Starting /dee2/code/volunteer_pipeline.sh SRR21853546 current disk space = 1550584909824 free memory = 1600100636 SRR21853546 SRAfilesize 39604e35510a6846dce8d82ec18ee97f SRR21853546.sra SRR21853546.sra file validated SRR21853546 is single end SRR21853546 is conventional basespace SRR21853546 read1 length is 37-101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR21853546_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 37-101 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.07 37.0 37.0 37.0 25.0 37.0 2 35.09825 37.0 37.0 37.0 37.0 37.0 3 35.6185 37.0 37.0 37.0 37.0 37.0 4 35.7495 37.0 37.0 37.0 37.0 37.0 5 35.89 37.0 37.0 37.0 37.0 37.0 6 35.827 37.0 37.0 37.0 37.0 37.0 7 35.5645 37.0 37.0 37.0 37.0 37.0 8 35.772 37.0 37.0 37.0 37.0 37.0 9 35.8965 37.0 37.0 37.0 37.0 37.0 10-11 35.838499999999996 37.0 37.0 37.0 37.0 37.0 12-13 35.79925 37.0 37.0 37.0 37.0 37.0 14-15 35.846000000000004 37.0 37.0 37.0 37.0 37.0 16-17 35.78 37.0 37.0 37.0 37.0 37.0 18-19 35.85875 37.0 37.0 37.0 37.0 37.0 20-21 35.869749999999996 37.0 37.0 37.0 37.0 37.0 22-23 35.858999999999995 37.0 37.0 37.0 37.0 37.0 24-25 35.7145 37.0 37.0 37.0 37.0 37.0 26-27 35.7705 37.0 37.0 37.0 37.0 37.0 28-29 35.615750000000006 37.0 37.0 37.0 37.0 37.0 30-31 35.606 37.0 37.0 37.0 37.0 37.0 32-33 35.56875 37.0 37.0 37.0 37.0 37.0 34-35 35.623 37.0 37.0 37.0 37.0 37.0 36-37 35.5815 37.0 37.0 37.0 37.0 37.0 38-39 35.70367591897974 37.0 37.0 37.0 37.0 37.0 40-41 35.55313828457115 37.0 37.0 37.0 37.0 37.0 42-43 35.58664666166541 37.0 37.0 37.0 37.0 37.0 44-45 35.586690017513135 37.0 37.0 37.0 37.0 37.0 46-47 35.51788841631223 37.0 37.0 37.0 37.0 37.0 48-49 35.53340005003753 37.0 37.0 37.0 37.0 37.0 50-51 35.526895171378534 37.0 37.0 37.0 37.0 37.0 52-53 35.461095821866394 37.0 37.0 37.0 37.0 37.0 54-55 35.472604453340004 37.0 37.0 37.0 37.0 37.0 56-57 35.476357267950966 37.0 37.0 37.0 37.0 37.0 58-59 35.46710032524393 37.0 37.0 37.0 37.0 37.0 60-61 35.44408306229672 37.0 37.0 37.0 37.0 37.0 62-63 35.339754816112084 37.0 37.0 37.0 37.0 37.0 64-65 35.36602451838879 37.0 37.0 37.0 37.0 37.0 66-67 35.267200400300226 37.0 37.0 37.0 37.0 37.0 68-69 35.43157368026019 37.0 37.0 37.0 37.0 37.0 70-71 35.37678258694021 37.0 37.0 37.0 37.0 37.0 72-73 35.385789342006504 37.0 37.0 37.0 37.0 37.0 74-75 35.32199149362022 37.0 37.0 37.0 31.0 37.0 76-77 35.26920190142607 37.0 37.0 37.0 31.0 37.0 78-79 35.335251438578936 37.0 37.0 37.0 31.0 37.0 80-81 35.334500875656744 37.0 37.0 37.0 37.0 37.0 82-83 35.28946710032524 37.0 37.0 37.0 37.0 37.0 84-85 35.322903629536924 37.0 37.0 37.0 37.0 37.0 86-87 35.24380475594493 37.0 37.0 37.0 25.0 37.0 88-89 35.309887359198996 37.0 37.0 37.0 31.0 37.0 90-91 35.31464330413016 37.0 37.0 37.0 37.0 37.0 92-93 35.27334167709637 37.0 37.0 37.0 31.0 37.0 94-95 35.21001251564456 37.0 37.0 37.0 25.0 37.0 96-97 35.08542601811161 37.0 37.0 37.0 25.0 37.0 98-99 35.19151717909905 37.0 37.0 37.0 25.0 37.0 100-101 35.21490459025233 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100-101 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 1.0 22 1.0 23 1.0 24 5.0 25 7.0 26 9.0 27 16.0 28 40.0 29 53.0 30 87.0 31 115.0 32 155.0 33 175.0 34 286.0 35 533.0 36 2059.0 37 457.