Starting /dee2/code/volunteer_pipeline.sh SRR21853535 current disk space = 1550629347328 free memory = 1320715136 SRR21853535 SRAfilesize 8f527b3e44159e313f9486a560ab03a2 SRR21853535.sra SRR21853535.sra file validated SRR21853535 is single end SRR21853535 is conventional basespace SRR21853535 read1 length is 76-101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR21853535_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 76-101 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.0045 37.0 37.0 37.0 25.0 37.0 2 35.1075 37.0 37.0 37.0 37.0 37.0 3 35.554 37.0 37.0 37.0 37.0 37.0 4 35.689 37.0 37.0 37.0 37.0 37.0 5 35.8075 37.0 37.0 37.0 37.0 37.0 6 35.799 37.0 37.0 37.0 37.0 37.0 7 35.7245 37.0 37.0 37.0 37.0 37.0 8 35.835 37.0 37.0 37.0 37.0 37.0 9 35.819 37.0 37.0 37.0 37.0 37.0 10-11 35.90025 37.0 37.0 37.0 37.0 37.0 12-13 35.93125 37.0 37.0 37.0 37.0 37.0 14-15 35.9475 37.0 37.0 37.0 37.0 37.0 16-17 35.852 37.0 37.0 37.0 37.0 37.0 18-19 35.867999999999995 37.0 37.0 37.0 37.0 37.0 20-21 35.857749999999996 37.0 37.0 37.0 37.0 37.0 22-23 35.882000000000005 37.0 37.0 37.0 37.0 37.0 24-25 35.86025 37.0 37.0 37.0 37.0 37.0 26-27 35.713499999999996 37.0 37.0 37.0 37.0 37.0 28-29 35.84625 37.0 37.0 37.0 37.0 37.0 30-31 35.73725 37.0 37.0 37.0 37.0 37.0 32-33 35.61325 37.0 37.0 37.0 37.0 37.0 34-35 35.6555 37.0 37.0 37.0 37.0 37.0 36-37 35.53775 37.0 37.0 37.0 37.0 37.0 38-39 35.69625 37.0 37.0 37.0 37.0 37.0 40-41 35.546499999999995 37.0 37.0 37.0 37.0 37.0 42-43 35.535 37.0 37.0 37.0 37.0 37.0 44-45 35.3795 37.0 37.0 37.0 37.0 37.0 46-47 35.44775 37.0 37.0 37.0 37.0 37.0 48-49 35.359750000000005 37.0 37.0 37.0 37.0 37.0 50-51 35.52925 37.0 37.0 37.0 37.0 37.0 52-53 35.383250000000004 37.0 37.0 37.0 37.0 37.0 54-55 35.346999999999994 37.0 37.0 37.0 37.0 37.0 56-57 35.219 37.0 37.0 37.0 31.0 37.0 58-59 35.4555 37.0 37.0 37.0 37.0 37.0 60-61 35.33875 37.0 37.0 37.0 37.0 37.0 62-63 35.22175 37.0 37.0 37.0 37.0 37.0 64-65 35.41625 37.0 37.0 37.0 37.0 37.0 66-67 35.307500000000005 37.0 37.0 37.0 37.0 37.0 68-69 35.230999999999995 37.0 37.0 37.0 31.0 37.0 70-71 35.18825 37.0 37.0 37.0 31.0 37.0 72-73 35.289 37.0 37.0 37.0 31.0 37.0 74-75 35.37325 37.0 37.0 37.0 37.0 37.0 76-77 35.292278382095525 37.0 37.0 37.0 37.0 37.0 78-79 35.42885721430358 37.0 37.0 37.0 37.0 37.0 80-81 35.39334833708427 37.0 37.0 37.0 37.0 37.0 82-83 35.38134533633408 37.0 37.0 37.0 37.0 37.0 84-85 35.27156789197299 37.0 37.0 37.0 31.0 37.0 86-87 35.41760440110028 37.0 37.0 37.0 37.0 37.0 88-89 35.440610152538135 37.0 37.0 37.0 37.0 37.0 90-91 35.30132533133283 37.0 37.0 37.0 37.0 37.0 92-93 35.2448112028007 37.0 37.0 37.0 31.0 37.0 94-95 35.316358979689895 37.0 37.0 37.0 37.0 37.0 96-97 35.14766556293465 37.0 37.0 37.0 25.0 37.0 98-99 35.346885429825804 37.0 37.0 37.0 37.0 37.0 100-101 35.24624645266751 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100-101 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 18 1.0 19 0.0 20 1.0 21 0.0 22 2.0 23 3.0 24 6.0 25 7.0 26 17.0 27 20.0 28 36.0 29 59.0 30 66.0 31 107.0 32 163.0 33 172.0 34 255.0 35 537.0 36 2093.0 37 455.