Starting /dee2/code/volunteer_pipeline.sh SRR21853540 current disk space = 1550630846464 free memory = 1327397548 SRR21853540 SRAfilesize 10cf24a8b581319eb699be7b092a9c23 SRR21853540.sra SRR21853540.sra file validated SRR21853540 is single end SRR21853540 is conventional basespace SRR21853540 read1 length is 78-101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR21853540_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 78-101 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.306 37.0 37.0 37.0 37.0 37.0 2 35.6755 37.0 37.0 37.0 37.0 37.0 3 35.91575 37.0 37.0 37.0 37.0 37.0 4 35.9375 37.0 37.0 37.0 37.0 37.0 5 36.0395 37.0 37.0 37.0 37.0 37.0 6 36.0855 37.0 37.0 37.0 37.0 37.0 7 36.022 37.0 37.0 37.0 37.0 37.0 8 36.095 37.0 37.0 37.0 37.0 37.0 9 36.0985 37.0 37.0 37.0 37.0 37.0 10-11 36.08225 37.0 37.0 37.0 37.0 37.0 12-13 36.07175 37.0 37.0 37.0 37.0 37.0 14-15 36.06175 37.0 37.0 37.0 37.0 37.0 16-17 36.088499999999996 37.0 37.0 37.0 37.0 37.0 18-19 35.9945 37.0 37.0 37.0 37.0 37.0 20-21 35.966 37.0 37.0 37.0 37.0 37.0 22-23 36.019999999999996 37.0 37.0 37.0 37.0 37.0 24-25 35.893249999999995 37.0 37.0 37.0 37.0 37.0 26-27 35.903000000000006 37.0 37.0 37.0 37.0 37.0 28-29 35.764 37.0 37.0 37.0 37.0 37.0 30-31 35.812 37.0 37.0 37.0 37.0 37.0 32-33 35.747 37.0 37.0 37.0 37.0 37.0 34-35 35.79275 37.0 37.0 37.0 37.0 37.0 36-37 35.80275 37.0 37.0 37.0 37.0 37.0 38-39 35.636250000000004 37.0 37.0 37.0 37.0 37.0 40-41 35.74925 37.0 37.0 37.0 37.0 37.0 42-43 35.65075 37.0 37.0 37.0 37.0 37.0 44-45 35.55625 37.0 37.0 37.0 37.0 37.0 46-47 35.633750000000006 37.0 37.0 37.0 37.0 37.0 48-49 35.59625 37.0 37.0 37.0 37.0 37.0 50-51 35.582750000000004 37.0 37.0 37.0 37.0 37.0 52-53 35.582 37.0 37.0 37.0 37.0 37.0 54-55 35.6175 37.0 37.0 37.0 37.0 37.0 56-57 35.52425 37.0 37.0 37.0 37.0 37.0 58-59 35.42025 37.0 37.0 37.0 37.0 37.0 60-61 35.43625 37.0 37.0 37.0 37.0 37.0 62-63 35.369749999999996 37.0 37.0 37.0 37.0 37.0 64-65 35.44975 37.0 37.0 37.0 37.0 37.0 66-67 35.35675 37.0 37.0 37.0 37.0 37.0 68-69 35.3285 37.0 37.0 37.0 37.0 37.0 70-71 35.17375 37.0 37.0 37.0 25.0 37.0 72-73 35.27675 37.0 37.0 37.0 31.0 37.0 74-75 35.30975 37.0 37.0 37.0 31.0 37.0 76-77 35.272 37.0 37.0 37.0 31.0 37.0 78-79 35.26827050512628 37.0 37.0 37.0 31.0 37.0 80-81 35.391597899474874 37.0 37.0 37.0 37.0 37.0 82-83 35.264132066033014 37.0 37.0 37.0 37.0 37.0 84-85 35.3064032016008 37.0 37.0 37.0 31.0 37.0 86-87 35.27538769384692 37.0 37.0 37.0 31.0 37.0 88-89 35.19534767383692 37.0 37.0 37.0 25.0 37.0 90-91 34.89194597298649 37.0 37.0 37.0 25.0 37.0 92-93 35.02451225612806 37.0 37.0 37.0 25.0 37.0 94-95 35.20963903267621 37.0 37.0 37.0 25.0 37.0 96-97 35.008485520374634 37.0 37.0 37.0 25.0 37.0 98-99 34.979159761312296 37.0 37.0 37.0 25.0 37.0 100-101 34.884716724197986 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 2101 1 0.0 2101 2 0.0 2101 3 0.0 2101 4 0.0 2101 5 0.0 2101 6 0.0 2101 7 0.0 2101 8 0.0 2101 9 0.0 2101 10-11 0.0 2101 12-13 0.0 2101 14-15 0.0 2101 16-17 0.0 2101 18-19 0.0 2101 20-21 0.0 2101 22-23 0.0 2101 24-25 0.0 