Starting /dee2/code/volunteer_pipeline.sh SRR21853536 current disk space = 1550609649664 free memory = 1599829356 SRR21853536 SRAfilesize 71bd8da97de02ef9eab73a4de420b833 SRR21853536.sra SRR21853536.sra file validated SRR21853536 is single end SRR21853536 is conventional basespace SRR21853536 read1 length is 44-101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR21853536_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 44-101 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.3325 37.0 37.0 37.0 37.0 37.0 2 34.75925 37.0 37.0 37.0 25.0 37.0 3 35.612 37.0 37.0 37.0 37.0 37.0 4 35.857 37.0 37.0 37.0 37.0 37.0 5 35.918 37.0 37.0 37.0 37.0 37.0 6 35.8445 37.0 37.0 37.0 37.0 37.0 7 35.7375 37.0 37.0 37.0 37.0 37.0 8 35.883 37.0 37.0 37.0 37.0 37.0 9 35.999 37.0 37.0 37.0 37.0 37.0 10-11 36.008750000000006 37.0 37.0 37.0 37.0 37.0 12-13 35.96 37.0 37.0 37.0 37.0 37.0 14-15 36.055 37.0 37.0 37.0 37.0 37.0 16-17 35.98375 37.0 37.0 37.0 37.0 37.0 18-19 35.89025 37.0 37.0 37.0 37.0 37.0 20-21 35.9785 37.0 37.0 37.0 37.0 37.0 22-23 35.90975 37.0 37.0 37.0 37.0 37.0 24-25 35.8885 37.0 37.0 37.0 37.0 37.0 26-27 35.8505 37.0 37.0 37.0 37.0 37.0 28-29 35.84075 37.0 37.0 37.0 37.0 37.0 30-31 35.75375 37.0 37.0 37.0 37.0 37.0 32-33 35.724000000000004 37.0 37.0 37.0 37.0 37.0 34-35 35.72475 37.0 37.0 37.0 37.0 37.0 36-37 35.84425 37.0 37.0 37.0 37.0 37.0 38-39 35.7635 37.0 37.0 37.0 37.0 37.0 40-41 35.66025 37.0 37.0 37.0 37.0 37.0 42-43 35.7425 37.0 37.0 37.0 37.0 37.0 44-45 35.65965307653827 37.0 37.0 37.0 37.0 37.0 46-47 35.632316158079036 37.0 37.0 37.0 37.0 37.0 48-49 35.67083541770886 37.0 37.0 37.0 37.0 37.0 50-51 35.663081540770385 37.0 37.0 37.0 37.0 37.0 52-53 35.62681340670335 37.0 37.0 37.0 37.0 37.0 54-55 35.708104052026016 37.0 37.0 37.0 37.0 37.0 56-57 35.60155077538769 37.0 37.0 37.0 37.0 37.0 58-59 35.55491618714036 37.0 37.0 37.0 37.0 37.0 60-61 35.69602201651239 37.0 37.0 37.0 37.0 37.0 62-63 35.60326789135896 37.0 37.0 37.0 37.0 37.0 64-65 35.519769769769766 37.0 37.0 37.0 37.0 37.0 66-67 35.57957957957958 37.0 37.0 37.0 37.0 37.0 68-69 35.47647647647648 37.0 37.0 37.0 37.0 37.0 70-71 35.45170170170171 37.0 37.0 37.0 37.0 37.0 72-73 35.5508008008008 37.0 37.0 37.0 37.0 37.0 74-75 35.46496496496496 37.0 37.0 37.0 37.0 37.0 76-77 35.48923923923924 37.0 37.0 37.0 37.0 37.0 78-79 35.53278278278278 37.0 37.0 37.0 37.0 37.0 80-81 35.55630630630631 37.0 37.0 37.0 37.0 37.0 82-83 35.48773773773774 37.0 37.0 37.0 37.0 37.0 84-85 35.39614614614615 37.0 37.0 37.0 37.0 37.0 86-87 35.46526369924368 37.0 37.0 37.0 37.0 37.0 88-89 35.402503128911135 37.0 37.0 37.0 37.0 37.0 90-91 35.44630788485607 37.0 37.0 37.0 37.0 37.0 92-93 35.52715894868585 37.0 37.0 37.0 37.0 37.0 94-95 35.351939924906134 37.0 37.0 37.0 37.0 37.0 96-97 35.39799483621204 37.0 37.0 37.0 37.0 37.0 98-99 35.410355450799045 37.0 37.0 37.0 37.0 37.0 100-101 35.27080638778378 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100-101 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 1.0 21 1.0 22 0.0 23 2.0 24 5.0 25 10.0 26 13.0 27 16.0 28 40.0 29 45.0 30 86.0 31 82.0 32 119.0 33 149.0 34 231.0 35 494.0 36 2163.0 37 543.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 30.4 12.975 16.125 40.5 2 25.504212407454684 19.81107990809293 29.81873883073781 24.865968853714577 3 26.025 23.674999999999997 22.7 27.6 4 28.599999999999998 28.075 17.849999999999998 25.474999999999998 5 28.225 28.95 20.325 22.5 6 22.05 31.874999999999996 20.175 25.900000000000002 7 20.775 15.825 36.175000000000004 27.224999999999998 8 22.175 21.45 24.2 32.175 9 23.325000000000003 19.3 29.075 28.299999999999997 10-11 25.8125 27.1375 19.45 27.6 12-13 24.462500000000002 21.25 25.924999999999997 28.3625 