Starting /dee2/code/volunteer_pipeline.sh SRR21853544 current disk space = 1550584508416 free memory = 1378769352 SRR21853544 SRAfilesize 9de291f9a716d5ceae1d87a500146153 SRR21853544.sra SRR21853544.sra file validated SRR21853544 is single end SRR21853544 is conventional basespace SRR21853544 read1 length is 35-101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR21853544_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 35-101 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.28425 32.0 32.0 32.0 32.0 32.0 2 31.39975 32.0 32.0 32.0 32.0 32.0 3 31.538 32.0 32.0 32.0 32.0 32.0 4 31.54875 32.0 32.0 32.0 32.0 32.0 5 31.64375 32.0 32.0 32.0 32.0 32.0 6 34.8675 36.0 36.0 36.0 36.0 36.0 7 35.16775 36.0 36.0 36.0 36.0 36.0 8 35.127 36.0 36.0 36.0 36.0 36.0 9 35.0795 36.0 36.0 36.0 36.0 36.0 10-11 35.143125 36.0 36.0 36.0 36.0 36.0 12-13 35.1445 36.0 36.0 36.0 36.0 36.0 14-15 35.147875 36.0 36.0 36.0 36.0 36.0 16-17 35.016000000000005 36.0 36.0 36.0 36.0 36.0 18-19 35.062375 36.0 36.0 36.0 36.0 36.0 20-21 35.1485 36.0 36.0 36.0 36.0 36.0 22-23 34.988125 36.0 36.0 36.0 34.0 36.0 24-25 35.050375 36.0 36.0 36.0 36.0 36.0 26-27 34.897875 36.0 36.0 36.0 32.0 36.0 28-29 34.965125 36.0 36.0 36.0 34.0 36.0 30-31 34.97825 36.0 36.0 36.0 36.0 36.0 32-33 34.752250000000004 36.0 36.0 36.0 32.0 36.0 34-35 34.838625 36.0 36.0 36.0 34.0 36.0 36-37 34.73786893446724 36.0 36.0 36.0 32.0 36.0 38-39 34.726863431715856 36.0 36.0 36.0 34.0 36.0 40-41 34.67196098049024 36.0 36.0 36.0 34.0 36.0 42-43 34.44497248624312 36.0 36.0 36.0 32.0 36.0 44-45 34.20985492746373 36.0 36.0 36.0 32.0 36.0 46-47 34.68234117058529 36.0 36.0 36.0 32.0 36.0 48-49 34.68271635817909 36.0 36.0 36.0 32.0 36.0 50-51 34.66445722861431 36.0 36.0 36.0 32.0 36.0 52-53 34.59867433716858 36.0 36.0 36.0 32.0 36.0 54-55 34.40095047523762 36.0 36.0 36.0 32.0 36.0 56-57 34.509629814907456 36.0 36.0 36.0 32.0 36.0 58-59 34.18296648324162 36.0 36.0 36.0 32.0 36.0 60-61 34.37693846923462 36.0 36.0 36.0 32.0 36.0 62-63 34.31703351675838 36.0 36.0 36.0 32.0 36.0 64-65 34.314032016008 36.0 36.0 36.0 32.0 36.0 66-67 34.155952976488244 36.0 36.0 36.0 32.0 36.0 68-69 34.344297148574285 36.0 36.0 36.0 32.0 36.0 70-71 34.012756378189096 36.0 36.0 36.0 32.0 36.0 72-73 33.74912456228114 36.0 36.0 36.0 29.5 36.0 74-75 33.47223611805903 36.0 36.0 36.0 27.0 36.0 76-77 33.361805902951474 36.0 36.0 36.0 27.0 36.0 78-79 33.77976488244122 36.0 36.0 36.0 29.5 36.0 80-81 33.74924962481241 36.0 36.0 36.0 27.0 36.0 82-83 33.78001500750375 36.0 36.0 36.0 27.0 36.0 84-85 33.90245122561281 36.0 36.0 36.0 29.5 36.0 86-87 33.915576064239275 36.0 36.0 36.0 29.5 36.0 88-89 33.797848386289715 36.0 36.0 36.0 27.0 36.0 90-91 33.94507896062187 36.0 36.0 36.0 32.0 36.0 92-93 33.788861076345434 36.0 36.0 36.0 27.0 36.0 94-95 33.64668335419274 36.0 36.0 36.0 27.0 36.0 96-97 33.703585498739116 36.0 36.0 36.0 27.0 36.0 98-99 33.69587982891339 36.0 36.0 36.0 27.0 36.0 100-101 32.82329647447749 36.0 34.0 36.0 20.5 36.