Starting /dee2/code/volunteer_pipeline.sh SRR21853541 current disk space = 1550631677952 free memory = 1595662900 SRR21853541 SRAfilesize 926546a6e28c3a7ffc2c57b3da59d4ec SRR21853541.sra SRR21853541.sra file validated SRR21853541 is single end SRR21853541 is conventional basespace SRR21853541 read1 length is 41-101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR21853541_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 41-101 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.223 32.0 32.0 32.0 32.0 32.0 2 31.423 32.0 32.0 32.0 32.0 32.0 3 31.47175 32.0 32.0 32.0 32.0 32.0 4 31.5535 32.0 32.0 32.0 32.0 32.0 5 31.57575 32.0 32.0 32.0 32.0 32.0 6 34.8865 36.0 36.0 36.0 36.0 36.0 7 35.1055 36.0 36.0 36.0 36.0 36.0 8 35.07125 36.0 36.0 36.0 36.0 36.0 9 35.076 36.0 36.0 36.0 36.0 36.0 10-11 35.071875 36.0 36.0 36.0 36.0 36.0 12-13 35.15975 36.0 36.0 36.0 36.0 36.0 14-15 35.048249999999996 36.0 36.0 36.0 36.0 36.0 16-17 35.015 36.0 36.0 36.0 36.0 36.0 18-19 34.951875 36.0 36.0 36.0 36.0 36.0 20-21 35.00475 36.0 36.0 36.0 36.0 36.0 22-23 34.927875 36.0 36.0 36.0 34.0 36.0 24-25 34.871 36.0 36.0 36.0 36.0 36.0 26-27 34.800625 36.0 36.0 36.0 32.0 36.0 28-29 34.87875 36.0 36.0 36.0 32.0 36.0 30-31 34.808125000000004 36.0 36.0 36.0 32.0 36.0 32-33 34.664249999999996 36.0 36.0 36.0 32.0 36.0 34-35 34.77975 36.0 36.0 36.0 32.0 36.0 36-37 34.69225 36.0 36.0 36.0 32.0 36.0 38-39 34.671875 36.0 36.0 36.0 32.0 36.0 40-41 34.626125 36.0 36.0 36.0 32.0 36.0 42-43 34.60340085021255 36.0 36.0 36.0 32.0 36.0 44-45 34.548637159289825 36.0 36.0 36.0 32.0 36.0 46-47 34.664666166541636 36.0 36.0 36.0 32.0 36.0 48-49 34.579394848712184 36.0 36.0 36.0 32.0 36.0 50-51 34.628407101775444 36.0 36.0 36.0 32.0 36.0 52-53 34.59414853713429 36.0 36.0 36.0 32.0 36.0 54-55 34.39459864966241 36.0 36.0 36.0 32.0 36.0 56-57 34.462490622655665 36.0 36.0 36.0 32.0 36.0 58-59 34.3183295823956 36.0 36.0 36.0 32.0 36.0 60-61 34.33683420855213 36.0 36.0 36.0 32.0 36.0 62-63 34.199174793698425 36.0 36.0 36.0 32.0 36.0 64-65 34.25618904726181 36.0 36.0 36.0 32.0 36.0 66-67 34.17621310655328 36.0 36.0 36.0 32.0 36.0 68-69 34.337793896948476 36.0 36.0 36.0 32.0 36.0 70-71 33.98649324662331 36.0 36.0 36.0 32.0 36.0 72-73 34.05290145072536 36.0 36.0 36.0 32.0 36.0 74-75 33.836918459229615 36.0 36.0 36.0 32.0 36.0 76-77 33.92333666833417 36.0 36.0 36.0 32.0 36.0 78-79 33.93446723361681 36.0 36.0 36.0 29.5 36.0 80-81 33.851300650325165 36.0 36.0 36.0 27.0 36.0 82-83 33.88156578289144 36.0 36.0 36.0 29.5 36.0 84-85 33.919334667333665 36.0 36.0 36.0 29.5 36.0 86-87 33.863681840920464 36.0 36.0 36.0 29.5 36.0 88-89 33.75331498623968 36.0 36.0 36.0 27.0 36.0 90-91 33.78367859979068 36.0 36.0 36.0 29.5 36.0 92-93 33.7932622156458 36.0 36.0 36.0 27.0 36.0 94-95 33.73147220831247 36.0 36.0 36.0 27.0 36.0 96-97 33.714002612306345 36.0 36.0 36.0 27.0 36.0 98-99 33.71889386710113 36.0 36.0 36.0 27.0 36.0 100-101 32.755430110399296 36.0 34.0 36.0 20.5 36.