2101 26-27 0.0 2101 28-29 0.0 2101 30-31 0.0 2101 32-33 0.0 2101 34-35 0.0 2101 36-37 0.0 2101 38-39 0.0 2101 40-41 0.0 2101 42-43 0.0 2101 44-45 0.0 2101 46-47 0.0 2101 48-49 0.0 2101 50-51 0.0 2101 52-53 0.0 2101 54-55 0.0 2101 56-57 0.0 2101 58-59 0.0 2101 60-61 0.0 2101 62-63 0.0 2101 64-65 0.0 2101 66-67 0.0 2101 68-69 0.0 2101 70-71 0.0 2101 72-73 0.0 2101 74-75 0.0 2101 76-77 0.0 2101 78-79 0.0 2101 80-81 0.0 2101 82-83 0.0 2101 84-85 0.0 2101 86-87 0.0 2101 88-89 0.0 2101 90-91 0.0 2101 92-93 0.0 2101 94-95 0.0 2101 96-97 0.0 2101 98-99 0.0 2101 100-101 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 17 1.0 18 0.0 19 0.0 20 0.0 21 0.0 22 1.0 23 1.0 24 6.0 25 5.0 26 4.0 27 25.0 28 24.0 29 44.0 30 68.0 31 94.0 32 121.0 33 193.0 34 324.0 35 623.0 36 2066.0 37 400.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 31.715857928964482 12.131065532766383 17.658829414707352 38.494247123561784 2 26.174999999999997 19.575 30.2 24.05 3 26.431607901975497 23.78094523630908 23.030757689422355 26.756689172293076 4 27.900000000000002 28.625 18.224999999999998 25.25 5 30.049999999999997 28.95 20.3 20.7 6 22.625 33.300000000000004 21.125 22.95 7 20.4 17.4 37.974999999999994 24.224999999999998 8 23.65 20.75 24.075 31.525 9 23.75 21.025 28.475 26.75 10-11 26.6125 28.037499999999998 19.7625 25.587500000000002 12-13 23.4875 22.625 25.8625 28.025 14-15 23.8125 24.5125 24.837500000000002 26.8375 16-17 25.662499999999998 23.4125 23.6125 27.3125 18-19 24.9875 24.7875 24.55 25.674999999999997 20-21 25.05 24.875 24.1625 25.912499999999998 22-23 25.424999999999997 25.5625 23.0875 25.924999999999997 24-25 24.4875 24.5625 24.4 26.55 26-27 24.4125 24.9 23.35 27.3375 28-29 24.95 24.212500000000002 23.9 26.937499999999996 30-31 24.25 23.7 25.25 26.8 32-33 24.75 25.0 24.1375 26.1125 34-35 25.4 24.6 24.6 25.4 36-37 25.412499999999998 24.0125 24.125 26.450000000000003 38-39 24.4125 25.1 24.0625 26.424999999999997 40-41 25.424999999999997 24.1625 23.7875 26.625 42-43 24.5375 25.05 24.55 25.8625 44-45 24.5125 24.8125 24.375 26.3 46-47 25.412499999999998 24.65 23.3625 26.575 48-49 24.637500000000003 24.975 23.8375 26.55 50-51 25.474999999999998 24.2625 23.6375 26.625 52-53 25.1875 23.9375 23.1375 27.737499999999997 54-55 25.924999999999997 23.6375 24.525 25.912499999999998 56-57 25.3 24.1625 24.4125 26.125 58-59 25.374999999999996 23.7375 23.1625 27.725 60-61 26.450000000000003 23.674999999999997 24.8 25.074999999999996 62-63 24.887500000000003 24.0125 23.7625 27.3375 64-65 25.587500000000002 23.2125 24.8625 26.337500000000002 66-67 25.7875 24.9125 23.549999999999997 25.75 68-69 24.8625 24.887500000000003 24.3125 25.937500000000004 70-71 26.474999999999998 24.5625 23.0875 25.874999999999996 72-73 25.7375 24.1875 24.025 26.05 74-75 26.8 23.9875 22.900000000000002 26.3125 76-77 26.737499999999997 22.95 24.3625 25.95 78-79 25.853231653956744 24.62807850981373 23.72796599574947 25.790723840480062 80-81 26.881720430107524 23.74343585896474 23.868467116779193 25.506376594148538 82-83 26.25062531265633 24.912456228114056 23.47423711855928 