Starting /dee2/code/volunteer_pipeline.sh SRR21853537 current disk space = 1550613499904 free memory = 1599494052 SRR21853537 SRAfilesize a12ec3c0b90a2f8d4d046b3c88133722 SRR21853537.sra SRR21853537.sra file validated SRR21853537 is single end SRR21853537 is conventional basespace SRR21853537 read1 length is 58-101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR21853537_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 58-101 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.071 37.0 37.0 37.0 25.0 37.0 2 34.87775 37.0 37.0 37.0 25.0 37.0 3 35.7445 37.0 37.0 37.0 37.0 37.0 4 35.7845 37.0 37.0 37.0 37.0 37.0 5 35.9915 37.0 37.0 37.0 37.0 37.0 6 35.9125 37.0 37.0 37.0 37.0 37.0 7 35.6195 37.0 37.0 37.0 37.0 37.0 8 35.9625 37.0 37.0 37.0 37.0 37.0 9 35.907 37.0 37.0 37.0 37.0 37.0 10-11 36.0415 37.0 37.0 37.0 37.0 37.0 12-13 36.0115 37.0 37.0 37.0 37.0 37.0 14-15 35.98325 37.0 37.0 37.0 37.0 37.0 16-17 36.102500000000006 37.0 37.0 37.0 37.0 37.0 18-19 35.9525 37.0 37.0 37.0 37.0 37.0 20-21 36.035 37.0 37.0 37.0 37.0 37.0 22-23 35.92075 37.0 37.0 37.0 37.0 37.0 24-25 35.91575 37.0 37.0 37.0 37.0 37.0 26-27 35.76375 37.0 37.0 37.0 37.0 37.0 28-29 35.8615 37.0 37.0 37.0 37.0 37.0 30-31 35.7885 37.0 37.0 37.0 37.0 37.0 32-33 35.76375 37.0 37.0 37.0 37.0 37.0 34-35 35.75075 37.0 37.0 37.0 37.0 37.0 36-37 35.711749999999995 37.0 37.0 37.0 37.0 37.0 38-39 35.801 37.0 37.0 37.0 37.0 37.0 40-41 35.70025 37.0 37.0 37.0 37.0 37.0 42-43 35.65675 37.0 37.0 37.0 37.0 37.0 44-45 35.051249999999996 37.0 37.0 37.0 31.0 37.0 46-47 35.414500000000004 37.0 37.0 37.0 31.0 37.0 48-49 34.653000000000006 37.0 37.0 37.0 25.0 37.0 50-51 35.266000000000005 37.0 37.0 37.0 31.0 37.0 52-53 35.1455 37.0 37.0 37.0 31.0 37.0 54-55 35.1495 37.0 37.0 37.0 31.0 37.0 56-57 34.62575 37.0 37.0 37.0 25.0 37.0 58-59 34.88744573643411 37.0 37.0 37.0 25.0 37.0 60-61 34.90745372686343 37.0 37.0 37.0 31.0 37.0 62-63 34.36618309154577 37.0 37.0 37.0 25.0 37.0 64-65 35.0847923961981 37.0 37.0 37.0 25.0 37.0 66-67 34.53001500750375 37.0 37.0 37.0 25.0 37.0 68-69 34.31715857928965 37.0 37.0 37.0 25.0 37.0 70-71 34.06453226613307 37.0 37.0 37.0 25.0 37.0 72-73 35.00600300150075 37.0 37.0 37.0 25.0 37.0 74-75 35.37202902176632 37.0 37.0 37.0 31.0 37.0 76-77 35.39729797348011 37.0 37.0 37.0 31.0 37.0 78-79 35.52314235676758 37.0 37.0 37.0 37.0 37.0 80-81 35.46985238929197 37.0 37.0 37.0 37.0 37.0 82-83 35.472854640980735 37.0 37.0 37.0 37.0 37.0 84-85 35.385789342006504 37.0 37.0 37.0 37.0 37.0 86-87 35.40323285228142 37.0 37.0 37.0 37.0 37.0 88-89 35.44903581267218 37.0 37.0 37.0 37.0 37.0 90-91 35.35191350645192 37.0 37.0 37.0 37.0 37.0 92-93 35.458719179777745 37.0 37.0 37.0 37.0 37.0 94-95 35.467903308892744 37.0 37.0 37.0 37.0 37.0 96-97 35.44480611088123 37.0 37.0 37.0 37.0 37.0 98-99 35.40383878536387 37.0 37.0 37.0 37.0 37.0 100-101 35.41288841924512 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100-101 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 16 1.0 17 0.0 18 0.0 19 0.0 20 1.0 21 0.0 22 1.0 23 3.0 24 3.0 25 7.0 26 13.0 27 17.0 28 38.0 29 49.0 30 85.0 31 118.0 32 232.0 33 234.0 34 220.0 35 483.0 36 2000.0 37 495.