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 11101 1 0.0 11101 2 0.0 11101 3 0.0 11101 4 0.0 11101 5 0.0 11101 6 0.0 11101 7 0.0 11101 8 0.0 11101 9 0.0 11101 10-11 0.0 11101 12-13 0.0 11101 14-15 0.0 11101 16-17 0.0 11101 18-19 0.0 11101 20-21 0.0 11101 22-23 0.0 11101 24-25 0.0 11101 26-27 0.0 11101 28-29 0.0 11101 30-31 0.0 11101 32-33 0.0 11101 34-35 0.0 11101 36-37 0.0 11101 38-39 0.0 11101 40-41 0.0 11101 42-43 0.0 11101 44-45 0.0 11101 46-47 0.0 11101 48-49 0.0 11101 50-51 0.0 11101 52-53 0.0 11101 54-55 0.0 11101 56-57 0.0 11101 58-59 0.0 11101 60-61 0.0 11101 62-63 0.0 11101 64-65 0.0 11101 66-67 0.0 11101 68-69 0.0 11101 70-71 0.0 11101 72-73 0.0 11101 74-75 0.0 11101 76-77 0.0 11101 78-79 0.0 11101 80-81 0.0 11101 82-83 0.0 11101 84-85 0.0 11101 86-87 0.0 11101 88-89 0.0 11101 90-91 0.0 11101 92-93 0.0 11101 94-95 0.0 11101 96-97 0.0 11101 98-99 0.0 11101 100-101 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 2.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 1.0 20 5.0 21 4.0 22 7.0 23 4.0 24 9.0 25 20.0 26 14.0 27 35.0 28 70.0 29 90.0 30 102.0 31 152.0 32 197.0 33 339.0 34 707.0 35 2242.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 30.81540770385193 12.981490745372687 16.683341670835418 39.51975987993997 2 24.562281140570285 23.261630815407706 29.71485742871436 22.461230615307652 3 24.487243621810904 23.78689344672336 24.937468734367183 26.788394197098548 4 26.263131565782892 29.63981990995498 17.38369184592296 26.713356678339167 5 30.265132566283143 30.190095047523762 19.28464232116058 20.260130065032516 6 24.924774322968908 31.89568706118355 19.358074222668005 23.82146439317954 7 21.060530265132567 18.75937968984492 35.64282141070535 24.537268634317158 8 22.161080540270135 25.437718859429715 23.56178089044522 28.83941970985493 9 23.761880940470235 19.084542271135568 28.46423211605803 28.68934467233617 10-11 27.4512256128064 28.23911955977989 19.05952976488244 25.250125062531264 12-13 23.24912456228114 22.886443221610804 25.250125062531264 28.61430715357679 14-15 23.486743371685844 24.399699849924964 24.54977488744372 27.56378189094547 16-17 26.413206603301653 22.811405702851424 22.736368184092047 28.039019509754876 18-19 24.474737368684345 23.411705852926463 25.325162581290645 26.788394197098548 20-21 25.850425212606304 23.274137068534266 24.749874937468736 26.125562781390695 22-23 23.986993496748372 27.188594297148573 22.623811905952977 26.20060030015007 24-25 24.68734367183592 23.28664332166083 24.474737368684345 27.55127563781891 26-27 24.249624812406203 24.012006003001503 22.948974487243625 28.789394697348676 28-29 25.050025012506254 25.15007503751876 23.21160580290145 26.588294147073537 30-31 24.049524762381193 22.948974487243625 25.60030015007504 27.40120060030015 32-33 24.174587293646823 25.625312656328163 23.349174587293646 26.850925462731368 34-35 26.388194097048522 24.974987493746873 21.91095547773887 26.725862931465734 36-37 26.350675337668832 24.099549774887443 22.411205602801402 27.138569284642323 38-39 24.349674837418707 25.100050025012504 24.92496248124062 25.625312656328163 40-41 26.125562781390695 25.56278139069535 22.723861930965484 25.587793896948476 42-43 24.12456228114057 25.3751875937969 24.912456228114056 25.587793896948476 44-45 25.22511255627814 23.51175587793897 24.81240620310155 26.450725362681343 46-47 25.737868934467233 22.386193096548272 23.999499749874936 27.876438219109556 48-49 23.54927463731866 24.912456228114056 25.087543771885944 26.450725362681343 50-51 26.32566283141571 23.56178089044522 24.299649824912457 25.812906453226613 52-53 24.574787393696848 23.724362181090545 22.26113056528264 29.439719859929962 54-55 27.213606803401703 23.461730865432717 24.149574787393696 25.175087543771884 56-57 24.16208104052026 23.21160580290145 24.912456228114056 27.71385692846423 58-59 25.41270635317659 22.486243121560783 24.899949974987493 