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 26.650000000000002 12.225 17.25 43.875 2 24.430955993930198 19.90389479008599 30.62721294891249 25.03793626707132 3 25.525 24.05 23.425 27.0 4 26.6 27.85 19.6 25.95 5 28.875 29.099999999999998 20.849999999999998 21.175 6 23.125 32.975 20.075000000000003 23.825 7 20.4 18.875 36.6 24.125 8 22.75 23.400000000000002 25.05 28.799999999999997 9 22.275 19.825 29.65 28.249999999999996 10-11 25.05 28.037499999999998 20.3 26.6125 12-13 23.6625 22.8625 25.4875 27.987499999999997 14-15 24.0375 24.7875 25.6125 25.5625 16-17 25.75 24.0 23.5375 26.7125 18-19 25.124999999999996 24.7375 24.7875 25.35 20-21 26.1125 23.8875 24.3625 25.637500000000003 22-23 24.224999999999998 25.324999999999996 24.4375 26.0125 24-25 23.25 23.8875 25.662499999999998 27.200000000000003 26-27 24.8125 23.5375 24.962500000000002 26.687499999999996 28-29 25.0375 24.637500000000003 23.575 26.75 30-31 25.074999999999996 24.8 24.1625 25.9625 32-33 24.325 25.912499999999998 24.5 25.2625 34-35 23.775 24.9 24.6125 26.7125 36-37 24.2875 24.45 25.074999999999996 26.187500000000004 38-39 24.825 24.425 24.5375 26.2125 40-41 25.324999999999996 24.675 23.1625 26.8375 42-43 24.375 25.587500000000002 24.0125 26.025 44-45 25.650000000000002 25.45 23.674999999999997 25.224999999999998 46-47 24.825 24.2 23.8625 27.1125 48-49 24.2 24.712500000000002 25.5375 25.55 50-51 24.925 24.0 24.962500000000002 26.1125 52-53 26.187500000000004 24.1125 22.975 26.724999999999998 54-55 25.8 23.7125 24.7375 25.75 56-57 24.7375 24.462500000000002 25.1 25.7 58-59 24.6625 23.2125 25.0 27.125 60-61 26.55 24.375 23.6625 25.412499999999998 62-63 25.1875 24.875 24.2 25.7375 64-65 26.724999999999998 23.2625 24.337500000000002 25.674999999999997 66-67 25.25 25.687500000000004 23.025000000000002 26.0375 68-69 25.6125 25.2125 23.65 25.525 70-71 25.687500000000004 23.525 24.15 26.637499999999996 72-73 25.95 24.637500000000003 23.8125 25.6 74-75 25.7875 24.637500000000003 24.0125 25.5625 76-77 26.465808226028255 23.790473809226153 24.21552694086761 25.528191023877984 78-79 26.19404851212803 24.63115778944736 23.380845211302827 25.79394848712178 80-81 26.469117279319832 23.193298324581146 24.006001500375092 26.331582895723933 82-83 27.24431107776944 23.43085771442861 23.43085771442861 25.893973493373345 84-85 26.131532883220803 23.468367091772944 23.918479619904975 26.481620405101275 86-87 26.78169542385596 23.518379594898725 24.60615153788447 25.09377344336084 88-89 27.819454863715933 23.680920230057513 23.443360840210055 25.056264066016503 90-91 25.593898474618655 25.11877969492373 23.193298324581146 26.094023505876468 92-93 26.619154788697173 24.418604651162788 23.418354588647162 25.543885971492873 94-95 25.647117669125922 23.62135800925347 24.259097161435538 26.47242716018507 96-97 27.155549993742962 23.201101238893756 24.92804404955575 24.715304717807534 98-99 26.48291629620221 23.65045090816715 24.145814810110505 25.720817985520135 100-101 27.620841180163215 11.079723791588199 29.37853107344633 31.92090395480226 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 2.0 1 1.0 2 0.0 3 0.0 4 0.0 5 1.0 6 1.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 1.0 23 1.0 24 0.5 25 1.5 26 2.5 27 3.5 28 4.5 29 6.0 30 6.5 31 8.5 32 13.5 33 26.0 34 34.5 35 35.5 36 43.0 37 52.5 38 66.5 39 84.5 40 106.0 41 131.0 42 134.0 43 144.0 44 167.5 45 184.5 46 185.0 47 166.0 48 157.5 49 147.0 50 149.0 51 146.5 52 125.5 53 106.5 54 93.0 55 94.0 56 94.5 57 94.0 58 81.0 59 75.5 60 77.5 61 68.0 62 74.0 63 77.5 64 79.0 65 76.5 66 65.5 67 58.0 68 54.5 69 52.0 70 53.5 71 54.0 72 46.0 73 46.5 74 42.0 75 28.5 76 22.0 77 18.0 78 12.0 79 7.5 80 6.0 81 2.5 82 0.5 83 2.0 84 1.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 1.15 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 76 1.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 1.0 95 2.0 96 1.0 97 21.0 98 75.0 99 266.0 100 894.0 101 2739.