Starting /dee2/code/volunteer_pipeline.sh SRR21853542 current disk space = 1550640742400 free memory = 1596502460 SRR21853542 SRAfilesize 231ea4f7a30370c4760d7dcbc727e6c9 SRR21853542.sra SRR21853542.sra file validated SRR21853542 is single end SRR21853542 is conventional basespace SRR21853542 read1 length is 35-101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR21853542_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 35-101 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.076 37.0 37.0 37.0 25.0 37.0 2 35.09225 37.0 37.0 37.0 25.0 37.0 3 35.505 37.0 37.0 37.0 37.0 37.0 4 35.67 37.0 37.0 37.0 37.0 37.0 5 35.839 37.0 37.0 37.0 37.0 37.0 6 35.6875 37.0 37.0 37.0 37.0 37.0 7 35.617 37.0 37.0 37.0 37.0 37.0 8 35.8955 37.0 37.0 37.0 37.0 37.0 9 35.7825 37.0 37.0 37.0 37.0 37.0 10-11 35.82475 37.0 37.0 37.0 37.0 37.0 12-13 35.8365 37.0 37.0 37.0 37.0 37.0 14-15 35.816500000000005 37.0 37.0 37.0 37.0 37.0 16-17 35.832499999999996 37.0 37.0 37.0 37.0 37.0 18-19 35.81525 37.0 37.0 37.0 37.0 37.0 20-21 35.76725 37.0 37.0 37.0 37.0 37.0 22-23 35.78175 37.0 37.0 37.0 37.0 37.0 24-25 35.79975 37.0 37.0 37.0 37.0 37.0 26-27 35.64675 37.0 37.0 37.0 37.0 37.0 28-29 35.713 37.0 37.0 37.0 37.0 37.0 30-31 35.59025 37.0 37.0 37.0 37.0 37.0 32-33 35.6005 37.0 37.0 37.0 37.0 37.0 34-35 35.60525 37.0 37.0 37.0 37.0 37.0 36-37 35.581790895447725 37.0 37.0 37.0 37.0 37.0 38-39 35.48174087043522 37.0 37.0 37.0 37.0 37.0 40-41 35.50700350175087 37.0 37.0 37.0 37.0 37.0 42-43 35.436718359179594 37.0 37.0 37.0 37.0 37.0 44-45 35.0040020010005 37.0 37.0 37.0 31.0 37.0 46-47 35.3231615807904 37.0 37.0 37.0 31.0 37.0 48-49 35.386443221610804 37.0 37.0 37.0 37.0 37.0 50-51 35.46048024012006 37.0 37.0 37.0 37.0 37.0 52-53 35.38894447223612 37.0 37.0 37.0 37.0 37.0 54-55 35.365273955466606 37.0 37.0 37.0 37.0 37.0 56-57 35.377972465581976 37.0 37.0 37.0 31.0 37.0 58-59 35.225281602002504 37.0 37.0 37.0 25.0 37.0 60-61 35.08864761472622 37.0 37.0 37.0 31.0 37.0 62-63 35.04957436154231 37.0 37.0 37.0 25.0 37.0 64-65 35.15623435152729 37.0 37.0 37.0 31.0 37.0 66-67 34.90560841261893 37.0 37.0 37.0 25.0 37.0 68-69 34.32674011016525 37.0 37.0 37.0 25.0 37.0 70-71 34.38507761642464 37.0 37.0 37.0 25.0 37.0 72-73 35.04957436154231 37.0 37.0 37.0 25.0 37.0 74-75 35.21657486229344 37.0 37.0 37.0 31.0 37.0 76-77 35.19228843264898 37.0 37.0 37.0 31.0 37.0 78-79 35.13119679519279 37.0 37.0 37.0 25.0 37.0 80-81 35.3415122684026 37.0 37.0 37.0 37.0 37.0 82-83 35.28342513770656 37.0 37.0 37.0 37.0 37.0 84-85 35.200801201802705 37.0 37.0 37.0 25.0 37.0 86-87 35.268469822188834 37.0 37.0 37.0 31.0 37.0 88-89 35.15055110220441 37.0 37.0 37.0 25.0 37.0 90-91 35.17459919839679 37.0 37.0 37.0 31.0 37.0 92-93 35.16508016032064 37.0 37.0 37.0 25.0 37.0 94-95 34.937108494111754 37.0 37.0 37.0 25.0 37.0 96-97 35.18653428958555 37.0 37.0 37.0 31.0 37.0 98-99 35.16477969483385 37.0 37.0 37.0 25.0 37.0 100-101 35.01305739427541 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100-101 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 2.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 3.0 24 6.0 25 7.0 26 25.0 27 15.0 28 48.0 29 59.0 30 91.0 31 124.0 32 167.0 33 196.0 34 338.0 35 512.0 36 1922.0 37 485.