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 28.799999999999997 12.55 17.925 40.725 2 23.65155735629273 25.069637883008355 29.349202329703722 21.92960243099519 3 25.1 23.35 27.075 24.474999999999998 4 25.15 27.175 19.15 28.525 5 31.25 29.45 20.125 19.175 6 25.5 32.45 20.775 21.275 7 19.7 20.150000000000002 37.475 22.675 8 21.224999999999998 28.349999999999998 22.400000000000002 28.025 9 27.05 19.8 27.125 26.025 10-11 26.8125 30.425 19.025 23.7375 12-13 21.775 24.3 25.087500000000002 28.8375 14-15 22.537499999999998 26.075 24.1375 27.250000000000004 16-17 26.450000000000003 22.875 22.912499999999998 27.762500000000003 18-19 22.5875 23.8875 26.325 27.200000000000003 20-21 25.8625 24.474999999999998 25.7125 23.95 22-23 22.162499999999998 29.6375 24.025 24.175 24-25 23.3125 23.5125 26.400000000000002 26.775 26-27 23.225 24.1125 23.3875 29.275000000000002 28-29 26.474999999999998 26.8375 22.725 23.962500000000002 30-31 23.400000000000002 23.3125 26.8625 26.424999999999997 32-33 23.325000000000003 27.025 22.7625 26.887499999999996 34-35 23.474999999999998 26.825 26.200000000000003 23.5 36-37 21.8125 26.224999999999998 27.425 24.5375 38-39 23.3875 22.975 25.55 28.0875 40-41 26.224999999999998 22.8625 23.225 27.6875 42-43 23.5375 26.325 26.275 23.8625 44-45 22.525000000000002 24.5375 25.575 27.3625 46-47 26.4125 23.3625 22.9875 27.237499999999997 48-49 23.974999999999998 26.5875 25.837500000000002 23.599999999999998 50-51 25.825 23.6125 26.737499999999997 23.825 52-53 22.9875 23.4625 23.4125 30.1375 54-55 25.912499999999998 23.95 26.1125 24.025 56-57 24.9875 22.6875 25.124999999999996 27.200000000000003 58-59 24.0780097512189 23.365420677584698 26.453306663332913 26.103262907863485 60-61 26.663331665832917 23.54927463731866 25.587793896948476 24.19959979989995 62-63 24.92496248124062 23.3991995997999 25.3751875937969 26.300650325162582 64-65 25.775387693846923 22.873936968484244 26.87593796898449 24.474737368684345 66-67 22.086043021510758 28.414207103551774 24.424712356178087 25.07503751875938 68-69 23.374187093546773 29.127063531765884 23.499249624812407 23.999499749874936 70-71 27.863931965982992 23.449224612306153 24.349674837418707 24.337168584292147 72-73 29.277138569284645 23.3991995997999 23.336668334167083 23.986993496748372 74-75 29.772329246935204 23.405053790342755 22.692019014260694 24.130597948461347 76-77 28.809106830122595 23.380035026269702 23.642732049036777 24.168126094570926 78-79 28.896672504378284 23.95546659994996 22.254190642982234 24.893670252689517 80-81 29.234425819364525 23.755316487365523 22.942206654991242 24.06805103827871 82-83 28.383787840880657 23.742807105328996 23.46760070052539 24.405804353264948 84-85 28.7215411558669 23.705278959219413 23.517638228671505 24.055541656242184 86-87 29.18648310387985 23.566958698372968 23.241551939924907 24.005006257822277 88-89 29.514149762083647 23.190583521162033 22.777360380666163 24.517906336088156 90-91 29.855979962429558 23.681903569192237 22.517219787100814 23.944896681277395 92-93 29.81335337592384 22.98634598521859 23.149192033070275 24.0511086057873 94-95 29.07268170426065 22.907268170426065 23.145363408521302 24.87468671679198 96-97 29.4493916969773 23.52941176470588 22.939922237551738 24.08127430076508 98-99 29.630100419473752 23.503241388076777 22.613448582687173 24.2532096097623 100-101 31.772053083528494 10.101483216237314 28.508977361436376 29.617486338797818 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 5.0 1 2.5 2 1.0 3 1.