25.362681340670335 84-85 26.638319159579787 24.212106053026513 23.13656828414207 26.013006503251624 86-87 26.700850425212607 24.574787393696848 22.98649324662331 25.737868934467233 88-89 26.450725362681343 24.69984992496248 22.886443221610804 25.962981490745374 90-91 26.18809404702351 24.324662331165584 23.82441220610305 25.662831415707853 92-93 26.100550275137568 24.312156078039017 23.449224612306153 26.138069034517258 94-95 26.579111944965604 23.877423389618514 23.964978111319574 25.57848655409631 96-97 26.705043173570264 24.364910524339884 23.68915029408084 25.240896008009013 98-99 26.941624365482237 23.083756345177665 22.538071065989847 27.436548223350254 100-101 27.197630922693268 10.458229426433915 29.286159600997507 33.05798004987531 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 1.0 2 1.5 3 1.0 4 1.0 5 1.0 6 0.5 7 1.5 8 1.5 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 1.5 21 2.0 22 1.5 23 1.5 24 1.0 25 1.0 26 2.0 27 3.5 28 3.5 29 5.0 30 9.5 31 9.0 32 8.5 33 10.0 34 20.0 35 36.5 36 48.5 37 55.0 38 63.0 39 91.0 40 110.0 41 121.0 42 141.0 43 149.0 44 149.0 45 152.0 46 166.0 47 174.0 48 162.5 49 141.5 50 131.5 51 128.5 52 111.0 53 105.5 54 112.5 55 115.5 56 99.5 57 92.0 58 102.5 59 95.0 60 84.5 61 75.0 62 76.5 63 76.0 64 70.0 65 73.5 66 82.5 67 74.5 68 55.0 69 50.5 70 50.0 71 47.5 72 50.5 73 48.0 74 37.5 75 30.0 76 21.5 77 15.0 78 16.0 79 12.5 80 5.0 81 4.0 82 3.0 83 1.5 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.05 2 0.0 3 0.025 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 78 1.0 79 0.0 80 0.0 81 1.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 1.0 95 0.0 96 3.0 97 19.0 98 70.0 99 265.0 100 864.0 101 2776.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.925 #Duplication Level Percentage of deduplicated Percentage of total 1 93.78531073446328 87.15 2 5.78423459779392 10.75 3 0.3497444175410277 0.975 4 0.026903416733925208 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.026903416733925208 0.2 9 0.0 0.0 >10 0.026903416733925208 0.8250000000000001 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACAGCGATAGATCTCGTAT 33 0.8250000000000001 TruSeq Adapter, Index 1 (97% over 36bp) GATCGGAAGAGCACACGTCTGAACTCCAGTCACAGCGATAGATCGCGTAT 8 0.2 TruSeq Adapter, Index 1 (97% over 36bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 166446 spots for SRR21853540.sra Written 166446 spots for SRR21853540.sra Read 166446 spots for SRR21853540.sra Written 166446 spots for SRR21853540.sra Read 166446 spots for SRR21853540.sra Written 166446 spots for SRR21853540.sra Read 166446 spots for SRR21853540.sra Written 166446 spots for SRR21853540.sra Read 166446 spots for SRR21853540.sra Written 166446 spots for SRR21853540.sra Read 166446 spots for SRR21853540.sra Written 166446 spots for SRR21853540.sra Read 166446 spots for SRR21853540.sra Written 166446 spots for SRR21853540.sra Read 166446 spots for SRR21853540.sra Written 166446 spots for SRR21853540.sra Read 166446 spots for SRR21853540.sra Written 166446 spots for SRR21853540.sra Read 166446 spots for SRR21853540.sra Written 