Starting /dee2/code/volunteer_pipeline.sh SRR21853543 current disk space = 1550665322496 free memory = 1375275412 SRR21853543 SRAfilesize a49a2b3381e7bd99c8448f24d793300a SRR21853543.sra SRR21853543.sra file validated SRR21853543 is single end SRR21853543 is conventional basespace SRR21853543 read1 length is 35-101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR21853543_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 35-101 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.0375 37.0 37.0 37.0 25.0 37.0 2 35.6085 37.0 37.0 37.0 37.0 37.0 3 35.786 37.0 37.0 37.0 37.0 37.0 4 35.8775 37.0 37.0 37.0 37.0 37.0 5 35.894 37.0 37.0 37.0 37.0 37.0 6 35.9435 37.0 37.0 37.0 37.0 37.0 7 35.78 37.0 37.0 37.0 37.0 37.0 8 35.86 37.0 37.0 37.0 37.0 37.0 9 35.8835 37.0 37.0 37.0 37.0 37.0 10-11 35.951 37.0 37.0 37.0 37.0 37.0 12-13 35.87875 37.0 37.0 37.0 37.0 37.0 14-15 36.002250000000004 37.0 37.0 37.0 37.0 37.0 16-17 35.9645 37.0 37.0 37.0 37.0 37.0 18-19 35.914 37.0 37.0 37.0 37.0 37.0 20-21 35.91075 37.0 37.0 37.0 37.0 37.0 22-23 35.83525 37.0 37.0 37.0 37.0 37.0 24-25 35.79875 37.0 37.0 37.0 37.0 37.0 26-27 35.77125 37.0 37.0 37.0 37.0 37.0 28-29 35.571 37.0 37.0 37.0 37.0 37.0 30-31 35.691 37.0 37.0 37.0 37.0 37.0 32-33 35.66025 37.0 37.0 37.0 37.0 37.0 34-35 35.68575 37.0 37.0 37.0 37.0 37.0 36-37 35.618934467233615 37.0 37.0 37.0 37.0 37.0 38-39 35.520010005002504 37.0 37.0 37.0 37.0 37.0 40-41 35.562031015507756 37.0 37.0 37.0 37.0 37.0 42-43 35.53901950975488 37.0 37.0 37.0 37.0 37.0 44-45 35.279264632316156 37.0 37.0 37.0 31.0 37.0 46-47 35.3868184092046 37.0 37.0 37.0 37.0 37.0 48-49 35.448224112056025 37.0 37.0 37.0 37.0 37.0 50-51 35.4032016008004 37.0 37.0 37.0 37.0 37.0 52-53 35.45397698849425 37.0 37.0 37.0 37.0 37.0 54-55 35.395447723861935 37.0 37.0 37.0 37.0 37.0 56-57 35.33341670835418 37.0 37.0 37.0 31.0 37.0 58-59 35.263881940970485 37.0 37.0 37.0 31.0 37.0 60-61 35.27188594297149 37.0 37.0 37.0 25.0 37.0 62-63 35.16183091545773 37.0 37.0 37.0 25.0 37.0 64-65 35.182591295647825 37.0 37.0 37.0 31.0 37.0 66-67 35.128064032016006 37.0 37.0 37.0 25.0 37.0 68-69 34.98449224612307 37.0 37.0 37.0 25.0 37.0 70-71 34.73061530765382 37.0 37.0 37.0 25.0 37.0 72-73 35.049286965223914 37.0 37.0 37.0 25.0 37.0 74-75 35.16562421816363 37.0 37.0 37.0 25.0 37.0 76-77 35.2557164995869 37.0 37.0 37.0 31.0 37.0 78-79 35.02877877877878 37.0 37.0 37.0 25.0 37.0 80-81 35.25580023076894 37.0 37.0 37.0 31.0 37.0 82-83 34.963954943679596 37.0 37.0 37.0 25.0 37.0 84-85 35.17797246558197 37.0 37.0 37.0 25.0 37.0 86-87 34.931163954943685 37.0 37.0 37.0 25.0 37.0 88-89 34.984981226533165 37.0 37.0 37.0 25.0 37.0 90-91 34.978222778473096 37.0 37.0 37.0 25.0 37.0 92-93 34.89086357947434 37.0 37.0 37.0 25.0 37.0 94-95 34.83554443053818 37.0 37.0 37.0 25.0 37.0 96-97 34.921067473797734 37.0 37.0 37.0 25.0 37.0 98-99 34.797669801184 37.0 37.0 37.0 25.0 37.0 100-101 34.61648592803817 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 2101 1 0.0 2101 2 0.0 2101 3 0.0 2101 4 0.0 2101 5 0.0 2101 6 0.0 2101 7 0.0 2101 8 0.0 2101 9 0.0 2101 10-11 0.0 2101 12-13 0.0 2101 14-15 0.0 2101 16-17 0.0 2101 18-19 0.0 2101 20-21 0.0 2101 22-23 0.0 2101 24-25 0.0 2101 26-27 0.0 2101 28-29 0.0 2101 30-31 0.0 2101 32-33 0.0 2101 34-35 0.0 2101 36-37 0.0 2101 38-39 0.0 2101 40-41 0.0 2101 42-43 0.0 2101 44-45 0.0 2101 46-47 0.0 2101 48-49 0.0 2101 50-51 0.0 2101 52-53 0.0 2101 54-55 0.0 2101 56-57 0.0 2101 58-59 0.0 2101 60-61 0.0 2101 62-63 0.0 2101 64-65 0.0 2101 66-67 0.0 2101 68-69 0.0 2101 70-71 0.0 2101 72-73 0.0 2101 74-75 0.0 2101 76-77 0.0 2101 78-79 0.0 2101 80-81 0.0 2101 82-83 0.0 2101 84-85 0.0 2101 86-87 0.0 2101 88-89 0.0 2101 90-91 0.0 2101 92-93 0.0 2101 94-95 0.0 2101 96-97 0.0 2101 98-99 0.0 2101 100-101 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 2.