14-15 23.9875 23.9 24.837500000000002 27.275 16-17 25.8 22.525000000000002 23.474999999999998 28.199999999999996 18-19 26.0125 23.45 23.799999999999997 26.737499999999997 20-21 24.462500000000002 23.775 25.112499999999997 26.650000000000002 22-23 26.0 23.5625 22.650000000000002 27.787499999999998 24-25 24.65 25.0 23.1625 27.187499999999996 26-27 25.2 23.8875 24.087500000000002 26.825 28-29 25.55 24.25 22.525000000000002 27.675 30-31 24.825 24.5625 23.625 26.987499999999997 32-33 25.5375 24.887500000000003 22.075 27.500000000000004 34-35 26.075 23.4125 23.3375 27.175 36-37 25.9875 22.537499999999998 22.625 28.849999999999998 38-39 25.724999999999998 24.6125 23.25 26.4125 40-41 26.224999999999998 24.125 23.05 26.6 42-43 26.7125 22.7125 23.45 27.125 44-45 25.156289072268066 24.281070267566893 23.680920230057513 26.881720430107524 46-47 26.40070035017509 22.761380690345174 24.062031015507753 26.775887943971988 48-49 25.78789394697349 23.71185592796398 23.486743371685844 27.01350675337669 50-51 25.30015007503752 24.324662331165584 23.6368184092046 26.738369184592298 52-53 25.475237618809405 23.23661830915458 23.1615807903952 28.12656328164082 54-55 25.900450225112557 23.424212106053027 23.3991995997999 27.276138069034516 56-57 26.275637818909452 22.473736868434216 23.986993496748372 27.263631815907953 58-59 26.157117838378785 22.929697272954716 23.73029772329247 27.18288716537403 60-61 26.51988991743808 23.767825869402053 23.1048286214661 26.607455591693768 62-63 27.048667584136123 23.282872513449266 23.70824471412486 25.960215188289755 64-65 26.614114114114113 23.636136136136134 23.173173173173172 26.576576576576578 66-67 25.788288288288285 23.11061061061061 23.936436436436438 27.164664664664667 68-69 25.362862862862862 24.486986986986985 23.36086086086086 26.789289289289293 70-71 28.290790790790794 22.44744744744745 22.835335335335337 26.426426426426424 72-73 26.113613613613612 23.623623623623622 22.7977977977978 27.464964964964967 74-75 26.789289289289293 23.223223223223226 23.023023023023022 26.964464464464466 76-77 26.351351351351347 23.46096096096096 22.197197197197198 27.990490490490487 78-79 26.614114114114113 23.435935935935937 22.35985985985986 27.59009009009009 80-81 26.526526526526528 23.84884884884885 22.54754754754755 27.077077077077078 82-83 26.2012012012012 23.44844844844845 22.56006006006006 27.790290290290294 84-85 25.725725725725724 24.2992992992993 22.52252252252252 27.45245245245245 86-87 26.454761606807658 23.864347390814665 23.826805155800276 25.8540858465774 88-89 26.633291614518146 23.27909887359199 23.204005006257823 26.883604505632043 90-91 26.345431789737173 23.942428035043804 22.27784730913642 27.434292866082604 92-93 26.708385481852314 23.504380475594495 22.728410513141426 27.058823529411764 94-95 26.69586983729662 22.853566958698373 22.853566958698373 27.59699624530663 96-97 26.36591478696742 23.195488721804512 23.659147869674186 26.779448621553886 98-99 25.844122873825842 22.658035034272658 23.41964965727342 28.07819243462808 100-101 28.901013250194858 9.805144193296961 28.448947778643802 32.84489477786438 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1.0 1 0.5 2 0.5 3 0.5 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.5 24 1.5 25 2.5 26 1.5 27 2.5 28 4.0 29 2.5 30 4.5 31 9.0 32 14.0 33 15.0 34 16.5 35 28.0 36 39.5 37 45.5 38 61.5 39 78.5 40 89.0 41 103.5 42 119.5 43 122.5 44 130.5 45 147.5 46 154.5 47 163.0 48 162.0 49 143.5 50 125.5 51 122.0 52 113.5 53 101.5 54 100.5 55 102.0 56 103.5 57 106.0 58 102.5 59 94.5 60 92.5 61 96.5 62 103.0 63 94.5 64 86.0 65 86.0 66 81.5 67 85.0 68 81.5 69 74.0 70 68.0 71 65.0 72 60.0 73 45.5 74 34.0 75 26.5 76 23.5 77 25.5 78 18.5 79 9.0 80 6.0 81 2.0 82 2.0 83 1.