Starting /dee2/code/volunteer_pipeline.sh SRR21853539 current disk space = 1550610022400 free memory = 1603769916 SRR21853539 SRAfilesize 80047de5336d0b4bc7462e3999e2a47c SRR21853539.sra SRR21853539.sra file validated SRR21853539 is single end SRR21853539 is conventional basespace SRR21853539 read1 length is 47-101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR21853539_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 47-101 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.188 37.0 37.0 37.0 25.0 37.0 2 35.0585 37.0 37.0 37.0 25.0 37.0 3 35.6725 37.0 37.0 37.0 37.0 37.0 4 35.676 37.0 37.0 37.0 37.0 37.0 5 35.932 37.0 37.0 37.0 37.0 37.0 6 35.8465 37.0 37.0 37.0 37.0 37.0 7 35.69 37.0 37.0 37.0 37.0 37.0 8 35.8345 37.0 37.0 37.0 37.0 37.0 9 35.9565 37.0 37.0 37.0 37.0 37.0 10-11 35.93075 37.0 37.0 37.0 37.0 37.0 12-13 35.8195 37.0 37.0 37.0 37.0 37.0 14-15 35.866749999999996 37.0 37.0 37.0 37.0 37.0 16-17 35.95575 37.0 37.0 37.0 37.0 37.0 18-19 35.857749999999996 37.0 37.0 37.0 37.0 37.0 20-21 35.919250000000005 37.0 37.0 37.0 37.0 37.0 22-23 35.91275 37.0 37.0 37.0 37.0 37.0 24-25 35.8785 37.0 37.0 37.0 37.0 37.0 26-27 35.766 37.0 37.0 37.0 37.0 37.0 28-29 35.72625 37.0 37.0 37.0 37.0 37.0 30-31 35.756249999999994 37.0 37.0 37.0 37.0 37.0 32-33 35.71775 37.0 37.0 37.0 37.0 37.0 34-35 35.7685 37.0 37.0 37.0 37.0 37.0 36-37 35.70025 37.0 37.0 37.0 37.0 37.0 38-39 35.645250000000004 37.0 37.0 37.0 37.0 37.0 40-41 35.5595 37.0 37.0 37.0 37.0 37.0 42-43 35.614999999999995 37.0 37.0 37.0 37.0 37.0 44-45 35.3625 37.0 37.0 37.0 37.0 37.0 46-47 35.52525 37.0 37.0 37.0 37.0 37.0 48-49 35.576644161040264 37.0 37.0 37.0 37.0 37.0 50-51 35.545886471617905 37.0 37.0 37.0 37.0 37.0 52-53 35.63140785196299 37.0 37.0 37.0 37.0 37.0 54-55 35.53263315828957 37.0 37.0 37.0 37.0 37.0 56-57 35.46636659164791 37.0 37.0 37.0 37.0 37.0 58-59 35.38309577394348 37.0 37.0 37.0 37.0 37.0 60-61 35.385096274068516 37.0 37.0 37.0 31.0 37.0 62-63 35.36134033508377 37.0 37.0 37.0 37.0 37.0 64-65 35.37334333583396 37.0 37.0 37.0 37.0 37.0 66-67 35.23205801450363 37.0 37.0 37.0 25.0 37.0 68-69 35.07376844211053 37.0 37.0 37.0 25.0 37.0 70-71 35.03950987746937 37.0 37.0 37.0 25.0 37.0 72-73 35.34283570892723 37.0 37.0 37.0 37.0 37.0 74-75 35.40164724772989 37.0 37.0 37.0 37.0 37.0 76-77 35.35321494873031 37.0 37.0 37.0 37.0 37.0 78-79 35.389542156617466 37.0 37.0 37.0 37.0 37.0 80-81 35.38153615211409 37.0 37.0 37.0 37.0 37.0 82-83 35.29622216662497 37.0 37.0 37.0 37.0 37.0 84-85 35.27070302727046 37.0 37.0 37.0 31.0 37.0 86-87 35.34375781836377 37.0 37.0 37.0 31.0 37.0 88-89 35.2849637227921 37.0 37.0 37.0 37.0 37.0 90-91 35.41105829372029 37.0 37.0 37.0 37.0 37.0 92-93 35.45345345345345 37.0 37.0 37.0 37.0 37.0 94-95 35.36270337922403 37.0 37.0 37.0 37.0 37.0 96-97 35.29843109382465 37.0 37.0 37.0 31.0 37.0 98-99 35.26830246713254 37.0 37.0 37.0 31.0 37.0 100-101 35.08743346075524 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100-101 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 18 1.0 19 0.0 20 0.0 21 0.0 22 0.0 23 5.0 24 5.0 25 7.0 26 19.0 27 30.0 28 35.0 29 45.0 30 77.0 31 91.0 32 159.0 33 170.0 34 284.0 35 464.0 36 2107.0 37 501.