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 1.0 22 2.0 23 3.0 24 2.0 25 17.0 26 9.0 27 24.0 28 33.0 29 41.0 30 62.0 31 106.0 32 143.0 33 235.0 34 370.0 35 677.0 36 1942.0 37 331.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 30.64596895343015 11.892839258888333 16.399599399098648 41.06159238858287 2 25.56278139069535 22.086043021510758 28.46423211605803 23.88694347173587 3 26.063031515757878 23.011505752876438 23.836918459229615 27.088544272136065 4 27.63881940970485 28.264132066033014 16.60830415207604 27.48874437218609 5 28.53926963481741 28.714357178589296 20.110055027513756 22.63631815907954 6 24.61230615307654 30.86543271635818 21.335667833916958 23.186593296648326 7 20.23511755877939 17.733866933466732 36.818409204602304 25.212606303151574 8 23.08654327163582 21.710855427713856 23.71185592796398 31.49074537268634 9 24.7623811905953 19.70985492746373 26.863431715857928 28.66433216608304 10-11 27.301150575287643 27.776388194097045 18.434217108554275 26.488244122061033 12-13 24.174587293646823 22.07353676838419 25.050025012506254 28.70185092546273 14-15 24.074537268634316 24.212106053026513 23.58679339669835 28.12656328164082 16-17 26.050525262631314 23.424212106053027 22.886443221610804 27.63881940970485 18-19 24.81240620310155 24.099549774887443 24.16208104052026 26.92596298149075 20-21 25.975487743871934 22.773886943471737 24.499749874937468 26.750875437718857 22-23 24.874937468734366 26.113056528264135 22.63631815907954 26.375687843921963 24-25 24.54977488744372 23.17408704352176 24.12456228114057 28.151575787893947 26-27 25.60030015007504 24.487243621810904 22.061030515257627 27.851425712856425 28-29 26.25062531265633 25.07503751875938 22.273636818409205 26.40070035017509 30-31 24.399699849924964 23.82441220610305 23.936968484242122 27.838919459729865 32-33 25.26263131565783 24.412206103051524 22.586293146573286 27.738869434717362 34-35 26.3631815907954 24.287143571785894 23.13656828414207 26.21310655327664 36-37 26.504065040650403 22.439024390243905 22.82676672920575 28.230143839899934 38-39 25.50025012506253 24.324662331165584 23.54927463731866 26.625812906453227 40-41 25.63781890945473 25.437718859429715 21.98599299649825 26.93846923461731 42-43 25.30015007503752 24.212106053026513 24.874937468734366 25.6128064032016 44-45 24.315196998123827 23.30206378986867 23.68980612883052 28.692933083176985 46-47 26.841776110068793 22.276422764227643 23.2520325203252 27.629768605378363 48-49 25.062531265632813 24.449724862431214 24.074537268634316 26.413206603301653 50-51 26.563281640820406 22.998999499749875 24.099549774887443 26.338169084542272 52-53 25.18759379689845 24.412206103051524 22.0360180090045 28.36418209104552 54-55 26.675837918959477 22.736368184092047 24.074537268634316 26.513256628314156 56-57 25.07503751875938 23.349174587293646 24.58729364682341 26.988494247123562 58-59 25.350175087543768 