27.201100550275136 60-61 27.03851925962982 22.873936968484244 24.562281140570285 25.52526263131566 62-63 24.712356178089045 22.761380690345174 24.674837418709355 27.851425712856425 64-65 26.500750375187593 22.998999499749875 24.112056028014006 26.388194097048522 66-67 24.79989994997499 26.43821910955478 23.036518259129565 25.72536268134067 68-69 25.15007503751876 26.038019009504755 23.1615807903952 25.65032516258129 70-71 25.18759379689845 25.962981490745374 23.1615807903952 25.68784392196098 72-73 25.46273136568284 26.25062531265633 22.798899449724864 25.48774387193597 74-75 25.3751875937969 25.6128064032016 23.13656828414207 25.87543771885943 76-77 28.76438219109555 23.036518259129565 22.236118059029515 25.962981490745374 78-79 28.92696348174087 22.998999499749875 22.961480740370185 25.11255627813907 80-81 28.501750875437722 23.32416208104052 22.811405702851424 25.362681340670335 82-83 27.951475737868936 23.3991995997999 22.56128064032016 26.088044022011005 84-85 28.70185092546273 22.873936968484244 22.273636818409205 26.150575287643825 86-87 28.730456535334586 22.589118198874296 23.12695434646654 25.553470919324578 88-89 29.68476357267951 22.516887665749312 23.05479109331999 24.74355766825119 90-91 28.912798698861504 22.569748529963718 22.93256599524584 25.58488677592894 92-93 28.6107634543179 23.52941176470588 23.216520650813514 24.6433041301627 94-95 29.21151439299124 22.265331664580724 22.302878598247812 26.220275344180227 96-97 26.98571786519669 23.44024054121774 23.05186670007517 26.522174893510396 98-99 28.451670265464244 21.745205131461958 23.7520640162581 26.0510605868157 100-101 30.275088366374675 10.096818810511756 27.96987859228523 31.658214230828342 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 8.0 1 4.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 1.5 13 1.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 0.5 24 0.5 25 1.0 26 2.0 27 4.5 28 6.5 29 5.0 30 5.0 31 7.5 32 13.0 33 21.5 34 25.5 35 29.0 36 35.0 37 41.5 38 54.5 39 80.0 40 102.5 41 118.0 42 133.0 43 127.5 44 140.0 45 155.0 46 150.5 47 164.5 48 167.0 49 146.5 50 134.0 51 131.0 52 116.0 53 111.5 54 108.5 55 98.0 56 98.0 57 89.5 58 91.0 59 135.0 60 139.0 61 90.5 62 75.5 63 75.0 64 70.5 65 72.0 66 71.5 67 65.5 68 60.5 69 63.5 70 58.0 71 47.0 72 42.5 73 37.0 74 39.5 75 34.5 76 22.5 77 17.5 78 12.5 79 10.5 80 9.5 81 7.5 82 5.0 83 4.0 84 2.5 85 0.5 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.5 99 1.0 100 2.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.05 2 0.05 3 0.05 4 0.05 5 0.05 6 0.3 7 0.05 8 0.05 9 0.05 10-11 0.05 12-13 0.05 14-15 0.05 16-17 0.05 18-19 0.05 20-21 0.05 22-23 0.05 24-25 0.05 26-27 0.05 28-29 0.05 30-31 0.05 32-33 0.05 34-35 0.05 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 34-35 2.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 1.0 88-89 0.0 90-91 2.0 92-93 0.0 94-95 2.0 96-97 22.0 98-99 301.0 100-101 3670.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 96.42500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.42960850401866 95.875 2 0.466683951257454 0.8999999999999999 3 0.051853772361939325 0.15 4 0.025926886180969663 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.025926886180969663 2.9749999999999996 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACAGCGATAGATCTCGTAT 119 2.9749999999999996 TruSeq Adapter, Index 1 (97% over 36bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GATCGGA 15 6.2395283E-4 