Starting /dee2/code/volunteer_pipeline.sh SRR21853545 current disk space = 1550535417856 free memory = 1599625236 SRR21853545 SRAfilesize 7aa63630e090cab74916c2d49346c502 SRR21853545.sra SRR21853545.sra file validated SRR21853545 is single end SRR21853545 is conventional basespace SRR21853545 read1 length is 73-101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR21853545_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 73-101 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.1705 37.0 37.0 37.0 25.0 37.0 2 34.5675 37.0 37.0 37.0 25.0 37.0 3 35.692 37.0 37.0 37.0 37.0 37.0 4 35.7405 37.0 37.0 37.0 37.0 37.0 5 35.802 37.0 37.0 37.0 37.0 37.0 6 35.8295 37.0 37.0 37.0 37.0 37.0 7 35.6905 37.0 37.0 37.0 37.0 37.0 8 35.924 37.0 37.0 37.0 37.0 37.0 9 35.811 37.0 37.0 37.0 37.0 37.0 10-11 35.90425 37.0 37.0 37.0 37.0 37.0 12-13 35.90325 37.0 37.0 37.0 37.0 37.0 14-15 35.852999999999994 37.0 37.0 37.0 37.0 37.0 16-17 35.894999999999996 37.0 37.0 37.0 37.0 37.0 18-19 35.9095 37.0 37.0 37.0 37.0 37.0 20-21 35.93175 37.0 37.0 37.0 37.0 37.0 22-23 35.75375 37.0 37.0 37.0 37.0 37.0 24-25 35.84025 37.0 37.0 37.0 37.0 37.0 26-27 35.810249999999996 37.0 37.0 37.0 37.0 37.0 28-29 35.745 37.0 37.0 37.0 37.0 37.0 30-31 35.712500000000006 37.0 37.0 37.0 37.0 37.0 32-33 35.5995 37.0 37.0 37.0 37.0 37.0 34-35 35.671 37.0 37.0 37.0 37.0 37.0 36-37 35.682249999999996 37.0 37.0 37.0 37.0 37.0 38-39 35.716750000000005 37.0 37.0 37.0 37.0 37.0 40-41 35.68375 37.0 37.0 37.0 37.0 37.0 42-43 35.67275 37.0 37.0 37.0 37.0 37.0 44-45 35.63875 37.0 37.0 37.0 37.0 37.0 46-47 35.6385 37.0 37.0 37.0 37.0 37.0 48-49 35.50725 37.0 37.0 37.0 37.0 37.0 50-51 35.591499999999996 37.0 37.0 37.0 37.0 37.0 52-53 35.454499999999996 37.0 37.0 37.0 37.0 37.0 54-55 35.4955 37.0 37.0 37.0 37.0 37.0 56-57 35.463750000000005 37.0 37.0 37.0 37.0 37.0 58-59 35.467 37.0 37.0 37.0 37.0 37.0 60-61 35.49925 37.0 37.0 37.0 37.0 37.0 62-63 35.3495 37.0 37.0 37.0 37.0 37.0 64-65 35.432500000000005 37.0 37.0 37.0 37.0 37.0 66-67 35.4525 37.0 37.0 37.0 37.0 37.0 68-69 35.380250000000004 37.0 37.0 37.0 37.0 37.0 70-71 35.27175 37.0 37.0 37.0 31.0 37.0 72-73 35.414500000000004 37.0 37.0 37.0 37.0 37.0 74-75 35.52788197049262 37.0 37.0 37.0 37.0 37.0 76-77 35.39034758689672 37.0 37.0 37.0 37.0 37.0 78-79 35.4463615903976 37.0 37.0 37.0 37.0 37.0 80-81 35.50850425212606 37.0 37.0 37.0 37.0 37.0 82-83 35.480798505332224 37.0 37.0 37.0 37.0 37.0 84-85 35.34926194645985 37.0 37.0 37.0 37.0 37.0 86-87 35.389041781336005 37.0 37.0 37.0 37.0 37.0 88-89 35.491868901676256 37.0 37.0 37.0 37.0 37.0 90-91 35.34976232174131 37.0 37.0 37.0 37.0 37.0 92-93 35.3922942206655 37.0 37.0 37.0 37.0 37.0 94-95 35.440330247685765 37.0 37.0 37.0 37.0 37.0 96-97 35.304812923663704 37.0 37.0 37.0 37.0 37.0 98-99 35.38354834785038 37.0 37.0 37.0 37.0 37.0 100-101 35.288639191403846 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100-101 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 23 1.0 24 3.0 25 7.0 26 9.0 27 30.0 28 42.0 29 60.0 30 71.0 31 103.0 32 120.0 33 178.0 34 262.0 35 480.0 36 2126.0 37 508.