23.411705852926463 23.424212106053027 27.813906953476735 60-61 26.713356678339167 23.036518259129565 23.461730865432717 26.788394197098548 62-63 26.263131565782892 23.71185592796398 22.061030515257627 27.963981990995496 64-65 26.788394197098548 23.78689344672336 23.074037018509255 26.350675337668832 66-67 25.962981490745374 24.637318659329665 22.948974487243625 26.450725362681343 68-69 25.67533766883442 24.512256128064035 23.999499749874936 25.812906453226613 70-71 27.938969484742373 22.723861930965484 22.11105552776388 27.226113056528263 72-73 27.445584188141105 23.079809857393045 23.46760070052539 26.007005253940456 74-75 28.508881661245933 22.86715036277208 22.454340755566676 26.169627220415308 76-77 28.08707619166771 23.05767546603278 22.657325159514574 26.197923182784937 78-79 27.64014014014014 22.64764764764765 21.896896896896898 27.815315315315313 80-81 28.09410586910274 22.625453635339756 22.45025653860593 26.83018395695157 82-83 28.498122653316642 23.103879849812266 22.853566958698373 25.544430538172712 84-85 27.80976220275344 23.09136420525657 22.778473091364205 26.320400500625784 86-87 28.71088861076345 23.366708385481854 21.964956195244056 25.957446808510635 88-89 28.685857321652065 22.60325406758448 22.95369211514393 25.75719649561952 90-91 28.573216520650814 21.914893617021278 23.30413016270338 26.207759699624532 92-93 27.83479349186483 23.404255319148938 22.866082603254068 25.894868585732166 94-95 27.859824780976222 22.728410513141426 22.640801001251564 26.77096370463079 96-97 27.93233082706767 22.644110275689222 22.907268170426065 26.516290726817044 98-99 28.881553891075285 22.10232321949981 22.72438745715374 26.291735432271167 100-101 29.940957116221256 10.037290242386575 26.864512119328776 33.15724052206339 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 4.0 1 2.0 2 0.5 3 1.0 4 0.5 5 0.5 6 0.5 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.0 20 0.0 21 0.5 22 1.0 23 0.5 24 1.0 25 1.0 26 1.5 27 2.5 28 2.5 29 5.0 30 7.0 31 9.5 32 14.0 33 16.0 34 21.0 35 29.5 36 35.5 37 40.0 38 54.0 39 66.0 40 76.0 41 98.5 42 126.5 43 136.5 44 132.0 45 144.5 46 153.5 47 160.5 48 162.0 49 146.0 50 135.5 51 120.0 52 113.0 53 118.0 54 110.0 55 102.5 56 93.0 57 81.0 58 88.0 59 95.0 60 94.0 61 93.5 62 78.5 63 79.0 64 91.0 65 108.5 66 114.0 67 86.5 68 67.5 69 63.0 70 67.5 71 68.5 72 61.5 73 49.0 74 40.5 75 37.5 76 30.0 77 22.0 78 15.0 79 9.5 80 7.0 81 7.0 82 5.5 83 3.0 84 1.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.15 2 0.05 3 0.05 4 0.05 5 0.05 6 0.05 7 0.05 8 0.05 9 0.05 10-11 0.05 12-13 0.05 14-15 0.05 16-17 0.05 18-19 0.05 20-21 0.05 22-23 0.05 24-25 0.05 26-27 0.05 28-29 0.05 30-31 0.05 32-33 0.05 34-35 0.05 36-37 0.01250625312656328 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.01250625312656328 46-47 0.01250625312656328 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 34-35 2.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 1.0 72-73 0.0 74-75 0.0 76-77 1.0 78-79 0.0 80-81 1.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 2.0 96-97 19.0 98-99 322.0 100-101 3652.