94.625 1 ATCGGAA 15 6.2395283E-4 94.625 2 GAAGAGC 20 0.0019562363 70.96875 6 TCGGAAG 20 0.0019562363 70.96875 3 GAGCACA 20 0.0019562363 70.96875 9 AGAGCAC 20 0.0019562363 70.96875 8 AAGAGCA 25 0.004737802 56.775 7 CGGAAGA 25 0.004737802 56.775 4 GGAAGAG 25 0.004737802 56.775 5 TCTTCTG 25 0.0015516402 37.85 54-55 GTCTTCT 30 0.003795791 31.541668 54-55 AAAAAAA 60 1.5544068E-4 23.65625 66-67 >>END_MODULE Read 298581 spots for SRR21853544.sra Written 298581 spots for SRR21853544.sra Read 298581 spots for SRR21853544.sra Written 298581 spots for SRR21853544.sra Read 298581 spots for SRR21853544.sra Written 298581 spots for SRR21853544.sra Read 298581 spots for SRR21853544.sra Written 298581 spots for SRR21853544.sra Read 298581 spots for SRR21853544.sra Written 298581 spots for SRR21853544.sra Read 298590 spots for SRR21853544.sra Written 298590 spots for SRR21853544.sra Read 298581 spots for SRR21853544.sra Written 298581 spots for SRR21853544.sra Read 298581 spots for SRR21853544.sra Written 298581 spots for SRR21853544.sra Read 298581 spots for SRR21853544.sra Written 298581 spots for SRR21853544.sra Read 298581 spots for SRR21853544.sra Written 298581 spots for SRR21853544.sra Read 298581 spots for SRR21853544.sra Written 298581 spots for SRR21853544.sra Read 298581 spots for SRR21853544.sra Written 298581 spots for SRR21853544.sra Read 298581 spots for SRR21853544.sra Written 298581 spots for SRR21853544.sra Read 298581 spots for SRR21853544.sra Written 298581 spots for SRR21853544.sra Read 298581 spots for SRR21853544.sra Written 298581 spots for SRR21853544.sra Read 298581 spots for SRR21853544.sra Written 298581 spots for SRR21853544.sra Read 298581 spots for SRR21853544.sra Written 298581 spots for SRR21853544.sra Read 298581 spots for SRR21853544.sra Written 298581 spots for SRR21853544.sra Read 298581 spots for SRR21853544.sra Written 298581 spots for SRR21853544.sra Read 298581 spots for SRR21853544.sra Written 298581 spots for SRR21853544.sra SRR ids: ['SRR21853544.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_rb8v0z5n SRR21853544.sra spots: 5971629 blocks: [[1, 298581], [298582, 597162], [597163, 895743], [895744, 1194324], [1194325, 1492905], [1492906, 1791486], [1791487, 2090067], [2090068, 2388648], [2388649, 2687229], [2687230, 2985810], [2985811, 3284391], [3284392, 3582972], [3582973, 3881553], [3881554, 4180134], [4180135, 4478715], [4478716, 4777296], [4777297, 5075877], [5075878, 5374458], [5374459, 5673039], [5673040, 5971629]] SRR21853544 file size 1627167 SRR21853544 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR21853544 SRR21853544_1.fastq Input file: SRR21853544_1.fastq trimmed: SRR21853544-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Fri Dec 6 17:33:03 2024 >> started Fri Dec 6 17:33:06 2024 >> done (3.473s) 5971629 reads processed; of these: 45 ( 0.00%) short reads filtered out after trimming by size control 315343 ( 5.28%) empty reads filtered out after trimming by size control 5656241 (94.72%) reads available; of these: 68 ( 0.00%) trimmed reads available after processing 5656173 (100.00%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 1 0.00% 20 1 0.00% 21 1 0.00% 22 0 0.00% 23 1 0.00% 24 2 0.00% 25 1 0.00% 26 1 0.00% 27 0 0.00% 28 1 0.00% 29 1 0.00% 30 1 0.00% 31 0 0.00% 32 0 0.00% 33 1 0.00% 34 1 0.00% 35 28 0.00% 36 53 0.00% 37 42 0.00% 38 45 0.00% 39 40 0.00% 40 47 0.00% 41 41 0.00% 42 41 0.00% 43 