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 31.94097048524262 12.531265632816407 15.132566283141571 40.3951975987994 2 23.740285785911254 23.790423665078965 28.653797944346955 23.815492604662822 3 27.463731865932967 21.1855927963982 25.887943971985994 25.46273136568284 4 26.463231615807903 27.163581790895446 16.883441720860432 29.48974487243622 5 31.065532766383193 28.53926963481741 19.034517258629315 21.360680340170084 6 26.338169084542272 30.540270135067534 19.634817408704354 23.486743371685844 7 19.759879939969984 19.759879939969984 35.06753376688344 25.41270635317659 8 21.235617808904454 23.486743371685844 23.311655827913956 31.96598299149575 9 25.68784392196098 20.185092546273136 26.088044022011005 28.039019509754876 10-11 27.67633816908454 28.339169584792394 17.933966983491743 26.050525262631314 12-13 22.59879939969985 22.98649324662331 25.200100050025014 29.214607303651825 14-15 23.6368184092046 24.787393696848426 23.536768384192097 28.039019509754876 16-17 26.17558779389695 22.136068034017008 23.336668334167083 28.35167583791896 18-19 24.16208104052026 23.47423711855928 24.12456228114057 28.23911955977989 20-21 26.475737868934466 23.524262131065534 24.54977488744372 25.45022511255628 22-23 23.84942471235618 27.70135067533767 22.386193096548272 26.063031515757878 24-25 24.012006003001503 22.98649324662331 25.062531265632813 27.938969484742373 26-27 23.62431215607804 23.17408704352176 22.936468234117058 30.265132566283143 28-29 27.03851925962982 24.287143571785894 22.136068034017008 26.538269134567283 30-31 24.69984992496248 23.274137068534266 25.18759379689845 26.8384192096048 32-33 24.474737368684345 24.92496248124062 23.011505752876438 27.5887943971986 34-35 26.138069034517258 24.562281140570285 22.0360180090045 27.263631815907953 36-37 27.188594297148573 22.436218109054526 22.586293146573286 27.788894447223612 38-39 25.52526263131566 24.312156078039017 24.64982491245623 25.512756378189096 40-41 26.513256628314156 24.92496248124062 22.273636818409205 26.28814407203602 42-43 24.537268634317158 24.437218609304654 24.362181090545274 26.663331665832917 44-45 24.299649824912457 23.461730865432717 23.78689344672336 28.451725862931465 46-47 26.863431715857928 22.63631815907954 22.173586793396698 28.326663331665834 48-49 24.449724862431214 24.674837418709355 24.84992496248124 26.025512756378188 50-51 26.713356678339167 22.26113056528264 24.81240620310155 26.21310655327664 52-53 25.387693846923458 21.210605302651324 23.19909954977489 30.202601300650322 54-55 27.558168626469854 22.554415811858895 24.305729296972732 25.581686264698522 56-57 24.44305381727159 22.878598247809762 24.455569461827285 28.222778473091363 58-59 24.80600750938673 23.341677096370464 24.180225281602002 27.672090112640802 60-61 27.350106396294905 22.105394918012266 24.345975716610337 26.19852296908249 62-63 24.036054081121684 23.71056584877316 23.84827240861292 28.40510766149224 64-65 26.70255383074612 22.8843264897346 24.44917376064096 25.963945918878316 66-67 23.935903855783675 27.929394091136707 22.30846269404106 25.826239359038556 68-69 24.236354531797698 25.78868302453681 23.372558838257387 26.602403605408114 70-71 28.70555833750626 22.8092138207311 22.371056584877316 26.114171256885328 72-73 29.056084126189287 22.821732598898347 21.957936905358036 26.164246369554334 74-75 28.492739108662995 22.183274912368553 23.28492739108663 26.039058587881826 76-77 29.694541812719077 21.932899349023536 22.746619929894845 25.625938908362546 78-79 29.631947921882823 21.807711567351028 22.1457185778668 26.41462193289935 80-81 29.018527791687532 22.396094141211815 22.30846269404106 26.27691537305959 82-83 28.818227341011514 22.25838758137206 23.13470205307962 25.78868302453681 