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 23.3 13.900000000000002 12.425 50.375 2 22.8794361943116 20.312106720362447 36.974578404228545 19.83387868109741 3 22.45 24.474999999999998 24.075 28.999999999999996 4 24.575 30.525000000000002 19.825 25.074999999999996 5 28.225 31.900000000000002 20.375 19.5 6 20.625 33.050000000000004 21.6 24.725 7 20.175 15.825 39.2 24.8 8 21.075 20.849999999999998 26.724999999999998 31.35 9 21.8 19.525000000000002 29.125 29.549999999999997 10-11 25.2 28.000000000000004 19.55 27.250000000000004 12-13 23.425 22.3375 26.987499999999997 27.250000000000004 14-15 23.4625 24.325 25.275 26.937499999999996 16-17 24.712500000000002 24.7375 23.325000000000003 27.224999999999998 18-19 24.212500000000002 23.7 24.9 27.187499999999996 20-21 24.525 24.712500000000002 24.224999999999998 26.5375 22-23 25.5125 24.95 23.45 26.087500000000002 24-25 24.4875 25.174999999999997 23.7375 26.6 26-27 25.6 25.087500000000002 23.875 25.4375 28-29 24.875 25.1875 24.1125 25.825 30-31 24.675 24.3875 24.6875 26.25 32-33 25.1875 23.325000000000003 23.849999999999998 27.6375 34-35 25.05 24.0625 24.0625 26.825 36-37 25.387500000000003 24.5125 23.325000000000003 26.775 38-39 25.243810952738183 24.718679669917478 22.99324831207802 27.04426106526632 40-41 25.318829707426854 24.60615153788447 24.18104526131533 25.893973493373345 42-43 25.006251562890725 24.381095273818453 23.705926481620406 26.906726681670417 44-45 25.081310983237426 25.068801601200903 23.817863397548162 26.032024018013512 46-47 24.818613960470355 25.94445834375782 22.742056542406804 26.494871153365025 48-49 25.344008006004504 24.59344508381286 23.39254440830623 26.670002501876404 50-51 26.432324243182386 23.71778834125594 23.83037277958469 26.019514635976982 52-53 24.39329497122842 24.655991993995496 24.34325744308231 26.607455591693768 54-55 25.881911433575183 24.843632724543408 23.229922441831373 26.044533400050035 56-57 25.469101826369776 25.594195646735052 23.129847385539154 25.806855141356017 58-59 25.156367275456592 24.043032274205654 23.39254440830623 27.408056042031525 60-61 25.006254691018263 23.805354015511636 24.055541656242184 27.132849637227917 62-63 25.50662997247936 23.91793845384038 24.243182386790092 26.332249186890166 64-65 25.056292219164373 24.130597948461347 24.218163622717036 26.594946209657245 66-67 25.73179884913685 24.168126094570926 23.855391543657746 26.244683512634477 68-69 24.943707780835627 25.106329747310486 23.91793845384038 26.032024018013512 70-71 26.069552164123095 23.505128846634975 23.592694520890667 26.832624468351263 72-73 25.581686264698522 23.15486614961221 24.043032274205654 27.220415311483613 74-75 25.869402051538653 23.817863397548162 24.330748061045785 25.9819864898674 76-77 26.294721040780583 22.266700025018764 25.381536152114087 26.057042782086565 78-79 24.893670252689517 23.1048286214661 24.130597948461347 27.87090317738304 80-81 25.806855141356017 24.83112334250688 24.0180135101326 25.344008006004504 82-83 25.956967725794343 24.06805103827871 22.641981486114584 27.33299974981236 84-85 26.595744680851062 24.58072590738423 23.27909887359199 25.544430538172712 86-87 26.37046307884856 24.380475594493117 23.341677096370464 25.90738423028786 88-89 24.705882352941178 24.46808510638298 23.617021276595747 27.2090112640801 90-91 25.90738423028786 23.642052565707132 24.30538172715895 26.14518147684606 92-93 25.60700876095119 24.20525657071339 24.730913642052567 25.456821026282856 94-95 25.56946182728411 24.380475594493117 23.704630788485606 26.345431789737173 96-97 25.547902316844084 24.458359423919852 23.393863494051345 26.599874765184722 98-99 25.26302446444416 23.310939282545316 24.920775763721636 26.505260489288883 100-101 26.411258795934323 9.83580922595778 29.413604378420644 34.33932759968726 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.5 25 0.5 26 0.5 27 2.0 28 3.5 29 5.5 30 6.5 31 7.0 32 12.0 33 19.0 34 27.0 35 30.5 36 32.5 37 48.0 38 70.5 39 99.5 40 118.0 41 132.0 42 145.0 43 156.5 44 175.0 45 182.0 46 180.0 47 167.5 48 152.0 49 152.5 50 141.0 51 123.5 52 125.0 53 113.0 54 103.5 55 91.5 56 73.0 57 77.0 58 82.5 59 82.5 60 83.0 61 80.0 62 82.0 63 86.5 64 77.0 65 70.0 66 73.0 67 67.0 68 59.5 69 62.0 70 57.5 71 47.5 72 44.5 73 39.0 74 32.5 75 26.5 76 24.5 77 23.0 78 13.5 79 5.5 80 5.5 81 4.0 82 2.0 83 2.0 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.675 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 36-37 1.0 38-39 0.0 40-41 0.0 42-43 2.