42 0.00% 44 51 0.00% 45 47 0.00% 46 46 0.00% 47 69 0.00% 48 51 0.00% 49 61 0.00% 50 57 0.00% 51 66 0.00% 52 55 0.00% 53 88 0.00% 54 65 0.00% 55 71 0.00% 56 66 0.00% 57 53 0.00% 58 78 0.00% 59 80 0.00% 60 75 0.00% 61 85 0.00% 62 81 0.00% 63 84 0.00% 64 97 0.00% 65 89 0.00% 66 91 0.00% 67 98 0.00% 68 92 0.00% 69 98 0.00% 70 104 0.00% 71 126 0.00% 72 122 0.00% 73 116 0.00% 74 105 0.00% 75 111 0.00% 76 153 0.00% 77 137 0.00% 78 135 0.00% 79 158 0.00% 80 153 0.00% 81 187 0.00% 82 182 0.00% 83 189 0.00% 84 209 0.00% 85 224 0.00% 86 203 0.00% 87 220 0.00% 88 233 0.00% 89 282 0.00% 90 280 0.00% 91 454 0.01% 92 326 0.01% 93 369 0.01% 94 656 0.01% 95 1624 0.03% 96 7155 0.13% 97 24954 0.44% 98 96039 1.70% 99 362995 6.42% 100 1227960 21.71% 101 3927793 69.44% 5656241 reads passed initial QC criterion=sequence-density sequence-density=0.25 sequence-density-rank=1 fanout-score=2.49 fanout-score-rank=20 prefix-density=0.27 prefix-fanout=2.3 sequence=CCATGGCACCCACCGTGATGGCTTCCTCCGCCACCTCCGTGGC criterion=fanout-score sequence-density=0.08 sequence-density-rank=22 fanout-score=286.36 fanout-score-rank=1 prefix-density=1.00 prefix-fanout=24.2 sequence=CGCCGCCGCCGA Started job on | Dec 06 17:33:29 Started mapping on | Dec 06 17:33:30 Finished on | Dec 06 17:33:43 Mapping speed, Million of reads per hour | 1566.34 Number of input reads | 5656241 Average input read length | 100 UNIQUE READS: Uniquely mapped reads number | 5154105 Uniquely mapped reads % | 91.12% Average mapped length | 100.25 Number of splices: Total | 1691574 Number of splices: Annotated (sjdb) | 1603007 Number of splices: GT/AG | 1668236 Number of splices: GC/AG | 20604 Number of splices: AT/AC | 943 Number of splices: Non-canonical | 1791 Mismatch rate per base, % | 0.27% Deletion rate per base | 0.00% Deletion average length | 1.57 Insertion rate per base | 0.00% Insertion average length | 1.28 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 187233 % of reads mapped to multiple loci | 3.31% Number of reads mapped to too many loci | 185422 % of reads mapped to too many loci | 3.28% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.94% % of reads unmapped: other | 0.35% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 314903 314903 314903 N_multimapping 187233 187233 187233 N_noFeature 216247 2681433 2621825 N_ambiguous 79604 7604 5455 UnstrandedReadsAssigned:4858254 PositiveStrandReadsAssigned:2465068 NegativeStrandReadsAssigned:2526825 Dataset is classified unstranded MeadianReadLen=101 20thPercentileLength=100 echo kmer=95 SRR21853544 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR21853544-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 5,656,241 reads, 5,059,224 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,073 rounds 52973 SRR21853544.ke.tsv 35125 SRR21853544.se.tsv 88098 total ==> SRR21853544.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 0 0 PNS24247 1044 945 12.2495 4.37662 PNS24249 1928 1829 81.8107 15.1025 PNS24246 1044 945 12.2495 4.37662 PNS24248 1044 945 12.2495 4.37662 PNS24244 1471 1372 5.44089 1.33897 PNS24243 293 194 9 15.6637 KQK14069 1603 1504 1532.92 344.132 KQK14071 474 375 102.171 91.9916 ==> SRR21853544.se.tsv <== BRADI_1g14170v3 1830 BRADI_1g53295v3 50 BRADI_1g59795v3 75 BRADI_1g07683v3 0 BRADI_1g00485v3 34 BRADI_1g20270v3 494 BRADI_1g74790v3 73 BRADI_1g09890v3 3 BRADI_1g77505v3 84 BRADI_1g48960v3 0 SRR21853544 completed mapping pipeline successfully