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 11101 1 0.0 11101 2 0.0 11101 3 0.0 11101 4 0.0 11101 5 0.0 11101 6 0.0 11101 7 0.0 11101 8 0.0 11101 9 0.0 11101 10-11 0.0 11101 12-13 0.0 11101 14-15 0.0 11101 16-17 0.0 11101 18-19 0.0 11101 20-21 0.0 11101 22-23 0.0 11101 24-25 0.0 11101 26-27 0.0 11101 28-29 0.0 11101 30-31 0.0 11101 32-33 0.0 11101 34-35 0.0 11101 36-37 0.0 11101 38-39 0.0 11101 40-41 0.0 11101 42-43 0.0 11101 44-45 0.0 11101 46-47 0.0 11101 48-49 0.0 11101 50-51 0.0 11101 52-53 0.0 11101 54-55 0.0 11101 56-57 0.0 11101 58-59 0.0 11101 60-61 0.0 11101 62-63 0.0 11101 64-65 0.0 11101 66-67 0.0 11101 68-69 0.0 11101 70-71 0.0 11101 72-73 0.0 11101 74-75 0.0 11101 76-77 0.0 11101 78-79 0.0 11101 80-81 0.0 11101 82-83 0.0 11101 84-85 0.0 11101 86-87 0.0 11101 88-89 0.0 11101 90-91 0.0 11101 92-93 0.0 11101 94-95 0.0 11101 96-97 0.0 11101 98-99 0.0 11101 100-101 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 18 1.0 19 0.0 20 3.0 21 5.0 22 5.0 23 9.0 24 8.0 25 26.0 26 38.0 27 38.0 28 53.0 29 85.0 30 118.0 31 126.0 32 200.0 33 320.0 34 626.0 35 2339.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 29.825000000000003 12.025 19.45 38.7 2 24.875 21.45 29.75 23.925 3 25.25 24.2 23.7 26.85 4 26.474999999999998 29.9 18.5 25.124999999999996 5 26.85 31.674999999999997 20.275000000000002 21.2 6 23.003515821195382 32.72225012556505 20.617780010045202 23.656454043194376 7 19.05 17.4 38.475 25.074999999999996 8 22.2 22.3 25.974999999999998 29.525000000000002 9 23.075000000000003 19.975 28.925 28.025 10-11 26.2625 27.775 20.674999999999997 25.2875 12-13 22.925 22.975 25.912499999999998 28.1875 14-15 23.45 24.625 25.525 26.400000000000002 16-17 25.3125 24.0375 23.6625 26.987499999999997 18-19 24.6625 24.2375 24.9375 26.1625 20-21 25.6 25.137500000000003 24.275 24.9875 22-23 25.162499999999998 25.124999999999996 23.7625 25.95 24-25 24.8625 23.5875 25.6 25.95 26-27 24.4375 24.9125 24.325 26.325 28-29 26.125 24.05 23.65 26.174999999999997 30-31 24.825 24.65 24.0625 26.4625 32-33 24.9875 25.55 23.849999999999998 25.6125 34-35 24.825 24.925 23.9125 26.337500000000002 36-37 24.8125 25.1 23.3625 26.724999999999998 38-39 24.5625 25.424999999999997 24.425 25.587500000000002 40-41 25.412499999999998 25.15 23.425 26.0125 42-43 24.318579644911228 24.831207801950487 24.81870467616904 26.03150787696924 44-45 25.668917229307326 24.06851712928232 23.893473368342086 26.36909227306827 46-47 24.731182795698924 24.793698424606152 23.968492123030757 26.506626656664167 48-49 25.006251562890725 24.90622655663916 24.218554638659665 25.868967241810452 50-51 24.99374843710928 24.93123280820205 24.20605151287822 25.868967241810452 52-53 25.256314078519633 24.043510877719427 23.85596399099775 26.84421105276319 54-55 25.056264066016503 24.668667166791696 24.10602650662666 26.16904226056514 56-57 25.35633908477119 24.01850462615654 24.981245311327832 25.64391097774444 58-59 25.23130782695674 23.78094523630908 24.593648412103025 26.39409852463116 60-61 24.15603900975244 24.256064016004 25.481370342585645 26.106526631657918 62-63 25.44386096524131 23.305826456614152 24.63115778944736 26.619154788697173 64-65 24.981245311327832 24.518629657414355 23.80595148787197 26.694173543385848 66-67 25.125062531265634 25.025012506253123 24.12456228114057 25.72536268134067 68-69 24.262131065532767 26.675837918959477 23.861930965482742 25.200100050025014 70-71 25.662831415707853 25.512756378189096 23.261630815407706 25.56278139069535 72-73 24.974987493746873 25.337668834417208 23.92446223111556 25.76288144072036 74-75 25.45022511255628 24.899949974987493 