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.30000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 93.06608884073673 85.9 2 6.500541711809317 12.0 3 0.35211267605633806 0.975 4 0.027085590465872153 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.054171180931744306 1.0250000000000001 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACATTACTCGATCTCGTAT 30 0.75 TruSeq Adapter, Index 27 (97% over 39bp) GATCGGAAGAGCACACGTCTGAACTCCAGTCACATTACTCGATCGCGTAT 11 0.27499999999999997 TruSeq Adapter, Index 27 (97% over 39bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 767448 spots for SRR21853535.sra Written 767448 spots for SRR21853535.sra Read 767448 spots for SRR21853535.sra Written 767448 spots for SRR21853535.sra Read 767448 spots for SRR21853535.sra Written 767448 spots for SRR21853535.sra Read 767448 spots for SRR21853535.sra Written 767448 spots for SRR21853535.sra Read 767448 spots for SRR21853535.sra Written 767448 spots for SRR21853535.sra Read 767448 spots for SRR21853535.sra Written 767448 spots for SRR21853535.sra Read 767448 spots for SRR21853535.sra Written 767448 spots for SRR21853535.sra Read 767448 spots for SRR21853535.sra Written 767448 spots for SRR21853535.sra Read 767448 spots for SRR21853535.sra Written 767448 spots for SRR21853535.sra Read 767448 spots for SRR21853535.sra Written 767448 spots for SRR21853535.sra Read 767448 spots for SRR21853535.sra Written 767448 spots for SRR21853535.sra Read 767448 spots for SRR21853535.sra Written 767448 spots for SRR21853535.sra Read 767448 spots for SRR21853535.sra Written 767448 spots for SRR21853535.sra Read 767455 spots for SRR21853535.sra Written 767455 spots for SRR21853535.sra Read 767448 spots for SRR21853535.sra Written 767448 spots for SRR21853535.sra Read 767448 spots for SRR21853535.sra Written 767448 spots for SRR21853535.sra Read 767448 spots for SRR21853535.sra Written 767448 spots for SRR21853535.sra Read 767448 spots for SRR21853535.sra Written 767448 spots for SRR21853535.sra Read 767448 spots for SRR21853535.sra Written 767448 spots for SRR21853535.sra Read 767448 spots for SRR21853535.sra Written 767448 spots for SRR21853535.sra SRR ids: ['SRR21853535.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_uu65fe_b SRR21853535.sra spots: 15348967 blocks: [[1, 767448], [767449, 1534896], [1534897, 2302344], [2302345, 3069792], [3069793, 3837240], [3837241, 4604688], [4604689, 5372136], [5372137, 6139584], [6139585, 6907032], [6907033, 7674480], [7674481, 8441928], [8441929, 9209376], [9209377, 9976824], [9976825, 10744272], [10744273, 11511720], [11511721, 12279168], [12279169, 13046616], [13046617, 13814064], [13814065, 14581512], [14581513, 15348967]] SRR21853535 file size 4133226 SRR21853535 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR21853535 SRR21853535_1.fastq Input file: SRR21853535_1.fastq trimmed: SRR21853535-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Fri Dec 6 17:20:25 2024 >> started Fri Dec 6 17:20:34 2024 >> done (9.520s) 15348967 reads processed; of these: 16 ( 0.00%) short reads filtered out after trimming by size control 188102 ( 1.23%) empty reads filtered out after trimming by size control 15160849 (98.77%) reads available; of these: 463 ( 0.00%) trimmed reads available after processing 15160386 (100.00%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 0 0.00% 20 0 0.00% 21 1 0.00% 22 1 0.00% 23 5 0.00% 24 3 0.00% 25 5 0.00% 26 7 0.00% 27 5 0.00% 28 10 0.00% 29 6 0.00% 30 6 0.00% 31 8 0.00% 32 9 0.00% 33 3 0.00% 34 4 0.00% 35 75 0.00% 36 