166446 spots for SRR21853540.sra Read 166446 spots for SRR21853540.sra Written 166446 spots for SRR21853540.sra Read 166446 spots for SRR21853540.sra Written 166446 spots for SRR21853540.sra Read 166446 spots for SRR21853540.sra Written 166446 spots for SRR21853540.sra Read 166446 spots for SRR21853540.sra Written 166446 spots for SRR21853540.sra Read 166446 spots for SRR21853540.sra Written 166446 spots for SRR21853540.sra Read 166446 spots for SRR21853540.sra Written 166446 spots for SRR21853540.sra Read 166446 spots for SRR21853540.sra Written 166446 spots for SRR21853540.sra Read 166446 spots for SRR21853540.sra Written 166446 spots for SRR21853540.sra Read 166449 spots for SRR21853540.sra Written 166449 spots for SRR21853540.sra Read 166446 spots for SRR21853540.sra Written 166446 spots for SRR21853540.sra SRR ids: ['SRR21853540.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_19pf0owq SRR21853540.sra spots: 3328923 blocks: [[1, 166446], [166447, 332892], [332893, 499338], [499339, 665784], [665785, 832230], [832231, 998676], [998677, 1165122], [1165123, 1331568], [1331569, 1498014], [1498015, 1664460], [1664461, 1830906], [1830907, 1997352], [1997353, 2163798], [2163799, 2330244], [2330245, 2496690], [2496691, 2663136], [2663137, 2829582], [2829583, 2996028], [2996029, 3162474], [3162475, 3328923]] SRR21853540 file size 894476 SRR21853540 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR21853540 SRR21853540_1.fastq Input file: SRR21853540_1.fastq trimmed: SRR21853540-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Fri Dec 6 17:27:11 2024 >> started Fri Dec 6 17:27:13 2024 >> done (2.221s) 3328923 reads processed; of these: 2 ( 0.00%) short reads filtered out after trimming by size control 47330 ( 1.42%) empty reads filtered out after trimming by size control 3281591 (98.58%) reads available; of these: 219 ( 0.01%) trimmed reads available after processing 3281372 (99.99%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 19 1 0.00% 20 0 0.00% 21 0 0.00% 22 0 0.00% 23 0 0.00% 24 0 0.00% 25 0 0.00% 26 0 0.00% 27 1 0.00% 28 0 0.00% 29 0 0.00% 30 0 0.00% 31 1 0.00% 32 1 0.00% 33 1 0.00% 34 3 0.00% 35 3 0.00% 36 8 0.00% 37 13 0.00% 38 9 0.00% 39 10 0.00% 40 10 0.00% 41 8 0.00% 42 8 0.00% 43 10 0.00% 44 9 0.00% 45 13 0.00% 46 12 0.00% 47 12 0.00% 48 12 0.00% 49 16 0.00% 50 23 0.00% 51 14 0.00% 52 16 0.00% 53 12 0.00% 54 26 0.00% 55 13 0.00% 56 25 0.00% 57 15 0.00% 58 19 0.00% 59 15 0.00% 60 29 0.00% 61 29 0.00% 62 16 0.00% 63 20 0.00% 64 22 0.00% 65 26 0.00% 66 25 0.00% 67 20 0.00% 68 24 0.00% 69 22 0.00% 70 22 0.00% 71 38 0.00% 72 33 0.00% 73 25 0.00% 74 25 0.00% 75 30 0.00% 76 30 0.00% 77 35 0.00% 78 42 0.00% 79 51 0.00% 80 53 0.00% 81 42 0.00% 82 60 0.00% 83 51 0.00% 84 52 0.00% 85 67 0.00% 86 63 0.00% 87 84 0.00% 88 82 0.00% 89 87 0.00% 90 130 0.00% 91 204 0.01% 92 110 0.00% 93 146 0.00% 94 283 0.01% 95 796 0.02% 96 4306 0.13% 97 14883 0.45% 98 57866 1.76% 99 218414 6.66% 100 733115 22.34% 101 2249794 68.56% 3281591 reads passed initial QC criterion=sequence-density sequence-density=0.19 