84-85 28.517776664997495 21.84526790185278 23.43515272909364 26.20180270405608 86-87 29.05083896819434 22.852491860756324 22.501878287002253 25.59479088404708 88-89 30.02254509018036 22.307114228456914 21.317635270541082 26.352705410821642 90-91 28.79509018036072 22.958416833667332 21.8687374749499 26.377755511022045 92-93 28.920340681362728 21.50551102204409 23.033567134268537 26.54058116232465 94-95 28.915058882485596 22.337759959909796 22.751190177900277 25.995990979704338 96-97 30.245675607921786 22.16094259212835 21.847580847330157 25.745800952619703 98-99 30.35213064557285 20.45164582801735 22.735391681551416 26.460831844858383 100-101 32.15122637087955 9.795344477425402 26.620840493672866 31.43258865802218 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 6.0 1 3.5 2 0.5 3 0.5 4 1.0 5 1.0 6 0.5 7 0.0 8 0.5 9 1.0 10 0.5 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 2.0 25 2.5 26 0.5 27 1.0 28 1.5 29 4.0 30 9.0 31 9.5 32 8.5 33 13.5 34 17.5 35 24.0 36 34.5 37 51.0 38 65.5 39 65.5 40 80.5 41 105.0 42 116.5 43 122.5 44 134.0 45 147.0 46 161.5 47 151.5 48 148.0 49 159.0 50 132.5 51 118.0 52 120.5 53 111.5 54 104.0 55 99.0 56 94.0 57 87.5 58 80.5 59 73.5 60 78.5 61 75.5 62 75.5 63 81.5 64 82.5 65 126.0 66 153.5 67 112.0 68 76.5 69 65.5 70 59.5 71 64.5 72 63.5 73 49.0 74 35.5 75 33.0 76 30.0 77 21.0 78 15.5 79 14.5 80 11.5 81 9.0 82 4.5 83 1.0 84 0.5 85 0.0 86 0.5 87 0.5 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.05 2 0.27499999999999997 3 0.05 4 0.05 5 0.05 6 0.05 7 0.05 8 0.05 9 0.05 10-11 0.05 12-13 0.05 14-15 0.05 16-17 0.05 18-19 0.05 20-21 0.05 22-23 0.05 24-25 0.05 26-27 0.05 28-29 0.05 30-31 0.05 32-33 0.05 34-35 0.05 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 34-35 2.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 1.0 54-55 2.0 56-57 0.0 58-59 0.0 60-61 1.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 1.0 86-87 1.0 88-89 0.0 90-91 0.0 92-93 1.0 94-95 1.0 96-97 30.0 98-99 314.0 100-101 3646.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 88.125 #Duplication Level Percentage of deduplicated Percentage of total 1 91.80141843971631 80.9 2 7.829787234042553 13.8 3 0.28368794326241137 0.75 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.028368794326241134 0.22499999999999998 >10 0.028368794326241134 1.075 >50 0.0 0.0 >100 0.028368794326241134 3.25 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACAGCGATAGATCTCGTAT 130 3.25 TruSeq Adapter, Index 1 (97% over 36bp) GATCGGAAGAGCACACGTCTGAACTCCAGTCACAGCGATAGATCGCGTAT 43 1.075 TruSeq Adapter, Index 1 (97% over 36bp) TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT 9 0.22499999999999998 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.025 8 0.0 0.0 0.0 0.0 0.025 9 0.0 0.0 0.0 0.0 0.025 10-11 0.0 0.0 0.0 0.0 0.025 12-13 0.0 0.0 0.0 0.0 0.025 14-15 0.0 0.0 0.0 0.0 0.025 16-17 0.0 0.0 0.0 0.0 0.025 18-19 0.0 0.0 0.0 0.0 0.025 20-21 0.0 0.0 0.0 0.0 0.025 22-23 0.0 0.0 0.0 0.0 0.025 24-25 0.0 0.0 0.0 0.0 0.025 26-27 0.0 0.0 0.0 0.0 0.025 28-29 0.0 0.0 0.0 0.0 0.025 30-31 0.0 0.0 0.0 0.0 0.025 32-33 0.0 0.0 0.0 0.0 0.025 34-35 0.0 0.0 0.0 0.0 0.025 36-37 0.0 0.0 0.0 0.0 0.025 38-39 0.0 0.0 0.0 0.0 0.025 40-41 0.0 0.0 0.0 0.0 0.025 42-43 0.0 0.0 0.0 0.0 0.025 44-45 0.0 0.0 0.0 0.0 0.025 46-47 0.0 0.0 0.0 0.0 0.025 48-49 0.0 0.0 0.0 0.0 0.025 50-51 0.0 0.0 0.0 0.0 0.025 52-53 0.0 0.0 0.0 0.0 0.025 54-55 0.0 0.0 0.0 0.0 0.025 56-57 0.0 0.0 0.0 0.0 0.025 58-59 0.0 0.0 0.0 0.0 0.025 60-61 0.0125 