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 2.075 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 44-45 2.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 1.0 58-59 0.0 60-61 0.0 62-63 1.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 1.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 3.0 96-97 18.0 98-99 330.0 100-101 3644.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.14999999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 91.19583104772353 83.125 2 8.11848601206802 14.799999999999999 3 0.603400987383434 1.6500000000000001 4 0.054854635216675815 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.027427317608337907 0.22499999999999998 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACCGCTCATTATCTCGTAT 9 0.22499999999999998 TruSeq Adapter, Index 2 (97% over 37bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1168712 spots for SRR21853536.sra Written 1168712 spots for SRR21853536.sra Read 1168712 spots for SRR21853536.sra Written 1168712 spots for SRR21853536.sra Read 1168712 spots for SRR21853536.sra Written 1168712 spots for SRR21853536.sra Read 1168712 spots for SRR21853536.sra Written 1168712 spots for SRR21853536.sra Read 1168712 spots for SRR21853536.sra Written 1168712 spots for SRR21853536.sra Read 1168712 spots for SRR21853536.sra Written 1168712 spots for SRR21853536.sra Read 1168712 spots for SRR21853536.sra Written 1168712 spots for SRR21853536.sra Read 1168712 spots for SRR21853536.sra Written 1168712 spots for SRR21853536.sra Read 1168728 spots for SRR21853536.sra Written 1168728 spots for SRR21853536.sra Read 1168712 spots for SRR21853536.sra Written 1168712 spots for SRR21853536.sra Read 1168712 spots for SRR21853536.sra Written 1168712 spots for SRR21853536.sra Read 1168712 spots for SRR21853536.sra Written 1168712 spots for SRR21853536.sra Read 1168712 spots for SRR21853536.sra Written 1168712 spots for SRR21853536.sra Read 1168712 spots for SRR21853536.sra Written 1168712 spots for SRR21853536.sra Read 1168712 spots for SRR21853536.sra Written 1168712 spots for SRR21853536.sra Read 1168712 spots for SRR21853536.sra Written 1168712 spots for SRR21853536.sra Read 1168712 spots for SRR21853536.sra Written 1168712 spots for SRR21853536.sra Read 1168712 spots for SRR21853536.sra Written 1168712 spots for SRR21853536.sra Read 1168712 spots for SRR21853536.sra Written 1168712 spots for SRR21853536.sra Read 1168712 spots for SRR21853536.sra Written 1168712 spots for SRR21853536.sra SRR ids: ['SRR21853536.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_d12f0k6v SRR21853536.sra spots: 23374256 blocks: [[1, 1168712], [1168713, 2337424], [2337425, 3506136], [3506137, 4674848], [4674849, 5843560], [5843561, 7012272], [7012273, 8180984], [8180985, 9349696], [9349697, 10518408], [10518409, 11687120], [11687121, 12855832], [12855833, 14024544], [14024545, 15193256], [15193257, 16361968], [16361969, 17530680], [17530681, 18699392], [18699393, 19868104], [19868105, 21036816], [21036817, 22205528], [22205529, 23374256]] SRR21853536 file size 6299349 SRR21853536 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR21853536 SRR21853536_1.fastq Input file: SRR21853536_1.fastq trimmed: SRR21853536-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Fri Dec 6 17:21:05 2024 >> started Fri Dec 6 17:21:24 2024 >> done (19.408s) 23374256 reads processed; of these: 26 ( 0.00%) short reads filtered out after trimming by size control 67614 ( 0.29%) empty reads filtered out after trimming by size control 23306616 (99.71%) reads available; of these: 464 ( 0.00%) trimmed reads available after processing 23306152 (100.00%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 2 0.00% 20 1 0.00% 21 