AT/AC | 929 Number of splices: Non-canonical | 1963 Mismatch rate per base, % | 0.24% Deletion rate per base | 0.00% Deletion average length | 1.63 Insertion rate per base | 0.00% Insertion average length | 1.30 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 210405 % of reads mapped to multiple loci | 3.92% Number of reads mapped to too many loci | 284506 % of reads mapped to too many loci | 5.29% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.18% % of reads unmapped: other | 0.74% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 388073 388073 388073 N_multimapping 210405 210405 210405 N_noFeature 266131 2564489 2415429 N_ambiguous 69377 4033 4242 UnstrandedReadsAssigned:4439755 PositiveStrandReadsAssigned:2206741 NegativeStrandReadsAssigned:2355592 Dataset is classified unstranded MeadianReadLen=101 20thPercentileLength=100 echo kmer=95 SRR21853534 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR21853534-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 5,373,741 reads, 4,600,972 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,065 rounds 52973 SRR21853534.ke.tsv 35125 SRR21853534.se.tsv 88098 total ==> SRR21853534.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 20.9477 9.43359 PNS24247 1044 945 0 0 PNS24249 1928 1829 57.2978 11.8084 PNS24246 1044 945 0 0 PNS24248 1044 945 0 0 PNS24244 1471 1372 17.7546 4.87779 PNS24243 293 194 17 33.0304 KQK14069 1603 1504 2465.64 617.944 KQK14071 474 375 27.5521 27.6943 ==> SRR21853534.se.tsv <== BRADI_1g14170v3 2586 BRADI_1g53295v3 28 BRADI_1g59795v3 64 BRADI_1g07683v3 0 BRADI_1g00485v3 19 BRADI_1g20270v3 177 BRADI_1g74790v3 61 BRADI_1g09890v3 0 BRADI_1g77505v3 39 BRADI_1g48960v3 0 SRR21853534 completed mapping pipeline successfully