23.51175587793897 26.138069034517258 76-77 26.075537768884445 24.96248124062031 22.998999499749875 25.962981490745374 78-79 26.713356678339167 24.137068534267133 24.262131065532767 24.88744372186093 80-81 26.3631815907954 24.374687343671837 23.09904952476238 26.163081540770385 82-83 26.488244122061033 24.112056028014006 24.012006003001503 25.387693846923458 84-85 25.82541270635318 24.54977488744372 22.961480740370185 26.663331665832917 86-87 25.86293146573287 25.57528764382191 23.47423711855928 25.087543771885944 88-89 25.94445834375782 24.48086064548411 23.317488116087066 26.257192894671004 90-91 25.772550982109344 24.75916426873514 23.72075566120355 25.74752908795196 92-93 26.345431789737173 24.217772215269086 23.754693366708384 25.682102628285357 94-95 27.566349524286434 23.960941412118178 23.5227841762644 24.949924887330997 96-97 25.630094043887148 24.200626959247646 23.69905956112853 26.470219435736674 98-99 26.252224764810578 23.518942283244343 24.59954233409611 25.62929061784897 100-101 27.357154100424996 10.861010546198646 28.333070990083424 33.44876436329293 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.5 16 1.0 17 1.0 18 0.5 19 0.0 20 0.5 21 1.0 22 1.5 23 1.5 24 0.5 25 1.5 26 2.5 27 3.0 28 6.5 29 9.5 30 9.5 31 8.0 32 13.0 33 18.0 34 19.5 35 27.0 36 46.5 37 58.5 38 66.5 39 91.0 40 106.0 41 114.0 42 135.5 43 155.0 44 161.5 45 171.0 46 175.5 47 184.0 48 179.0 49 157.0 50 149.5 51 139.0 52 125.0 53 114.0 54 98.0 55 94.0 56 100.0 57 97.0 58 102.5 59 102.5 60 85.0 61 70.5 62 66.5 63 75.5 64 79.0 65 63.5 66 52.0 67 55.5 68 57.5 69 55.0 70 54.5 71 47.0 72 42.0 73 35.5 74 29.0 75 24.5 76 17.0 77 12.0 78 9.0 79 6.0 80 3.5 81 5.5 82 3.0 83 0.5 84 1.5 85 1.5 86 0.5 87 0.5 88 0.5 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.44999999999999996 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 40-41 1.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 1.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 1.0 88-89 0.0 90-91 1.0 92-93 2.0 94-95 1.0 96-97 27.0 98-99 334.0 100-101 3632.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.75 #Duplication Level Percentage of deduplicated Percentage of total 1 99.49367088607595 98.25 2 0.4810126582278481 0.95 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.025316455696202535 0.8 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACAGCGATAGATCTCGTAT 32 0.8 TruSeq Adapter, Index 1 (97% over 36bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCGGAAG 15 6.246088E-4 94.600006 3 CGGAAGA 15 6.246088E-4 94.600006 4 AGAGCAC 15 6.246088E-4 94.600006 8 ATCGGAA 15 6.246088E-4 94.600006 2 GATCGGA 20 0.0019582885 70.950005 1 GAAGAGC 20 0.0019582885 70.950005 6 GAGCACA 20 0.0019582885 70.950005 9 GGAAGAG 20 0.0019582885 70.950005 5 AAGAGCA 30 0.009755995 47.300003 7 AAAAAAA 40 9.780995E-6 35.475002 66-67 >>END_MODULE Read 706195 spots for SRR21853541.sra Written 706195 spots for SRR21853541.sra Read 706206 spots for SRR21853541.sra Written 706206 spots for SRR21853541.sra Read 706195 spots for SRR21853541.sra Written 706195 spots for SRR21853541.sra Read 706195 spots for SRR21853541.sra Written 706195 spots for SRR21853541.sra Read 706195 spots for SRR21853541.sra Written 706195 spots for SRR21853541.sra Read 706195 spots for SRR21853541.sra Written 706195 