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 31.1 12.275 17.375 39.25 2 25.433673469387756 19.897959183673468 28.8265306122449 25.841836734693878 3 26.974999999999998 22.75 23.7 26.575 4 26.924999999999997 29.849999999999998 18.4 24.825 5 28.1 30.025000000000002 20.225 21.65 6 21.65 32.525 21.55 24.275 7 20.1 15.35 39.324999999999996 25.224999999999998 8 23.425 20.7 24.099999999999998 31.775 9 22.425 19.7 28.225 29.65 10-11 25.900000000000002 28.449999999999996 19.375 26.275 12-13 24.1375 22.0125 26.087500000000002 27.762500000000003 14-15 24.0375 24.2375 24.6625 27.0625 16-17 25.15 24.3875 23.25 27.212500000000002 18-19 24.1875 24.775 23.674999999999997 27.3625 20-21 25.074999999999996 25.05 23.775 26.1 22-23 25.0125 25.337500000000002 23.775 25.874999999999996 24-25 25.3125 24.275 23.674999999999997 26.737499999999997 26-27 25.124999999999996 24.2375 24.3625 26.275 28-29 24.275 24.4 24.7 26.625 30-31 24.1625 25.137500000000003 24.3875 26.3125 32-33 24.4125 24.725 23.799999999999997 27.0625 34-35 24.7 24.837500000000002 23.6625 26.8 36-37 25.2875 24.775 23.2625 26.674999999999997 38-39 25.374999999999996 23.962500000000002 24.4375 26.224999999999998 40-41 26.05 23.9375 23.8625 26.150000000000002 42-43 24.6625 25.0375 23.95 26.35 44-45 26.174999999999997 24.0 23.825 26.0 46-47 24.9 24.45 23.875 26.775 48-49 24.2375 24.1125 25.174999999999997 26.474999999999998 50-51 25.387500000000003 25.0 23.275000000000002 26.337500000000002 52-53 26.0 23.95 23.825 26.224999999999998 54-55 25.4875 23.7125 23.95 26.85 56-57 24.5125 25.0375 23.1125 27.3375 58-59 25.75 24.4875 24.65 25.112499999999997 60-61 25.912499999999998 24.3875 23.7875 25.912499999999998 62-63 26.525 24.025 23.575 25.874999999999996 64-65 26.775 23.3125 24.175 25.7375 66-67 24.8 24.6125 23.799999999999997 26.787499999999998 68-69 24.9375 24.95 24.825 25.2875 70-71 25.5125 24.5125 23.962500000000002 26.0125 72-73 26.187500000000004 24.337500000000002 23.325000000000003 26.150000000000002 74-75 26.994248562140534 24.081020255063766 23.305826456614152 25.618904726181547 76-77 26.894223555888974 24.256064016004 24.031007751937985 24.81870467616904 78-79 25.993998499624904 23.78094523630908 24.18104526131533 26.04401100275069 80-81 26.813406703351678 24.662331165582792 22.59879939969985 25.925462731365684 82-83 25.77861163227017 24.552845528455283 23.22701688555347 26.441525953721072 84-85 25.21891418563923 23.892919689767325 23.980485364023014 26.90768076057043 86-87 25.569176882662 23.492619464598448 23.967975981986488 26.970227670753065 88-89 26.54490868151113 23.517638228671505 24.130597948461347 25.806855141356017 90-91 27.257943457593193 23.942957217913435 23.90542907180385 24.893670252689517 92-93 25.969477107830873 24.10557918438829 23.54265699274456 26.38228671503628 94-95 25.55666750062547 24.48086064548411 23.842882161621215 26.1195896922692 96-97 25.941684394944314 23.551495432361406 23.96446001751971 26.54236015517457 98-99 26.043384498287452 23.163770138272234 25.459850310795385 25.33299505264493 100-101 27.587822014051522 11.02263856362217 29.679937548790008 31.709601873536297 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1.0 1 0.5 2 1.0 3 1.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.5 24 1.0 25 0.5 26 1.0 27 1.5 28 1.5 29 2.5 30 4.5 31 11.5 32 16.0 33 18.0 34 20.5 35 33.5 36 52.0 37 60.5 38 65.0 39 87.5 40 104.5 41 107.5 42 121.5 43 148.0 44 168.0 45 163.0 46 165.5 47 172.0 48 161.5 49 154.5 50 149.0 51 147.0 52 132.0 53 115.0 54 118.0 55 96.5 56 90.5 57 95.0 58 92.0 59 86.5 60 80.0 61 77.0 62 70.0 63 75.5 64 75.5 65 64.5 66 59.0 67 60.5 68 58.5 69 65.5 70 66.0 71 59.5 72 46.5 73 39.0 74 38.5 75 26.5 76 17.5 77 16.5 78 17.0 79 8.5 80 3.5 81 4.5 82 4.0 83 1.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 2.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 73 1.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 1.0 80 0.0 81 0.0 82 1.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 3.0 97 24.0 98 57.0 99 251.0 100 919.0 101 2743.