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.5 19 0.5 20 0.5 21 0.5 22 0.0 23 1.5 24 2.5 25 3.5 26 3.0 27 2.0 28 5.5 29 7.5 30 6.0 31 10.0 32 17.5 33 22.0 34 25.0 35 31.0 36 49.5 37 66.5 38 76.0 39 94.0 40 106.0 41 125.0 42 147.5 43 147.0 44 153.5 45 154.5 46 170.0 47 174.0 48 149.0 49 151.5 50 142.5 51 127.5 52 141.0 53 136.5 54 107.5 55 91.0 56 85.5 57 80.0 58 78.5 59 86.5 60 80.0 61 68.0 62 66.5 63 68.5 64 109.0 65 122.5 66 91.0 67 78.0 68 56.5 69 39.0 70 31.5 71 34.5 72 36.5 73 25.0 74 20.5 75 20.5 76 15.5 77 12.0 78 12.5 79 7.5 80 5.5 81 6.5 82 4.5 83 2.0 84 0.0 85 0.5 86 0.5 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.5 97 0.5 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 1.275 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 58 1.0 59 1.0 60 0.0 61 0.0 62 0.0 63 0.0 64 0.0 65 0.0 66 0.0 67 0.0 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 1.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 1.0 86 2.0 87 1.0 88 0.0 89 0.0 90 1.0 91 0.0 92 1.0 93 0.0 94 2.0 95 0.0 96 5.0 97 17.0 98 67.0 99 248.0 100 899.0 101 2753.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 87.825 #Duplication Level Percentage of deduplicated Percentage of total 1 92.74124679760888 81.45 2 6.604042129234272 11.600000000000001 3 0.48391688015940787 1.275 4 0.0 0.0 5 0.0569313976658127 0.25 6 0.0569313976658127 0.3 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.02846569883290635 1.075 >50 0.0 0.0 >100 0.02846569883290635 4.05 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACATTACTCGATCTCGTAT 162 4.05 TruSeq Adapter, Index 27 (97% over 39bp) GATCGGAAGAGCACACGTCTGAACTCCAGTCACATTACTCGATCGCGTAT 43 1.075 TruSeq Adapter, Index 27 (97% over 39bp) GATCGGAAGAGCACACGTCTGAACTCCAGTCACATTACTCGATCTCGTTT 6 0.15 TruSeq Adapter, Index 27 (97% over 39bp) GATCGGAAGAGCACACGTCTGAACTCCAGTCACATTACTCGATCTCGGAT 6 0.15 TruSeq Adapter, Index 27 (97% over 39bp) AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA 5 0.125 No Hit GNTCGGAAGAGCACACGTCTGAACTCCAGTCACATTACTCGATCTCGTAT 5 0.125 TruSeq Adapter, Index 27 (97% over 36bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content fail #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GATCGGA 30 8.934876E-9 95.734184 1 ATCGGAA 30 8.934876E-9 95.734184 2 TCGGAAG 30 9.786163E-9 94.5375 3 AGAGCAC 30 9.786163E-9 94.5375 8 AAGAGCA 35 2.854722E-8 81.03214 7 GAGCACA 35 2.854722E-8 81.03214 9 CGGAAGA 35 2.854722E-8 81.03214 4 GGAAGAG 35 2.854722E-8 81.03214 5 GAAGAGC 40 7.208291E-8 70.90313 6 ACACGTC 30 1.3587432E-6 47.26875 12-13 ACTCGAT 30 1.3587432E-6 47.26875 36-37 CACATTA 30 1.3587432E-6 47.26875 30-31 ATCTCGT 20 5.195413E-4 47.26875 42-43 CAGTCAC 30 1.3587432E-6 47.26875 26-27 GTCACAT 30 1.3587432E-6 47.26875 28-29 CACACGT 30 1.3587432E-6 47.26875 12-13 TCGATCT 20 5.195413E-4 47.26875 38-39 ACGTCTG 30 1.3587432E-6 47.26875 14-15 TGCCGTC 30 1.3587432E-6 47.26875 50-51 TTACTCG 30 1.3587432E-6 47.26875 34-35 >>END_MODULE Read 914718 spots for SRR21853537.sra Written 914718 spots for