1 0.00% 22 3 0.00% 23 1 0.00% 24 5 0.00% 25 4 0.00% 26 7 0.00% 27 4 0.00% 28 8 0.00% 29 0 0.00% 30 11 0.00% 31 4 0.00% 32 10 0.00% 33 6 0.00% 34 7 0.00% 35 139 0.00% 36 146 0.00% 37 131 0.00% 38 118 0.00% 39 127 0.00% 40 141 0.00% 41 146 0.00% 42 116 0.00% 43 137 0.00% 44 149 0.00% 45 137 0.00% 46 147 0.00% 47 176 0.00% 48 167 0.00% 49 172 0.00% 50 172 0.00% 51 176 0.00% 52 186 0.00% 53 212 0.00% 54 159 0.00% 55 190 0.00% 56 167 0.00% 57 200 0.00% 58 214 0.00% 59 236 0.00% 60 246 0.00% 61 253 0.00% 62 246 0.00% 63 270 0.00% 64 224 0.00% 65 260 0.00% 66 257 0.00% 67 270 0.00% 68 274 0.00% 69 293 0.00% 70 293 0.00% 71 318 0.00% 72 309 0.00% 73 305 0.00% 74 370 0.00% 75 351 0.00% 76 387 0.00% 77 400 0.00% 78 479 0.00% 79 412 0.00% 80 441 0.00% 81 501 0.00% 82 456 0.00% 83 551 0.00% 84 603 0.00% 85 603 0.00% 86 598 0.00% 87 685 0.00% 88 744 0.00% 89 785 0.00% 90 907 0.00% 91 1472 0.01% 92 938 0.00% 93 1113 0.00% 94 2118 0.01% 95 6874 0.03% 96 33653 0.14% 97 103158 0.44% 98 411291 1.76% 99 1560910 6.70% 100 5123160 21.98% 101 16044702 68.84% 23306616 reads passed initial QC criterion=sequence-density sequence-density=0.31 sequence-density-rank=1 fanout-score=2.41 fanout-score-rank=23 prefix-density=0.32 prefix-fanout=2.3 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.12 sequence-density-rank=26 fanout-score=171.69 fanout-score-rank=1 prefix-density=0.95 prefix-fanout=22.4 sequence=CGCCGCCGCCGC Started job on | Dec 06 17:21:41 Started mapping on | Dec 06 17:21:42 Finished on | Dec 06 17:22:09 Mapping speed, Million of reads per hour | 3107.55 Number of input reads | 23306616 Average input read length | 100 UNIQUE READS: Uniquely mapped reads number | 22211301 Uniquely mapped reads % | 95.30% Average mapped length | 100.25 Number of splices: Total | 7501433 Number of splices: Annotated (sjdb) | 7136823 Number of splices: GT/AG | 7397529 Number of splices: GC/AG | 90223 Number of splices: AT/AC | 4037 Number of splices: Non-canonical | 9644 Mismatch rate per base, % | 0.27% Deletion rate per base | 0.00% Deletion average length | 1.79 Insertion rate per base | 0.00% Insertion average length | 1.32 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 504929 % of reads mapped to multiple loci | 2.17% Number of reads mapped to too many loci | 333221 % of reads mapped to too many loci | 1.43% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.91% % of reads unmapped: other | 0.20% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 590386 590386 590386 N_multimapping 504929 504929 504929 N_noFeature 728537 11315082 11317037 N_ambiguous 344612 19625 19682 UnstrandedReadsAssigned:21138152 PositiveStrandReadsAssigned:10876594 NegativeStrandReadsAssigned:10874582 Dataset is classified unstranded MeadianReadLen=101 20thPercentileLength=100 echo kmer=95 SRR21853536 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR21853536-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 23,306,616 reads, 21,755,699 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,141 rounds 52973 SRR21853536.ke.tsv 35125 SRR21853536.se.tsv 88098 total ==> SRR21853536.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 74.7654 6.57844 PNS24247 1044 945 31.5605 2.45957 PNS24249 1928 1829 204.198 8.22214 PNS24246 1044 945 31.5605 2.45957 PNS24248 1044 945 31.5605 2.45957 PNS24244 1471 1372 11.3554 0.609533 PNS24243 293 194 24 9.11082 KQK14069 1603 1504 1708.05 83.6373 KQK14071 474 375 396.58 77.8839 ==> SRR21853536.se.tsv <== BRADI_1g14170v3 2404 BRADI_1g53295v3 77 BRADI_1g59795v3 403 BRADI_1g07683v3 0 BRADI_1g00485v3 74 BRADI_1g20270v3 2953 BRADI_1g74790v3 94 BRADI_1g09890v3 11 BRADI_1g77505v3 256 BRADI_1g48960v3 0 SRR21853536 completed mapping pipeline successfully