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.77499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 94.6645109135004 87.825 2 5.066019940716788 9.4 3 0.2155753166262463 0.6 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.026946914578280787 0.475 >50 0.026946914578280787 1.7000000000000002 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACAGCGATAGATCTCGTAT 68 1.7000000000000002 TruSeq Adapter, Index 1 (97% over 36bp) GATCGGAAGAGCACACGTCTGAACTCCAGTCACAGCGATAGATCGCGTAT 19 0.475 TruSeq Adapter, Index 1 (97% over 36bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 178155 spots for SRR21853543.sra Written 178155 spots for SRR21853543.sra Read 178155 spots for SRR21853543.sra Written 178155 spots for SRR21853543.sra Read 178155 spots for SRR21853543.sra Written 178155 spots for SRR21853543.sra Read 178155 spots for SRR21853543.sra Written 178155 spots for SRR21853543.sra Read 178155 spots for SRR21853543.sra Written 178155 spots for SRR21853543.sra Read 178155 spots for SRR21853543.sra Written 178155 spots for SRR21853543.sra Read 178155 spots for SRR21853543.sra Written 178155 spots for SRR21853543.sra Read 178155 spots for SRR21853543.sra Written 178155 spots for SRR21853543.sra Read 178155 spots for SRR21853543.sra Written 178155 spots for SRR21853543.sra Read 178155 spots for SRR21853543.sra Written 178155 spots for SRR21853543.sra Read 178155 spots for SRR21853543.sra Written 178155 spots for SRR21853543.sra Read 178155 spots for SRR21853543.sra Written 178155 spots for SRR21853543.sra Read 178164 spots for SRR21853543.sra Written 178164 spots for SRR21853543.sra Read 178155 spots for SRR21853543.sra Written 178155 spots for SRR21853543.sra Read 178155 spots for SRR21853543.sra Written 178155 spots for SRR21853543.sra Read 178155 spots for SRR21853543.sra Written 178155 spots for SRR21853543.sra Read 178155 spots for SRR21853543.sra Written 178155 spots for SRR21853543.sra Read 178155 spots for SRR21853543.sra Written 178155 spots for SRR21853543.sra Read 178155 spots for SRR21853543.sra Written 178155 spots for SRR21853543.sra Read 178155 spots for SRR21853543.sra Written 178155 spots for SRR21853543.sra SRR ids: ['SRR21853543.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_e779mpe9 SRR21853543.sra spots: 3563109 blocks: [[1, 178155], [178156, 356310], [356311, 534465], [534466, 712620], [712621, 890775], [890776, 1068930], [1068931, 1247085], [1247086, 1425240], [1425241, 1603395], [1603396, 1781550], [1781551, 1959705], [1959706, 2137860], [2137861, 2316015], [2316016, 2494170], [2494171, 2672325], [2672326, 2850480], [2850481, 3028635], [3028636, 3206790], [3206791, 3384945], [3384946, 3563109]] SRR21853543 file size 957449 SRR21853543 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR21853543 SRR21853543_1.fastq Input file: SRR21853543_1.fastq trimmed: SRR21853543-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Fri Dec 6 17:31:48 2024 >> started Fri Dec 6 17:31:50 2024 >> done (2.229s) 3563109 reads processed; of these: 11 ( 0.00%) short reads filtered out after trimming by size control 96473 ( 2.71%) empty reads filtered out after trimming by size control 3466625 (97.29%) reads available; of these: 233 ( 0.01%) trimmed reads available after processing 3466392 (99.99%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 1 0.00% 20 0 0.00% 21 2 0.00% 22 0 0.00% 23 1 0.00% 24 1 0.00% 25 0 0.00% 26 0 0.00% 27 0 0.00% 28 0 0.00% 29 2 0.00% 30 0 0.00% 31 0 0.00% 32 1 0.00% 33 1 0.00% 34 5 0.00% 35 23 0.00% 36 21 0.00% 37 23 0.00% 38 16 0.00% 39 22 0.00% 40 21 0.00% 41 24 0.00% 42 22 0.00% 43 30 0.00% 44 19 0.00% 45 