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.475 #Duplication Level Percentage of deduplicated Percentage of total 1 91.50040994807324 83.7 2 7.816343263186663 14.299999999999999 3 0.573927302541678 1.575 4 0.08198961464881116 0.3 5 0.027329871549603715 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACTCCGGAGAATCGCGGTT 5 0.125 TruSeq Adapter, Index 6 (97% over 36bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1485308 spots for SRR21853545.sra Written 1485308 spots for SRR21853545.sra Read 1485308 spots for SRR21853545.sra Written 1485308 spots for SRR21853545.sra Read 1485308 spots for SRR21853545.sra Written 1485308 spots for SRR21853545.sra Read 1485308 spots for SRR21853545.sra Written 1485308 spots for SRR21853545.sra Read 1485308 spots for SRR21853545.sra Written 1485308 spots for SRR21853545.sra Read 1485308 spots for SRR21853545.sra Written 1485308 spots for SRR21853545.sra Read 1485308 spots for SRR21853545.sra Written 1485308 spots for SRR21853545.sra Read 1485308 spots for SRR21853545.sra Written 1485308 spots for SRR21853545.sra Read 1485308 spots for SRR21853545.sra Written 1485308 spots for SRR21853545.sra Read 1485308 spots for SRR21853545.sra Written 1485308 spots for SRR21853545.sra Read 1485308 spots for SRR21853545.sra Written 1485308 spots for SRR21853545.sra Read 1485308 spots for SRR21853545.sra Written 1485308 spots for SRR21853545.sra Read 1485317 spots for SRR21853545.sra Written 1485317 spots for SRR21853545.sra Read 1485308 spots for SRR21853545.sra Written 1485308 spots for SRR21853545.sra Read 1485308 spots for SRR21853545.sra Written 1485308 spots for SRR21853545.sra Read 1485308 spots for SRR21853545.sra Written 1485308 spots for SRR21853545.sra Read 1485308 spots for SRR21853545.sra Written 1485308 spots for SRR21853545.sra Read 1485308 spots for SRR21853545.sra Written 1485308 spots for SRR21853545.sra Read 1485308 spots for SRR21853545.sra Written 1485308 spots for SRR21853545.sra Read 1485308 spots for SRR21853545.sra Written 1485308 spots for SRR21853545.sra SRR ids: ['SRR21853545.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_605_p4mj SRR21853545.sra spots: 29706169 blocks: [[1, 1485308], [1485309, 2970616], [2970617, 4455924], [4455925, 5941232], [5941233, 7426540], [7426541, 8911848], [8911849, 10397156], [10397157, 11882464], [11882465, 13367772], [13367773, 14853080], [14853081, 16338388], [16338389, 17823696], [17823697, 19309004], [19309005, 20794312], [20794313, 22279620], [22279621, 23764928], [23764929, 25250236], [25250237, 26735544], [26735545, 28220852], [28220853, 29706169]] SRR21853545 file size 8009123 SRR21853545 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR21853545 SRR21853545_1.fastq Input file: SRR21853545_1.fastq trimmed: SRR21853545-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Fri Dec 6 17:34:39 2024 >> started Fri Dec 6 17:35:01 2024 >> done (22.525s) 29706169 reads processed; of these: 27 ( 0.00%) short reads filtered out after trimming by size control 235834 ( 0.79%) empty reads filtered out after trimming by size control 29470308 (99.21%) reads available; of these: 595 ( 0.00%) trimmed reads available after processing 29469713 (100.00%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 4 0.00% 20 1 0.00% 21 1 0.00% 22 4 0.00% 23 4 0.00% 24 4 0.00% 25 5 0.00% 26 9 0.00% 27 4 0.00% 28 5 0.00% 29 5 0.00% 30 6 0.00% 31 3 0.00% 32 11 0.00% 33 9 0.00% 34 3 0.00% 35 116 0.00% 36 94 0.00% 37 106 0.00% 38 135 0.00% 39 111 