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 2.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 20.0 98-99 320.0 100-101 3655.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.95 #Duplication Level Percentage of deduplicated Percentage of total 1 93.95955295369878 88.275 2 5.7211282597126125 10.75 3 0.2394890899414582 0.675 4 0.07982969664715274 0.3 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 612822 spots for SRR21853546.sra Written 612822 spots for SRR21853546.sra Read 612822 spots for SRR21853546.sra Written 612822 spots for SRR21853546.sra Read 612822 spots for SRR21853546.sra Written 612822 spots for SRR21853546.sra Read 612822 spots for SRR21853546.sra Written 612822 spots for SRR21853546.sra Read 612822 spots for SRR21853546.sra Written 612822 spots for SRR21853546.sra Read 612822 spots for SRR21853546.sra Written 612822 spots for SRR21853546.sra Read 612822 spots for SRR21853546.sra Written 612822 spots for SRR21853546.sra Read 612822 spots for SRR21853546.sra Written 612822 spots for SRR21853546.sra Read 612822 spots for SRR21853546.sra Written 612822 spots for SRR21853546.sra Read 612822 spots for SRR21853546.sra Written 612822 spots for SRR21853546.sra Read 612822 spots for SRR21853546.sra Written 612822 spots for SRR21853546.sra Read 612822 spots for SRR21853546.sra Written 612822 spots for SRR21853546.sra Read 612822 spots for SRR21853546.sra Written 612822 spots for SRR21853546.sra Read 612822 spots for SRR21853546.sra Written 612822 spots for SRR21853546.sra Read 612822 spots for SRR21853546.sra Written 612822 spots for SRR21853546.sra Read 612839 spots for SRR21853546.sra Written 612839 spots for SRR21853546.sra Read 612822 spots for SRR21853546.sra Written 612822 spots for SRR21853546.sra Read 612822 spots for SRR21853546.sra Written 612822 spots for SRR21853546.sra Read 612822 spots for SRR21853546.sra Written 612822 spots for SRR21853546.sra Read 612822 spots for SRR21853546.sra Written 612822 spots for SRR21853546.sra SRR ids: ['SRR21853546.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_g34rybu2 SRR21853546.sra spots: 12256457 blocks: [[1, 612822], [612823, 1225644], [1225645, 1838466], [1838467, 2451288], [2451289, 3064110], [3064111, 3676932], [3676933, 4289754], [4289755, 4902576], [4902577, 5515398], [5515399, 6128220], [6128221, 6741042], [6741043, 7353864], [7353865, 7966686], [7966687, 8579508], [8579509, 9192330], [9192331, 9805152], [9805153, 10417974], [10417975, 11030796], [11030797, 11643618], [11643619, 12256457]] SRR21853546 file size 3297899 SRR21853546 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR21853546 SRR21853546_1.fastq Input file: SRR21853546_1.fastq trimmed: SRR21853546-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Fri Dec 6 17:34:51 2024 >> started Fri Dec 6 17:35:06 2024 >> done (15.624s) 12256457 reads processed; of these: 14 ( 0.00%) short reads filtered out after trimming by size control 20735 ( 0.17%) empty reads filtered out after trimming by size control 12235708 (99.83%) reads available; of these: 375 ( 0.00%) trimmed reads available after processing 12235333 (100.00%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 3 0.00% 20 4 0.00% 21 2 0.00% 22 2 0.00% 23 2 0.00% 24 2 0.00% 25 3 