0.0 0.0 0.0 0.025 62-63 0.025 0.0 0.0 0.0 0.025 64-65 0.025 0.0 0.0 0.0 0.025 66-67 0.025 0.0 0.0 0.0 0.025 68-69 0.025 0.0 0.0 0.0 0.025 70-71 0.025 0.0 0.0 0.0 0.025 72-73 0.025 0.0 0.0 0.0 0.025 74-75 0.025 0.0 0.0 0.0 0.025 76-77 0.025 0.0 0.0 0.0 0.025 78-79 0.025 0.0 0.0 0.0 0.025 80-81 0.025 0.0 0.0 0.0 0.025 82-83 0.025 0.0 0.0 0.0 0.025 84-85 0.025 0.0 0.0 0.0 0.025 86-87 0.025 0.0 0.0 0.0 0.025 88-89 0.025 0.0 0.0 0.0 0.025 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 229227 spots for SRR21853542.sra Written 229227 spots for SRR21853542.sra Read 229227 spots for SRR21853542.sra Written 229227 spots for SRR21853542.sra Read 229227 spots for SRR21853542.sra Written 229227 spots for SRR21853542.sra Read 229227 spots for SRR21853542.sra Written 229227 spots for SRR21853542.sra Read 229227 spots for SRR21853542.sra Written 229227 spots for SRR21853542.sra Read 229227 spots for SRR21853542.sra Written 229227 spots for SRR21853542.sra Read 229227 spots for SRR21853542.sra Written 229227 spots for SRR21853542.sra Read 229227 spots for SRR21853542.sra Written 229227 spots for SRR21853542.sra Read 229227 spots for SRR21853542.sra Written 229227 spots for SRR21853542.sra Read 229227 spots for SRR21853542.sra Written 229227 spots for SRR21853542.sra Read 229227 spots for SRR21853542.sra Written 229227 spots for SRR21853542.sra Read 229227 spots for SRR21853542.sra Written 229227 spots for SRR21853542.sra Read 229227 spots for SRR21853542.sra Written 229227 spots for SRR21853542.sra Read 229227 spots for SRR21853542.sra Written 229227 spots for SRR21853542.sra Read 229227 spots for SRR21853542.sra Written 229227 spots for SRR21853542.sra Read 229227 spots for SRR21853542.sra Written 229227 spots for SRR21853542.sra Read 229246 spots for SRR21853542.sra Written 229246 spots for SRR21853542.sra Read 229227 spots for SRR21853542.sra Written 229227 spots for SRR21853542.sra Read 229227 spots for SRR21853542.sra Written 229227 spots for SRR21853542.sra Read 229227 spots for SRR21853542.sra Written 229227 spots for SRR21853542.sra SRR ids: ['SRR21853542.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_d5l8iino SRR21853542.sra spots: 4584559 blocks: [[1, 229227], [229228, 458454], [458455, 687681], [687682, 916908], [916909, 1146135], [1146136, 1375362], [1375363, 1604589], [1604590, 1833816], [1833817, 2063043], [2063044, 2292270], [2292271, 2521497], [2521498, 2750724], [2750725, 2979951], [2979952, 3209178], [3209179, 3438405], [3438406, 3667632], [3667633, 3896859], [3896860, 4126086], [4126087, 4355313], [4355314, 4584559]] SRR21853542 file size 1232011 SRR21853542 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR21853542 SRR21853542_1.fastq Input file: SRR21853542_1.fastq trimmed: SRR21853542-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Fri Dec 6 17:29:54 2024 >> started Fri Dec 6 17:29:57 2024 >> done (2.375s) 4584559 reads processed; of these: 16 ( 0.00%) short reads filtered out after trimming by size control 178141 ( 3.89%) empty reads filtered out after trimming by size control 4406402 (96.11%) reads available; of these: 143 ( 0.00%) trimmed reads available after processing 4406259 (100.00%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 0 0.00% 20 1 0.00% 21 1 0.00% 22 1 0.00% 23 1 0.00% 24 2 0.00% 25 1 0.00% 26 0 0.00% 27 1 0.00% 28 3 0.00% 29 0 0.00% 30 2 0.00% 31 4 0.00% 32 1 0.00% 33 1 0.00% 34 3 0.00% 35 44 0.00% 36 40 0.00% 37 48 0.00% 38 36 0.00% 39 48 0.00% 40 47 