27 0.00% 46 16 0.00% 47 32 0.00% 48 26 0.00% 49 33 0.00% 50 26 0.00% 51 35 0.00% 52 25 0.00% 53 25 0.00% 54 31 0.00% 55 30 0.00% 56 30 0.00% 57 24 0.00% 58 28 0.00% 59 37 0.00% 60 34 0.00% 61 28 0.00% 62 38 0.00% 63 37 0.00% 64 23 0.00% 65 47 0.00% 66 42 0.00% 67 34 0.00% 68 34 0.00% 69 37 0.00% 70 44 0.00% 71 44 0.00% 72 44 0.00% 73 58 0.00% 74 42 0.00% 75 50 0.00% 76 50 0.00% 77 60 0.00% 78 61 0.00% 79 59 0.00% 80 60 0.00% 81 73 0.00% 82 68 0.00% 83 75 0.00% 84 76 0.00% 85 102 0.00% 86 93 0.00% 87 89 0.00% 88 105 0.00% 89 98 0.00% 90 131 0.00% 91 201 0.01% 92 138 0.00% 93 159 0.00% 94 311 0.01% 95 971 0.03% 96 4660 0.13% 97 15094 0.44% 98 59224 1.71% 99 227292 6.56% 100 751791 21.69% 101 2404287 69.36% 3466625 reads passed initial QC criterion=sequence-density sequence-density=0.20 sequence-density-rank=1 fanout-score=2.29 fanout-score-rank=23 prefix-density=0.24 prefix-fanout=1.9 sequence=GCTCCTTTCCAGGG criterion=fanout-score sequence-density=0.08 sequence-density-rank=21 fanout-score=295.02 fanout-score-rank=1 prefix-density=1.01 prefix-fanout=24.5 sequence=CGCCGCCGCCGA Started job on | Dec 06 17:32:12 Started mapping on | Dec 06 17:32:12 Finished on | Dec 06 17:32:19 Mapping speed, Million of reads per hour | 1782.84 Number of input reads | 3466625 Average input read length | 100 UNIQUE READS: Uniquely mapped reads number | 3188788 Uniquely mapped reads % | 91.99% Average mapped length | 100.31 Number of splices: Total | 1033720 Number of splices: Annotated (sjdb) | 978899 Number of splices: GT/AG | 1019306 Number of splices: GC/AG | 12710 Number of splices: AT/AC | 539 Number of splices: Non-canonical | 1165 Mismatch rate per base, % | 0.18% Deletion rate per base | 0.00% Deletion average length | 1.77 Insertion rate per base | 0.00% Insertion average length | 1.29 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 117001 % of reads mapped to multiple loci | 3.38% Number of reads mapped to too many loci | 119118 % of reads mapped to too many loci | 3.44% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.92% % of reads unmapped: other | 0.28% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 160836 160836 160836 N_multimapping 117001 117001 117001 N_noFeature 127578 1660632 1614226 N_ambiguous 48844 4527 3144 UnstrandedReadsAssigned:3012366 PositiveStrandReadsAssigned:1523629 NegativeStrandReadsAssigned:1571418 Dataset is classified unstranded MeadianReadLen=101 20thPercentileLength=100 echo kmer=95 SRR21853543 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR21853543-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 3,466,625 reads, 3,115,950 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,101 rounds 52973 SRR21853543.ke.tsv 35125 SRR21853543.se.tsv 88098 total ==> SRR21853543.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 0 0 PNS24247 1044 945 11.8356 6.8241 PNS24249 1928 1829 45.7614 13.6324 PNS24246 1044 945 11.8356 6.8241 PNS24248 1044 945 11.8356 6.8241 PNS24244 1471 1372 2.73178 1.08487 PNS24243 293 194 4 11.2343 KQK14069 1603 1504 1077.41 390.32 KQK14071 474 375 54.1423 78.6669 ==> SRR21853543.se.tsv <== BRADI_1g14170v3 1259 BRADI_1g53295v3 30 BRADI_1g59795v3 33 BRADI_1g07683v3 0 BRADI_1g00485v3 13 BRADI_1g20270v3 302 BRADI_1g74790v3 47 BRADI_1g09890v3 4 BRADI_1g77505v3 44 BRADI_1g48960v3 0 SRR21853543 completed mapping pipeline successfully