SRR21853537.sra Read 914718 spots for SRR21853537.sra Written 914718 spots for SRR21853537.sra Read 914718 spots for SRR21853537.sra Written 914718 spots for SRR21853537.sra Read 914718 spots for SRR21853537.sra Written 914718 spots for SRR21853537.sra Read 914718 spots for SRR21853537.sra Written 914718 spots for SRR21853537.sra Read 914718 spots for SRR21853537.sra Written 914718 spots for SRR21853537.sra Read 914718 spots for SRR21853537.sra Written 914718 spots for SRR21853537.sra Read 914718 spots for SRR21853537.sra Written 914718 spots for SRR21853537.sra Read 914718 spots for SRR21853537.sra Written 914718 spots for SRR21853537.sra Read 914718 spots for SRR21853537.sra Written 914718 spots for SRR21853537.sra Read 914718 spots for SRR21853537.sra Written 914718 spots for SRR21853537.sra Read 914718 spots for SRR21853537.sra Written 914718 spots for SRR21853537.sra Read 914718 spots for SRR21853537.sra Written 914718 spots for SRR21853537.sra Read 914718 spots for SRR21853537.sra Written 914718 spots for SRR21853537.sra Read 914718 spots for SRR21853537.sra Written 914718 spots for SRR21853537.sra Read 914718 spots for SRR21853537.sra Written 914718 spots for SRR21853537.sra Read 914718 spots for SRR21853537.sra Written 914718 spots for SRR21853537.sra Read 914718 spots for SRR21853537.sra Written 914718 spots for SRR21853537.sra Read 914718 spots for SRR21853537.sra Written 914718 spots for SRR21853537.sra Read 914724 spots for SRR21853537.sra Written 914724 spots for SRR21853537.sra SRR ids: ['SRR21853537.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_xhlux57d SRR21853537.sra spots: 18294366 blocks: [[1, 914718], [914719, 1829436], [1829437, 2744154], [2744155, 3658872], [3658873, 4573590], [4573591, 5488308], [5488309, 6403026], [6403027, 7317744], [7317745, 8232462], [8232463, 9147180], [9147181, 10061898], [10061899, 10976616], [10976617, 11891334], [11891335, 12806052], [12806053, 13720770], [13720771, 14635488], [14635489, 15550206], [15550207, 16464924], [16464925, 17379642], [17379643, 18294366]] SRR21853537 file size 4927893 SRR21853537 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR21853537 SRR21853537_1.fastq Input file: SRR21853537_1.fastq trimmed: SRR21853537-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Fri Dec 6 17:22:16 2024 >> started Fri Dec 6 17:22:26 2024 >> done (10.251s) 18294366 reads processed; of these: 77 ( 0.00%) short reads filtered out after trimming by size control 991847 ( 5.42%) empty reads filtered out after trimming by size control 17302442 (94.58%) reads available; of these: 479 ( 0.00%) trimmed reads available after processing 17301963 (100.00%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 2 0.00% 20 0 0.00% 21 1 0.00% 22 0 0.00% 23 3 0.00% 24 4 0.00% 25 7 0.00% 26 2 0.00% 27 4 0.00% 28 5 0.00% 29 4 0.00% 30 6 0.00% 31 9 0.00% 32 3 0.00% 33 6 0.00% 34 8 0.00% 35 98 0.00% 36 70 0.00% 37 77 0.00% 38 105 0.00% 39 94 0.00% 40 101 0.00% 41 94 0.00% 42 97 0.00% 43 101 0.00% 44 113 0.00% 45 123 0.00% 46 120 0.00% 47 136 0.00% 48 134 0.00% 49 176 0.00% 50 205 0.00% 51 171 0.00% 52 177 0.00% 53 201 0.00% 54 183 0.00% 55 187 0.00% 56 204 0.00% 57 246 0.00% 58 265 0.00% 59 301 0.00% 60 313 0.00% 61 338 