spots for SRR21853541.sra Read 706195 spots for SRR21853541.sra Written 706195 spots for SRR21853541.sra Read 706195 spots for SRR21853541.sra Written 706195 spots for SRR21853541.sra Read 706195 spots for SRR21853541.sra Written 706195 spots for SRR21853541.sra Read 706195 spots for SRR21853541.sra Written 706195 spots for SRR21853541.sra Read 706195 spots for SRR21853541.sra Written 706195 spots for SRR21853541.sra Read 706195 spots for SRR21853541.sra Written 706195 spots for SRR21853541.sra Read 706195 spots for SRR21853541.sra Written 706195 spots for SRR21853541.sra Read 706195 spots for SRR21853541.sra Written 706195 spots for SRR21853541.sra Read 706195 spots for SRR21853541.sra Written 706195 spots for SRR21853541.sra Read 706195 spots for SRR21853541.sra Written 706195 spots for SRR21853541.sra Read 706195 spots for SRR21853541.sra Written 706195 spots for SRR21853541.sra Read 706195 spots for SRR21853541.sra Written 706195 spots for SRR21853541.sra Read 706195 spots for SRR21853541.sra Written 706195 spots for SRR21853541.sra Read 706195 spots for SRR21853541.sra Written 706195 spots for SRR21853541.sra SRR ids: ['SRR21853541.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_7mm6oeut SRR21853541.sra spots: 14123911 blocks: [[1, 706195], [706196, 1412390], [1412391, 2118585], [2118586, 2824780], [2824781, 3530975], [3530976, 4237170], [4237171, 4943365], [4943366, 5649560], [5649561, 6355755], [6355756, 7061950], [7061951, 7768145], [7768146, 8474340], [8474341, 9180535], [9180536, 9886730], [9886731, 10592925], [10592926, 11299120], [11299121, 12005315], [12005316, 12711510], [12711511, 13417705], [13417706, 14123911]] SRR21853541 file size 3854109 SRR21853541 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR21853541 SRR21853541_1.fastq Input file: SRR21853541_1.fastq trimmed: SRR21853541-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Fri Dec 6 17:28:06 2024 >> started Fri Dec 6 17:28:13 2024 >> done (7.113s) 14123911 reads processed; of these: 52 ( 0.00%) short reads filtered out after trimming by size control 480824 ( 3.40%) empty reads filtered out after trimming by size control 13643035 (96.60%) reads available; of these: 130 ( 0.00%) trimmed reads available after processing 13642905 (100.00%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 0 0.00% 20 0 0.00% 21 0 0.00% 22 0 0.00% 23 1 0.00% 24 1 0.00% 25 2 0.00% 26 1 0.00% 27 0 0.00% 28 0 0.00% 29 0 0.00% 30 0 0.00% 31 0 0.00% 32 2 0.00% 33 0 0.00% 34 1 0.00% 35 30 0.00% 36 51 0.00% 37 56 0.00% 38 58 0.00% 39 54 0.00% 40 61 0.00% 41 67 0.00% 42 61 0.00% 43 49 0.00% 44 51 0.00% 45 53 0.00% 46 50 0.00% 47 79 0.00% 48 94 0.00% 49 86 0.00% 50 91 0.00% 51 107 0.00% 52 95 0.00% 53 91 0.00% 54 83 0.00% 55 93 0.00% 56 99 0.00% 57 128 0.00% 58 129 0.00% 59 151 0.00% 60 162 0.00% 61 153 0.00% 62 176 0.00% 63 173 0.00% 64 140 0.00% 65 161 0.00% 66 148 0.00% 67 167 0.00% 68 207 0.00% 69 203 0.00% 70 251 0.00% 71 245 0.00% 72 230 0.00% 73 238 0.00% 74 234 0.00% 75 231 0.00% 76 263 0.00% 77 289 0.00% 78 277 0.00% 79 300 0.00% 80 326 0.00% 81 376 0.00% 82 398 0.00% 83 385 0.00% 84 473 0.00% 85 481 0.00% 86 513 0.00% 87 517 0.00% 88 589 0.00% 89 600 0.00% 90 682 0.00% 91 1129 0.01% 92 774 0.01% 93 868 0.01% 94 1476 0.01% 95 3731 0.03% 96 17268 0.13% 