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 29.9 13.225000000000001 16.900000000000002 39.975 2 24.974849094567407 21.830985915492956 28.87323943661972 24.32092555331992 3 25.674999999999997 23.525 24.625 26.174999999999997 4 25.474999999999998 28.050000000000004 18.099999999999998 28.375 5 31.3 28.125 19.85 20.724999999999998 6 22.425 35.15 19.8 22.625 7 20.175 17.525 38.625 23.674999999999997 8 22.225 21.8 24.2 31.775 9 23.275000000000002 19.45 27.775 29.5 10-11 26.0 27.1 20.7375 26.1625 12-13 23.7375 22.15 26.337500000000002 27.775 14-15 23.3875 24.15 24.6625 27.800000000000004 16-17 25.85 22.9625 24.0 27.187499999999996 18-19 24.85 24.2 24.837500000000002 26.1125 20-21 25.224999999999998 24.1125 24.825 25.837500000000002 22-23 24.2375 25.4875 23.5125 26.7625 24-25 23.9375 24.6625 25.4875 25.912499999999998 26-27 23.925 23.95 23.2625 28.8625 28-29 26.0125 24.4375 24.025 25.525 30-31 24.9375 23.1875 25.124999999999996 26.75 32-33 24.575 25.7625 23.575 26.087500000000002 34-35 24.75 25.324999999999996 23.75 26.174999999999997 36-37 25.5125 24.0625 23.4625 26.9625 38-39 24.9375 25.9625 23.0625 26.0375 40-41 26.8125 24.5625 22.2125 26.4125 42-43 24.5 25.1875 25.912499999999998 24.4 44-45 25.5375 24.3875 24.1625 25.912499999999998 46-47 26.3125 24.1125 23.225 26.35 48-49 23.88097024256064 24.593648412103025 25.51887971992998 26.006501625406354 50-51 25.693923480870218 23.63090772693173 25.243810952738183 25.431357839459867 52-53 25.28132033008252 24.18104526131533 22.168042010502624 28.369592398099524 54-55 25.818954738684667 24.356089022255563 24.44361090272568 25.381345336334082 56-57 25.30632658164541 24.06851712928232 24.043510877719427 26.581645411352838 58-59 24.268567141785446 23.868467116779193 25.806451612903224 26.056514128532132 60-61 24.968742185546386 24.343585896474117 24.81870467616904 25.868967241810452 62-63 24.306076519129782 24.10602650662666 24.956239059764943 26.63165791447862 64-65 25.668917229307326 23.168292073018254 24.868717179294826 26.294073518379594 66-67 25.343835958989747 25.731432858214554 23.118279569892472 25.806451612903224 68-69 24.456114028507127 25.23130782695674 23.74343585896474 26.569142285571395 70-71 27.419354838709676 23.568392098024507 23.20580145036259 25.806451612903224 72-73 26.294073518379594 22.918229557389346 24.06851712928232 26.71917979494874 74-75 27.022633487557833 24.02150806552457 23.183693885206953 25.772164561710643 76-77 27.34208880550344 23.42714196372733 23.239524702939338 25.991244527829892 78-79 26.53239929947461 24.468351263447584 23.555166374781088 25.444083062296723 80-81 27.52064048036027 23.967975981986488 22.75456592444333 25.756817613209908 82-83 26.90768076057043 24.080560420315237 23.8804103077308 25.13134851138354 84-85 26.8951713785339 24.093069802351764 23.35501626219665 25.65674255691769 86-87 27.282962221666253 23.605203902927197 23.555166374781088 25.55666750062547 88-89 28.083562672004003 23.63022266700025 23.455091318488865 24.83112334250688 90-91 27.383037277958465 23.855391543657746 22.9672254190643 25.794345759319487 92-93 26.43893893893894 23.523523523523522 23.173173173173172 26.864364364364363 94-95 27.02127659574468 23.717146433041304 23.779724655819777 25.481852315394242 96-97 26.951509835860165 24.320260618970053 23.267760932214006 25.460468612955772 98-99 27.44227353463588 21.783811215427555 24.473483887338237 26.300431362598324 100-101 28.700670722196225 10.279207611917016 29.480580252690686 31.53954141319607 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 2.0 1 1.