0.00% 41 52 0.00% 42 40 0.00% 43 48 0.00% 44 46 0.00% 45 37 0.00% 46 60 0.00% 47 64 0.00% 48 50 0.00% 49 61 0.00% 50 63 0.00% 51 72 0.00% 52 67 0.00% 53 71 0.00% 54 75 0.00% 55 78 0.00% 56 48 0.00% 57 80 0.00% 58 63 0.00% 59 95 0.00% 60 73 0.00% 61 95 0.00% 62 82 0.00% 63 89 0.00% 64 69 0.00% 65 71 0.00% 66 90 0.00% 67 78 0.00% 68 87 0.00% 69 84 0.00% 70 92 0.00% 71 133 0.00% 72 113 0.00% 73 118 0.00% 74 108 0.00% 75 137 0.00% 76 142 0.00% 77 124 0.00% 78 116 0.00% 79 130 0.00% 80 159 0.00% 81 152 0.00% 82 164 0.00% 83 188 0.00% 84 181 0.00% 85 164 0.00% 86 203 0.00% 87 193 0.00% 88 231 0.01% 89 256 0.01% 90 240 0.01% 91 335 0.01% 92 283 0.01% 93 315 0.01% 94 494 0.01% 95 1278 0.03% 96 5988 0.14% 97 19577 0.44% 98 76105 1.73% 99 290109 6.58% 100 964281 21.88% 101 3042019 69.04% 4406402 reads passed initial QC criterion=sequence-density sequence-density=0.25 sequence-density-rank=1 fanout-score=2.41 fanout-score-rank=19 prefix-density=0.26 prefix-fanout=2.3 sequence=CCATGGCACCCACCGTGATGGCTTCCTCCGCCACCTCCGTGGC criterion=fanout-score sequence-density=0.11 sequence-density-rank=14 fanout-score=217.32 fanout-score-rank=1 prefix-density=0.97 prefix-fanout=24.4 sequence=CGCCGCCGCCGC Started job on | Dec 06 17:30:12 Started mapping on | Dec 06 17:30:12 Finished on | Dec 06 17:30:19 Mapping speed, Million of reads per hour | 2266.15 Number of input reads | 4406402 Average input read length | 100 UNIQUE READS: Uniquely mapped reads number | 4049668 Uniquely mapped reads % | 91.90% Average mapped length | 100.26 Number of splices: Total | 1339817 Number of splices: Annotated (sjdb) | 1268528 Number of splices: GT/AG | 1320818 Number of splices: GC/AG | 16319 Number of splices: AT/AC | 711 Number of splices: Non-canonical | 1969 Mismatch rate per base, % | 0.30% Deletion rate per base | 0.00% Deletion average length | 1.82 Insertion rate per base | 0.00% Insertion average length | 1.30 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 152198 % of reads mapped to multiple loci | 3.45% Number of reads mapped to too many loci | 137389 % of reads mapped to too many loci | 3.12% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.03% % of reads unmapped: other | 0.49% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 204536 204536 204536 N_multimapping 152198 152198 152198 N_noFeature 163892 2102228 2058361 N_ambiguous 62087 5359 4160 UnstrandedReadsAssigned:3823689 PositiveStrandReadsAssigned:1942081 NegativeStrandReadsAssigned:1987147 Dataset is classified unstranded MeadianReadLen=101 20thPercentileLength=100 echo kmer=95 SRR21853542 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR21853542-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 4,406,402 reads, 3,956,025 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,058 rounds 52973 SRR21853542.ke.tsv 35125 SRR21853542.se.tsv 88098 total ==> SRR21853542.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 0.00116965 0.000599946 PNS24247 1044 945 11.0753 5.0316 PNS24249 1928 1829 51.757 12.1489 PNS24246 1044 945 11.0753 5.0316 PNS24248 1044 945 11.0753 5.0316 PNS24244 1471 1372 7.0158 2.19535 PNS24243 293 194 10 22.1299 KQK14069 1603 1504 1458.64 416.371 KQK14071 474 375 90.9057 104.074 ==> SRR21853542.se.tsv <== BRADI_1g14170v3 1694 BRADI_1g53295v3 32 BRADI_1g59795v3 37 BRADI_1g07683v3 0 BRADI_1g00485v3 17 BRADI_1g20270v3 360 BRADI_1g74790v3 50 BRADI_1g09890v3 1 BRADI_1g77505v3 44 BRADI_1g48960v3 0 SRR21853542 completed mapping pipeline successfully