97 63458 0.47% 98 239840 1.76% 99 886896 6.50% 100 3099872 22.72% 101 9316159 68.29% 13643035 reads passed initial QC criterion=sequence-density sequence-density=0.23 sequence-density-rank=1 fanout-score=2.34 fanout-score-rank=18 prefix-density=0.24 prefix-fanout=2.2 sequence=CCATGGCACCCACCGTGATGGCTTCCTCCGCCACCTCCGTGGC criterion=fanout-score sequence-density=0.01 sequence-density-rank=37 fanout-score=10.44 fanout-score-rank=1 prefix-density=0.02 prefix-fanout=2.7 sequence=CCGCCGACAGCCGACGGGTTTGGGGCCGGGACCCCCGAGCCCAGTCCTCAGAGCCAATCCTTTTCCCGAAGTTACGGATCCGTTTTGCCGACTTCCCTTGCCTACATTGTTCCATTGGCCAGAGGCTGTTCACCTTGGAGACCTGATGCGGTTATGAGTACGACCGGGCGTGAACGGTACTCGGTCCTCCGGATTTTCATGGGCCGCCGGGGGCGCACCGGACACCGCGCGACGTGCGGTGCTCTTCCGGCCACTGGACCCTACCTCCGGCTGAACCGATTCCAGGGTTGGCAGGCCGTTAAGCAGAAAAGATAACTCTTCCCGAGGCCCCCGCCGGCGTCTCCGGACTTCCTAACGTCGCCGTCAACCGCCACATCCCGGCTCGGGAAATCTTAACCCGATTCCCTTTCGGGGGATACGCGTGATCGCGCTATCTGCCGGGGTTACCCCGTCCCTTAGGATCGGCTTACCCATGTGCAAGTGCCGTTCACATGGAACCTTTCTCCTCTTC Started job on | Dec 06 17:28:30 Started mapping on | Dec 06 17:28:30 Finished on | Dec 06 17:28:58 Mapping speed, Million of reads per hour | 1754.10 Number of input reads | 13643035 Average input read length | 100 UNIQUE READS: Uniquely mapped reads number | 11968071 Uniquely mapped reads % | 87.72% Average mapped length | 100.21 Number of splices: Total | 4119033 Number of splices: Annotated (sjdb) | 3906823 Number of splices: GT/AG | 4061622 Number of splices: GC/AG | 49657 Number of splices: AT/AC | 2315 Number of splices: Non-canonical | 5439 Mismatch rate per base, % | 0.28% Deletion rate per base | 0.01% Deletion average length | 1.73 Insertion rate per base | 0.00% Insertion average length | 1.74 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 600237 % of reads mapped to multiple loci | 4.40% Number of reads mapped to too many loci | 675778 % of reads mapped to too many loci | 4.95% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.40% % of reads unmapped: other | 0.53% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1074727 1074727 1074727 N_multimapping 600237 600237 600237 N_noFeature 570648 6171635 6205412 N_ambiguous 187741 14291 13112 UnstrandedReadsAssigned:11209682 PositiveStrandReadsAssigned:5782145 NegativeStrandReadsAssigned:5749547 Dataset is classified unstranded MeadianReadLen=101 20thPercentileLength=100 echo kmer=95 SRR21853541 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR21853541-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,643,035 reads, 11,767,536 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,083 rounds 52973 SRR21853541.ke.tsv 35125 SRR21853541.se.tsv 88098 total ==> SRR21853541.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 0.0570831 0.00994264 PNS24247 1044 945 44.5972 6.88012 PNS24249 1928 1829 137.352 10.9482 PNS24246 1044 945 44.5972 6.88012 PNS24248 1044 945 44.5972 6.88012 PNS24244 1471 1372 31.7992 3.37895 PNS24243 293 194 16 12.0237 KQK14069 1603 1504 2684.71 260.237 KQK14071 474 375 418.962 162.878 ==> SRR21853541.se.tsv <== BRADI_1g14170v3 3464 BRADI_1g53295v3 94 BRADI_1g59795v3 160 BRADI_1g07683v3 0 BRADI_1g00485v3 54 BRADI_1g20270v3 1261 BRADI_1g74790v3 111 BRADI_1g09890v3 5 BRADI_1g77505v3 205 BRADI_1g48960v3 0 SRR21853541 completed mapping pipeline successfully