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 1.0 13 1.0 14 0.0 15 0.0 16 0.0 17 0.0 18 1.0 19 1.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 1.0 26 2.5 27 3.0 28 4.0 29 5.0 30 8.0 31 9.0 32 12.0 33 18.0 34 23.0 35 29.0 36 43.0 37 59.5 38 71.5 39 87.0 40 93.5 41 116.5 42 138.0 43 152.0 44 174.0 45 173.0 46 157.0 47 152.0 48 160.5 49 156.0 50 139.0 51 124.5 52 114.5 53 107.5 54 114.0 55 110.5 56 92.0 57 86.5 58 89.0 59 85.5 60 81.0 61 80.0 62 74.0 63 69.0 64 72.0 65 98.0 66 104.0 67 75.0 68 60.5 69 55.5 70 55.0 71 54.0 72 47.5 73 40.5 74 27.5 75 18.0 76 19.0 77 21.0 78 12.5 79 6.5 80 7.5 81 3.5 82 1.5 83 1.0 84 0.0 85 0.5 86 0.5 87 0.0 88 0.0 89 0.5 90 0.5 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.5 99 0.5 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.6 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 46-47 1.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 1.0 76-77 1.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 1.0 92-93 1.0 94-95 3.0 96-97 16.0 98-99 325.0 100-101 3651.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 89.64999999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 91.07640825432236 81.65 2 8.1148912437256 14.549999999999999 3 0.7250418293363079 1.95 4 0.027886224205242612 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.027886224205242612 0.3 >50 0.027886224205242612 1.4500000000000002 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACAGCGATAGATCTCGTAT 58 1.4500000000000002 TruSeq Adapter, Index 1 (97% over 36bp) GATCGGAAGAGCACACGTCTGAACTCCAGTCACAGCGATAGATCGCGTAT 12 0.3 TruSeq Adapter, Index 1 (97% over 36bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GAGCACA 20 1.5811493E-5 94.4875 9 ATCGGAA 20 1.5811493E-5 94.4875 2 AAGAGCA 25 4.7855745E-5 75.590004 7 GATCGGA 25 4.7855745E-5 75.590004 1 TCGGAAG 25 4.7855745E-5 75.590004 3 CGGAAGA 25 4.7855745E-5 75.590004 4 AGAGCAC 25 4.7855745E-5 75.590004 8 GAAGAGC 30 1.1810059E-4 62.991665 6 GGAAGAG 30 1.1810059E-4 62.991665 5 ACAGCGA 20 5.2089855E-4 47.24375 32-33 ACACGTC 20 5.2089855E-4 47.24375 12-13 AGGGGGG 20 5.2089855E-4 47.24375 68-69 GTATGCC 20 5.2089855E-4 47.24375 46-47 CAGTCAC 20 5.2089855E-4 47.24375 26-27 CGATAGA 20 5.2089855E-4 47.24375 36-37 CCAGTCA 20 5.2089855E-4 47.24375 26-27 GCGATAG 20 5.2089855E-4 47.24375 34-35 CACGTCT 20 5.2089855E-4 47.24375 14-15 TATGCCG 20 5.2089855E-4 47.24375 48-49 GAAAAGG 20 5.2089855E-4 47.24375 64-65 >>END_MODULE Read 426656 spots for SRR21853539.sra Written 426656 spots for SRR21853539.sra Read 426656 spots for SRR21853539.sra Written 426656 spots for SRR21853539.sra Read 426656 spots for SRR21853539.sra Written 426656 spots for SRR21853539.sra Read 426656 spots for SRR21853539.sra Written 426656 spots for SRR21853539.sra Read 426656 spots