64 0.00% 37 65 0.00% 38 71 0.00% 39 74 0.00% 40 78 0.00% 41 70 0.00% 42 70 0.00% 43 97 0.00% 44 86 0.00% 45 99 0.00% 46 104 0.00% 47 93 0.00% 48 90 0.00% 49 95 0.00% 50 101 0.00% 51 96 0.00% 52 90 0.00% 53 121 0.00% 54 117 0.00% 55 114 0.00% 56 128 0.00% 57 116 0.00% 58 137 0.00% 59 96 0.00% 60 118 0.00% 61 137 0.00% 62 153 0.00% 63 141 0.00% 64 139 0.00% 65 154 0.00% 66 167 0.00% 67 147 0.00% 68 139 0.00% 69 150 0.00% 70 151 0.00% 71 175 0.00% 72 155 0.00% 73 183 0.00% 74 178 0.00% 75 163 0.00% 76 181 0.00% 77 161 0.00% 78 207 0.00% 79 228 0.00% 80 201 0.00% 81 217 0.00% 82 223 0.00% 83 256 0.00% 84 261 0.00% 85 278 0.00% 86 272 0.00% 87 278 0.00% 88 318 0.00% 89 366 0.00% 90 391 0.00% 91 799 0.01% 92 372 0.00% 93 533 0.00% 94 981 0.01% 95 3666 0.02% 96 20145 0.13% 97 69876 0.46% 98 266774 1.76% 99 1002089 6.61% 100 3404059 22.45% 101 10382845 68.48% 15160849 reads passed initial QC criterion=sequence-density sequence-density=0.18 sequence-density-rank=1 fanout-score=1.99 fanout-score-rank=31 prefix-density=0.17 prefix-fanout=2.0 sequence=CCGTCAATTCCTTT criterion=fanout-score sequence-density=0.07 sequence-density-rank=23 fanout-score=323.52 fanout-score-rank=1 prefix-density=0.91 prefix-fanout=25.3 sequence=CGCCGCCGCCGA Started job on | Dec 06 17:20:55 Started mapping on | Dec 06 17:20:55 Finished on | Dec 06 17:21:23 Mapping speed, Million of reads per hour | 1949.25 Number of input reads | 15160849 Average input read length | 100 UNIQUE READS: Uniquely mapped reads number | 13498401 Uniquely mapped reads % | 89.03% Average mapped length | 100.28 Number of splices: Total | 4652382 Number of splices: Annotated (sjdb) | 4386716 Number of splices: GT/AG | 4589539 Number of splices: GC/AG | 53933 Number of splices: AT/AC | 2675 Number of splices: Non-canonical | 6235 Mismatch rate per base, % | 0.29% Deletion rate per base | 0.00% Deletion average length | 1.67 Insertion rate per base | 0.00% Insertion average length | 1.35 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 590362 % of reads mapped to multiple loci | 3.89% Number of reads mapped to too many loci | 750369 % of reads mapped to too many loci | 4.95% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.34% % of reads unmapped: other | 0.78% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1072086 1072086 1072086 N_multimapping 590362 590362 590362 N_noFeature 750225 7235984 6840004 N_ambiguous 195048 11362 12164 UnstrandedReadsAssigned:12553128 PositiveStrandReadsAssigned:6251055 NegativeStrandReadsAssigned:6646233 Dataset is classified unstranded MeadianReadLen=101 20thPercentileLength=100 echo kmer=95 SRR21853535 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR21853535-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,160,849 reads, 12,999,289 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,168 rounds 52973 SRR21853535.ke.tsv 35125 SRR21853535.se.tsv 88098 total ==> SRR21853535.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 45.843 7.28688 PNS24247 1044 945 15.549 2.1891 PNS24249 1928 1829 142.95 10.3983 PNS24246 1044 945 15.549 2.1891 PNS24248 1044 945 15.549 2.1891 PNS24244 1471 1372 28.5602 2.7695 PNS24243 293 194 45 30.8606 KQK14069 1603 1504 7372.68 652.186 KQK14071 474 375 151.281 53.6721 ==> SRR21853535.se.tsv <== BRADI_1g14170v3 7812 BRADI_1g53295v3 82 BRADI_1g59795v3 148 BRADI_1g07683v3 0 BRADI_1g00485v3 38 BRADI_1g20270v3 446 BRADI_1g74790v3 154 BRADI_1g09890v3 0 BRADI_1g77505v3 126 BRADI_1g48960v3 1 SRR21853535 completed mapping pipeline successfully