sequence-density-rank=1 fanout-score=2.20 fanout-score-rank=18 prefix-density=0.22 prefix-fanout=1.9 sequence=GCTCCTTTCCAGGG criterion=fanout-score sequence-density=0.08 sequence-density-rank=24 fanout-score=6.87 fanout-score-rank=1 prefix-density=0.27 prefix-fanout=2.2 sequence=CTCCAAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGGAAGCCGGGTTACGGTGCCCAACTGCGCGCTAACCTAGAACCCACAAAGGGTGTTGGTCGATTAAGACAGCAGGACGGTGGTCATGGAAGTCGAAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATCAACTAGCCCCGAAAATGGATGGCGCTAAAGCGCGCGACCCACACCCGGCCATCTGGGCGAGCGCCATGCCCCGATGAGTAGGAGGGCGCGGCGGCCGCTGCAAAACCCGGGGCGCGAGCCCGGGCGGAGCGGCCGTCGGTGCAGATCTTGGTGGTAGTAGCAAATATTCAAATGAGAACTTTGAAGGCCGAAGAGGAGAAAGGTTCCATGTGAACGGCACTTGCACATGGGTAAGCCGATCCTAAGGGACGGGGTAACCCCGGCAGATAGCGCGATCACGCGTATCCCCCGAAAGGGAATCGGGTTAAGATTTCCCGAGCCGGGATG Started job on | Dec 06 17:27:34 Started mapping on | Dec 06 17:27:35 Finished on | Dec 06 17:27:41 Mapping speed, Million of reads per hour | 1968.95 Number of input reads | 3281591 Average input read length | 100 UNIQUE READS: Uniquely mapped reads number | 2900613 Uniquely mapped reads % | 88.39% Average mapped length | 100.26 Number of splices: Total | 986467 Number of splices: Annotated (sjdb) | 935058 Number of splices: GT/AG | 972588 Number of splices: GC/AG | 11917 Number of splices: AT/AC | 551 Number of splices: Non-canonical | 1411 Mismatch rate per base, % | 0.19% Deletion rate per base | 0.00% Deletion average length | 1.89 Insertion rate per base | 0.00% Insertion average length | 1.80 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 148927 % of reads mapped to multiple loci | 4.54% Number of reads mapped to too many loci | 174373 % of reads mapped to too many loci | 5.31% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.32% % of reads unmapped: other | 0.44% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 232051 232051 232051 N_multimapping 148927 148927 148927 N_noFeature 130742 1494644 1497764 N_ambiguous 45293 3527 3161 UnstrandedReadsAssigned:2724578 PositiveStrandReadsAssigned:1402442 NegativeStrandReadsAssigned:1399688 Dataset is classified unstranded MeadianReadLen=101 20thPercentileLength=100 echo kmer=95 SRR21853540 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR21853540-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 3,281,591 reads, 2,843,392 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,095 rounds 52973 SRR21853540.ke.tsv 35125 SRR21853540.se.tsv 88098 total ==> SRR21853540.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 0 0 PNS24247 1044 945 13.8295 8.75914 PNS24249 1928 1829 11.6036 3.79723 PNS24246 1044 945 13.8295 8.75914 PNS24248 1044 945 13.8295 8.75914 PNS24244 1471 1372 7.90802 3.44986 PNS24243 293 194 6 18.5113 KQK14069 1603 1504 737.408 293.46 KQK14071 474 375 138.173 220.536 ==> SRR21853540.se.tsv <== BRADI_1g14170v3 961 BRADI_1g53295v3 18 BRADI_1g59795v3 46 BRADI_1g07683v3 0 BRADI_1g00485v3 7 BRADI_1g20270v3 272 BRADI_1g74790v3 35 BRADI_1g09890v3 1 BRADI_1g77505v3 43 BRADI_1g48960v3 0 SRR21853540 completed mapping pipeline successfully