for SRR21853539.sra Written 426656 spots for SRR21853539.sra Read 426656 spots for SRR21853539.sra Written 426656 spots for SRR21853539.sra Read 426656 spots for SRR21853539.sra Written 426656 spots for SRR21853539.sra Read 426656 spots for SRR21853539.sra Written 426656 spots for SRR21853539.sra Read 426656 spots for SRR21853539.sra Written 426656 spots for SRR21853539.sra Read 426656 spots for SRR21853539.sra Written 426656 spots for SRR21853539.sra Read 426656 spots for SRR21853539.sra Written 426656 spots for SRR21853539.sra Read 426656 spots for SRR21853539.sra Written 426656 spots for SRR21853539.sra Read 426656 spots for SRR21853539.sra Written 426656 spots for SRR21853539.sra Read 426657 spots for SRR21853539.sra Written 426657 spots for SRR21853539.sra Read 426656 spots for SRR21853539.sra Written 426656 spots for SRR21853539.sra Read 426656 spots for SRR21853539.sra Written 426656 spots for SRR21853539.sra Read 426656 spots for SRR21853539.sra Written 426656 spots for SRR21853539.sra Read 426656 spots for SRR21853539.sra Written 426656 spots for SRR21853539.sra Read 426656 spots for SRR21853539.sra Written 426656 spots for SRR21853539.sra Read 426656 spots for SRR21853539.sra Written 426656 spots for SRR21853539.sra SRR ids: ['SRR21853539.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_fvapso7c SRR21853539.sra spots: 8533121 blocks: [[1, 426656], [426657, 853312], [853313, 1279968], [1279969, 1706624], [1706625, 2133280], [2133281, 2559936], [2559937, 2986592], [2986593, 3413248], [3413249, 3839904], [3839905, 4266560], [4266561, 4693216], [4693217, 5119872], [5119873, 5546528], [5546529, 5973184], [5973185, 6399840], [6399841, 6826496], [6826497, 7253152], [7253153, 7679808], [7679809, 8106464], [8106465, 8533121]] SRR21853539 file size 2294292 SRR21853539 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR21853539 SRR21853539_1.fastq Input file: SRR21853539_1.fastq trimmed: SRR21853539-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Fri Dec 6 17:26:24 2024 >> started Fri Dec 6 17:26:28 2024 >> done (4.078s) 8533121 reads processed; of these: 8 ( 0.00%) short reads filtered out after trimming by size control 162296 ( 1.90%) empty reads filtered out after trimming by size control 8370817 (98.10%) reads available; of these: 180 ( 0.00%) trimmed reads available after processing 8370637 (100.00%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 19 1 0.00% 20 0 0.00% 21 1 0.00% 22 0 0.00% 23 0 0.00% 24 1 0.00% 25 1 0.00% 26 0 0.00% 27 2 0.00% 28 2 0.00% 29 1 0.00% 30 2 0.00% 31 2 0.00% 32 1 0.00% 33 1 0.00% 34 3 0.00% 35 42 0.00% 36 34 0.00% 37 26 0.00% 38 37 0.00% 39 54 0.00% 40 52 0.00% 41 47 0.00% 42 52 0.00% 43 39 0.00% 44 45 0.00% 45 41 0.00% 46 67 0.00% 47 69 0.00% 48 53 0.00% 49 58 0.00% 50 66 0.00% 51 63 0.00% 52 71 0.00% 53 70 0.00% 54 81 0.00% 55 56 0.00% 56 76 0.00% 57 103 0.00% 58 97 0.00% 59 81 0.00% 60 88 0.00% 61 103 0.00% 62 113 0.00% 63 97 0.00% 64 100 0.00% 65 112 0.00% 66 99 0.00% 67 118 0.00% 68 113 0.00% 69 139 0.00% 70 136 0.00% 71 136 0.00% 72 144 0.00% 73 162 0.00% 74 152 0.00% 75 144 0.00% 76 143 0.00% 77 162 0.00% 78 201 0.00% 79 190 0.00% 80 193 0.00% 81 