0.00% 26 8 0.00% 27 7 0.00% 28 4 0.00% 29 5 0.00% 30 4 0.00% 31 5 0.00% 32 5 0.00% 33 7 0.00% 34 2 0.00% 35 67 0.00% 36 76 0.00% 37 64 0.00% 38 62 0.00% 39 68 0.00% 40 79 0.00% 41 78 0.00% 42 89 0.00% 43 102 0.00% 44 99 0.00% 45 78 0.00% 46 98 0.00% 47 76 0.00% 48 69 0.00% 49 89 0.00% 50 95 0.00% 51 95 0.00% 52 94 0.00% 53 94 0.00% 54 123 0.00% 55 101 0.00% 56 96 0.00% 57 113 0.00% 58 94 0.00% 59 121 0.00% 60 126 0.00% 61 113 0.00% 62 110 0.00% 63 106 0.00% 64 146 0.00% 65 131 0.00% 66 129 0.00% 67 149 0.00% 68 140 0.00% 69 122 0.00% 70 129 0.00% 71 149 0.00% 72 132 0.00% 73 146 0.00% 74 158 0.00% 75 149 0.00% 76 172 0.00% 77 176 0.00% 78 177 0.00% 79 226 0.00% 80 182 0.00% 81 200 0.00% 82 183 0.00% 83 221 0.00% 84 239 0.00% 85 244 0.00% 86 228 0.00% 87 254 0.00% 88 245 0.00% 89 301 0.00% 90 337 0.00% 91 667 0.01% 92 278 0.00% 93 361 0.00% 94 847 0.01% 95 3058 0.02% 96 16353 0.13% 97 56168 0.46% 98 219381 1.79% 99 810253 6.62% 100 2747368 22.45% 101 8373167 68.43% 12235708 reads passed initial QC criterion=sequence-density sequence-density=0.29 sequence-density-rank=1 fanout-score=2.32 fanout-score-rank=24 prefix-density=0.34 prefix-fanout=1.9 sequence=GCTCCTTTCCAGGG criterion=fanout-score sequence-density=0.08 sequence-density-rank=22 fanout-score=256.78 fanout-score-rank=1 prefix-density=0.91 prefix-fanout=23.4 sequence=CGCCGCCGCCGA Started job on | Dec 06 17:35:26 Started mapping on | Dec 06 17:35:26 Finished on | Dec 06 17:35:44 Mapping speed, Million of reads per hour | 2447.14 Number of input reads | 12235708 Average input read length | 100 UNIQUE READS: Uniquely mapped reads number | 11640980 Uniquely mapped reads % | 95.14% Average mapped length | 100.31 Number of splices: Total | 4043117 Number of splices: Annotated (sjdb) | 3831555 Number of splices: GT/AG | 3988999 Number of splices: GC/AG | 47751 Number of splices: AT/AC | 2244 Number of splices: Non-canonical | 4123 Mismatch rate per base, % | 0.29% Deletion rate per base | 0.00% Deletion average length | 1.72 Insertion rate per base | 0.00% Insertion average length | 1.30 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 285168 % of reads mapped to multiple loci | 2.33% Number of reads mapped to too many loci | 183872 % of reads mapped to too many loci | 1.50% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.77% % of reads unmapped: other | 0.25% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 309560 309560 309560 N_multimapping 285168 285168 285168 N_noFeature 459693 6012566 5932860 N_ambiguous 178231 13108 11172 UnstrandedReadsAssigned:11003056 PositiveStrandReadsAssigned:5615306 NegativeStrandReadsAssigned:5696948 Dataset is classified unstranded MeadianReadLen=101 20thPercentileLength=100 echo kmer=95 SRR21853546 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR21853546-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 12,235,708 reads, 11,310,278 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,233 rounds 52973 SRR21853546.ke.tsv 35125 SRR21853546.se.tsv 88098 total ==> SRR21853546.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 36.7354 6.74594 PNS24247 1044 945 17.907 2.91256 PNS24249 1928 1829 120.891 10.1593 PNS24246 1044 945 17.907 2.91256 PNS24248 1044 945 17.907 2.91256 PNS24244 1471 1372 36.6522 4.1061 PNS24243 293 194 14 11.092 KQK14069 1603 1504 1783.94 182.312 KQK14071 474 375 134.164 54.9908 ==> SRR21853546.se.tsv <== BRADI_1g14170v3 2054 BRADI_1g53295v3 85 BRADI_1g59795v3 130 BRADI_1g07683v3 0 BRADI_1g00485v3 51 BRADI_1g20270v3 1215 BRADI_1g74790v3 113 BRADI_1g09890v3 1 BRADI_1g77505v3 132 BRADI_1g48960v3 0 SRR21853546 completed mapping pipeline successfully