0.00% 40 130 0.00% 41 112 0.00% 42 121 0.00% 43 127 0.00% 44 134 0.00% 45 129 0.00% 46 147 0.00% 47 129 0.00% 48 141 0.00% 49 168 0.00% 50 156 0.00% 51 155 0.00% 52 161 0.00% 53 194 0.00% 54 149 0.00% 55 176 0.00% 56 179 0.00% 57 223 0.00% 58 181 0.00% 59 229 0.00% 60 216 0.00% 61 266 0.00% 62 244 0.00% 63 226 0.00% 64 274 0.00% 65 271 0.00% 66 241 0.00% 67 258 0.00% 68 261 0.00% 69 247 0.00% 70 296 0.00% 71 306 0.00% 72 342 0.00% 73 300 0.00% 74 314 0.00% 75 328 0.00% 76 349 0.00% 77 362 0.00% 78 380 0.00% 79 438 0.00% 80 462 0.00% 81 485 0.00% 82 474 0.00% 83 495 0.00% 84 568 0.00% 85 582 0.00% 86 595 0.00% 87 658 0.00% 88 690 0.00% 89 731 0.00% 90 926 0.00% 91 1954 0.01% 92 1008 0.00% 93 1279 0.00% 94 2207 0.01% 95 7481 0.03% 96 40102 0.14% 97 135152 0.46% 98 529100 1.80% 99 1978969 6.72% 100 6630279 22.50% 101 20126410 68.29% 29470308 reads passed initial QC criterion=sequence-density sequence-density=0.24 sequence-density-rank=1 fanout-score=2.80 fanout-score-rank=17 prefix-density=0.35 prefix-fanout=1.9 sequence=CCTTTCCAGGGCCTCAAGTCCACCGCCGGCCTCCCC criterion=fanout-score sequence-density=0.09 sequence-density-rank=24 fanout-score=209.75 fanout-score-rank=1 prefix-density=0.79 prefix-fanout=23.5 sequence=CGCCGCCGCCGC Started job on | Dec 06 17:35:19 Started mapping on | Dec 06 17:35:19 Finished on | Dec 06 17:36:00 Mapping speed, Million of reads per hour | 2587.64 Number of input reads | 29470308 Average input read length | 100 UNIQUE READS: Uniquely mapped reads number | 26923177 Uniquely mapped reads % | 91.36% Average mapped length | 100.22 Number of splices: Total | 9411887 Number of splices: Annotated (sjdb) | 8925315 Number of splices: GT/AG | 9279836 Number of splices: GC/AG | 112090 Number of splices: AT/AC | 4785 Number of splices: Non-canonical | 15176 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.01% Deletion average length | 2.23 Insertion rate per base | 0.01% Insertion average length | 1.97 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1114609 % of reads mapped to multiple loci | 3.78% Number of reads mapped to too many loci | 926367 % of reads mapped to too many loci | 3.14% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.27% % of reads unmapped: other | 0.45% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1432522 1432522 1432522 N_multimapping 1114609 1114609 1114609 N_noFeature 1128183 13827623 13853906 N_ambiguous 424604 29077 28572 UnstrandedReadsAssigned:25370390 PositiveStrandReadsAssigned:13066477 NegativeStrandReadsAssigned:13040699 Dataset is classified unstranded MeadianReadLen=101 20thPercentileLength=100 echo kmer=95 SRR21853545 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR21853545-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 29,470,308 reads, 26,287,865 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,120 rounds 52973 SRR21853545.ke.tsv 35125 SRR21853545.se.tsv 88098 total ==> SRR21853545.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 46.384 3.5168 PNS24247 1044 945 73.2612 4.9198 PNS24249 1928 1829 293.497 10.1834 PNS24246 1044 945 73.2612 4.9198 PNS24248 1044 945 73.2612 4.9198 PNS24244 1471 1372 63.3355 2.92953 PNS24243 293 194 8 2.61693 KQK14069 1603 1504 6207.47 261.922 KQK14071 474 375 1242.79 210.316 ==> SRR21853545.se.tsv <== BRADI_1g14170v3 8121 BRADI_1g53295v3 195 BRADI_1g59795v3 407 BRADI_1g07683v3 0 BRADI_1g00485v3 126 BRADI_1g20270v3 2688 BRADI_1g74790v3 257 BRADI_1g09890v3 12 BRADI_1g77505v3 418 BRADI_1g48960v3 1 SRR21853545 completed mapping pipeline successfully