0.00% 62 302 0.00% 63 308 0.00% 64 330 0.00% 65 314 0.00% 66 337 0.00% 67 372 0.00% 68 385 0.00% 69 436 0.00% 70 445 0.00% 71 483 0.00% 72 473 0.00% 73 532 0.00% 74 536 0.00% 75 535 0.00% 76 631 0.00% 77 582 0.00% 78 684 0.00% 79 729 0.00% 80 724 0.00% 81 857 0.00% 82 864 0.00% 83 964 0.01% 84 956 0.01% 85 1101 0.01% 86 1176 0.01% 87 1252 0.01% 88 1226 0.01% 89 1361 0.01% 90 1562 0.01% 91 2372 0.01% 92 1733 0.01% 93 2068 0.01% 94 2780 0.02% 95 5638 0.03% 96 24671 0.14% 97 84282 0.49% 98 318486 1.84% 99 1157316 6.69% 100 3991255 23.07% 101 11686889 67.54% 17302442 reads passed initial QC criterion=sequence-density sequence-density=0.18 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=31 prefix-density=0.17 prefix-fanout=2.0 sequence=CCGTCAATTCCTTT criterion=fanout-score sequence-density=0.08 sequence-density-rank=16 fanout-score=165.33 fanout-score-rank=1 prefix-density=0.64 prefix-fanout=21.1 sequence=CCGCCGCCGCCG Started job on | Dec 06 17:22:44 Started mapping on | Dec 06 17:22:44 Finished on | Dec 06 17:23:14 Mapping speed, Million of reads per hour | 2076.29 Number of input reads | 17302442 Average input read length | 100 UNIQUE READS: Uniquely mapped reads number | 15318883 Uniquely mapped reads % | 88.54% Average mapped length | 100.22 Number of splices: Total | 5509041 Number of splices: Annotated (sjdb) | 5196520 Number of splices: GT/AG | 5433637 Number of splices: GC/AG | 64965 Number of splices: AT/AC | 3296 Number of splices: Non-canonical | 7143 Mismatch rate per base, % | 0.28% Deletion rate per base | 0.00% Deletion average length | 1.60 Insertion rate per base | 0.00% Insertion average length | 1.31 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 751580 % of reads mapped to multiple loci | 4.34% Number of reads mapped to too many loci | 846057 % of reads mapped to too many loci | 4.89% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.47% % of reads unmapped: other | 0.76% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1231979 1231979 1231979 N_multimapping 751580 751580 751580 N_noFeature 967007 8045517 8037075 N_ambiguous 231129 14255 15016 UnstrandedReadsAssigned:14120747 PositiveStrandReadsAssigned:7259111 NegativeStrandReadsAssigned:7266792 Dataset is classified unstranded MeadianReadLen=101 20thPercentileLength=100 echo kmer=95 SRR21853537 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR21853537-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,302,442 reads, 14,705,226 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,142 rounds 52973 SRR21853537.ke.tsv 35125 SRR21853537.se.tsv 88098 total ==> SRR21853537.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 89.7567 12.6672 PNS24247 1044 945 29.1667 3.64582 PNS24249 1928 1829 153.973 9.94425 PNS24246 1044 945 29.1667 3.64582 PNS24248 1044 945 29.1667 3.64582 PNS24244 1471 1372 21.7699 1.87431 PNS24243 293 194 47 28.6178 KQK14069 1603 1504 6355.74 499.181 KQK14071 474 375 725.042 228.387 ==> SRR21853537.se.tsv <== BRADI_1g14170v3 7387 BRADI_1g53295v3 95 BRADI_1g59795v3 266 BRADI_1g07683v3 0 BRADI_1g00485v3 42 BRADI_1g20270v3 570 BRADI_1g74790v3 177 BRADI_1g09890v3 0 BRADI_1g77505v3 156 BRADI_1g48960v3 0 SRR21853537 completed mapping pipeline successfully