199 0.00% 82 207 0.00% 83 284 0.00% 84 280 0.00% 85 285 0.00% 86 289 0.00% 87 316 0.00% 88 352 0.00% 89 387 0.00% 90 409 0.00% 91 771 0.01% 92 478 0.01% 93 527 0.01% 94 872 0.01% 95 2319 0.03% 96 11444 0.14% 97 38361 0.46% 98 148736 1.78% 99 557816 6.66% 100 1884256 22.51% 101 5717886 68.31% 8370817 reads passed initial QC criterion=sequence-density sequence-density=0.22 sequence-density-rank=1 fanout-score=2.38 fanout-score-rank=19 prefix-density=0.23 prefix-fanout=2.3 sequence=CCATGGCACCCACCGTGATGGCTTCCTCCGCCACCTCCGTGGC criterion=fanout-score sequence-density=0.01 sequence-density-rank=36 fanout-score=8.62 fanout-score-rank=1 prefix-density=0.03 prefix-fanout=1.4 sequence=CATCCGACCCGTCTTGAAACACGGACCAAGGAGTCTGACATGCGTGCGAGTCGACGGGTTCTGAAACCTGGGATGCGCAAGGAAGCTGACGAGCGGGAGGCCCTCACGGGCCGCACCGCTGGCCGACCCTGATCTTCTGTGAAGGGTTCGAGTTGGAGCACGCCTGTCGGGACCCGAAAGATGGTGAACTATGCCTGAGCGGGGCGAAGCCAGAGGAA Started job on | Dec 06 17:26:45 Started mapping on | Dec 06 17:26:45 Finished on | Dec 06 17:26:57 Mapping speed, Million of reads per hour | 2511.25 Number of input reads | 8370817 Average input read length | 100 UNIQUE READS: Uniquely mapped reads number | 7412346 Uniquely mapped reads % | 88.55% Average mapped length | 100.23 Number of splices: Total | 2545150 Number of splices: Annotated (sjdb) | 2412219 Number of splices: GT/AG | 2509237 Number of splices: GC/AG | 30748 Number of splices: AT/AC | 1390 Number of splices: Non-canonical | 3775 Mismatch rate per base, % | 0.31% Deletion rate per base | 0.00% Deletion average length | 1.94 Insertion rate per base | 0.00% Insertion average length | 1.77 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 379752 % of reads mapped to multiple loci | 4.54% Number of reads mapped to too many loci | 397753 % of reads mapped to too many loci | 4.75% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.43% % of reads unmapped: other | 0.74% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 578719 578719 578719 N_multimapping 379752 379752 379752 N_noFeature 335411 3813791 3833730 N_ambiguous 116009 8609 7971 UnstrandedReadsAssigned:6960926 PositiveStrandReadsAssigned:3589946 NegativeStrandReadsAssigned:3570645 Dataset is classified unstranded MeadianReadLen=101 20thPercentileLength=100 echo kmer=95 SRR21853539 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR21853539-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 8,370,817 reads, 7,256,899 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,192 rounds 52973 SRR21853539.ke.tsv 35125 SRR21853539.se.tsv 88098 total ==> SRR21853539.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 9.85357 2.75257 PNS24247 1044 945 20.7821 5.14194 PNS24249 1928 1829 93.8003 11.9911 PNS24246 1044 945 20.7821 5.14194 PNS24248 1044 945 20.7821 5.14194 PNS24244 1471 1372 0 0 PNS24243 293 194 9 10.847 KQK14069 1603 1504 1879.02 292.115 KQK14071 474 375 318.317 198.472 ==> SRR21853539.se.tsv <== BRADI_1g14170v3 2451 BRADI_1g53295v3 63 BRADI_1g59795v3 112 BRADI_1g07683v3 0 BRADI_1g00485v3 34 BRADI_1g20270v3 700 BRADI_1g74790v3 69 BRADI_1g09890v3 4 BRADI_1g77505v3 110 BRADI_1g48960v3 0 SRR21853539 completed mapping pipeline successfully