Starting /dee2/code/volunteer_pipeline.sh SRR21853547 current disk space = 1550570577920 free memory = 1599084360 SRR21853547 SRAfilesize ab5b9f72f362b093e60cb78f37e82104 SRR21853547.sra SRR21853547.sra file validated SRR21853547 is single end SRR21853547 is conventional basespace SRR21853547 read1 length is 39-101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR21853547_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 39-101 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 34.95175 37.0 37.0 37.0 25.0 37.0 2 35.7625 37.0 37.0 37.0 37.0 37.0 3 36.06175 37.0 37.0 37.0 37.0 37.0 4 35.989 37.0 37.0 37.0 37.0 37.0 5 36.163 37.0 37.0 37.0 37.0 37.0 6 35.9745 37.0 37.0 37.0 37.0 37.0 7 35.9205 37.0 37.0 37.0 37.0 37.0 8 35.9745 37.0 37.0 37.0 37.0 37.0 9 36.0145 37.0 37.0 37.0 37.0 37.0 10-11 36.11475 37.0 37.0 37.0 37.0 37.0 12-13 35.984750000000005 37.0 37.0 37.0 37.0 37.0 14-15 36.1005 37.0 37.0 37.0 37.0 37.0 16-17 36.01875 37.0 37.0 37.0 37.0 37.0 18-19 35.948750000000004 37.0 37.0 37.0 37.0 37.0 20-21 35.99325 37.0 37.0 37.0 37.0 37.0 22-23 35.9655 37.0 37.0 37.0 37.0 37.0 24-25 35.965 37.0 37.0 37.0 37.0 37.0 26-27 35.8175 37.0 37.0 37.0 37.0 37.0 28-29 35.8495 37.0 37.0 37.0 37.0 37.0 30-31 35.812749999999994 37.0 37.0 37.0 37.0 37.0 32-33 35.82 37.0 37.0 37.0 37.0 37.0 34-35 35.80525 37.0 37.0 37.0 37.0 37.0 36-37 35.701 37.0 37.0 37.0 37.0 37.0 38-39 35.77675 37.0 37.0 37.0 37.0 37.0 40-41 35.73393348337084 37.0 37.0 37.0 37.0 37.0 42-43 35.75493873468367 37.0 37.0 37.0 37.0 37.0 44-45 35.60440110027507 37.0 37.0 37.0 37.0 37.0 46-47 35.58239559889972 37.0 37.0 37.0 37.0 37.0 48-49 35.56914228557139 37.0 37.0 37.0 37.0 37.0 50-51 35.549637409352336 37.0 37.0 37.0 37.0 37.0 52-53 35.484871217804454 37.0 37.0 37.0 37.0 37.0 54-55 35.58989747436859 37.0 37.0 37.0 37.0 37.0 56-57 35.45986496624156 37.0 37.0 37.0 37.0 37.0 58-59 35.57939484871218 37.0 37.0 37.0 37.0 37.0 60-61 35.42310577644411 37.0 37.0 37.0 37.0 37.0 62-63 35.44961240310077 37.0 37.0 37.0 37.0 37.0 64-65 35.45561390347587 37.0 37.0 37.0 37.0 37.0 66-67 35.49287321830458 37.0 37.0 37.0 37.0 37.0 68-69 35.523630907726925 37.0 37.0 37.0 37.0 37.0 70-71 35.42960740185046 37.0 37.0 37.0 37.0 37.0 72-73 35.307326831707925 37.0 37.0 37.0 31.0 37.0 74-75 35.418104526131536 37.0 37.0 37.0 37.0 37.0 76-77 35.2205551387847 37.0 37.0 37.0 25.0 37.0 78-79 35.289572393098275 37.0 37.0 37.0 25.0 37.0 80-81 35.29907476869217 37.0 37.0 37.0 25.0 37.0 82-83 35.19429857464366 37.0 37.0 37.0 25.0 37.0 84-85 35.28907226806702 37.0 37.0 37.0 25.0 37.0 86-87 35.18679669917479 37.0 37.0 37.0 25.0 37.0 88-89 35.19054763690923 37.0 37.0 37.0 25.0 37.0 90-91 34.94248562140535 37.0 37.0 37.0 25.0 37.0 92-93 34.934229749350536 37.0 37.0 37.0 25.0 37.0 94-95 35.116351214862604 37.0 37.0 37.0 25.0 37.0 96-97 35.00322783279894 37.0 37.0 37.0 25.0 37.0 98-99 34.84507884310689 37.0 37.0 37.0 25.0 37.0 100-101 34.738940313745 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 2101 1 0.0 2101 2 0.0 2101 3 0.0 2101 4 0.0 2101 5 0.0 2101 6 0.0 2101 7 0.0 2101 8 0.0 2101 9 0.0 2101 10-11 0.0 2101 12-13 0.0 2101 14-15 0.0 2101 16-17 0.0 2101 18-19 0.0 2101 20-21 0.0 2101 22-23 0.0 2101 24-25 0.0 2101 26-27 0.0 2101 28-29 0.0 2101 30-31 0.0 2101 32-33 0.0 2101 34-35 0.0 2101 36-37 0.0 2101 38-39 0.0 2101 40-41 0.0 2101 42-43 0.0 2101 44-45 0.0 2101 46-47 0.0 2101 48-49 0.0 2101 50-51 0.0 2101 52-53 0.0 2101 54-55 0.0 2101 56-57 0.0 2101 58-59 0.0 2101 60-61 0.0 2101 62-63 0.0 2101 64-65 0.0 2101 66-67 0.0 2101 68-69 0.0 2101 70-71 0.0 2101 72-73 0.0 2101 74-75 0.0 2101 76-77 0.0 2101 78-79 0.0 2101 80-81 0.0 2101 82-83 0.0 2101 84-85 0.0 2101 86-87 0.0 2101 88-89 0.0 2101 90-91 0.0 2101 92-93 0.0 2101 94-95 0.0 2101 96-97 0.0 2101 98-99 0.0 2101 100-101 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 1.0 23 1.0 24 4.0 25 9.0 26 11.0 27 8.0 28 20.0 29 35.0 30 68.0 31 89.0 32 136.0 33 200.0 34 303.0 35 708.0 36 2077.0 37 330.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 22.792094070552913 14.535901926444833 10.532899674756067 52.13910432824619 2 22.925 22.075 35.3 19.7 3 24.956239059764943 24.431107776944234 22.230557639409852 28.382095523880967 4 25.3 29.849999999999998 18.175 26.674999999999997 5 26.450000000000003 30.525000000000002 20.825 22.2 6 20.674999999999997 33.800000000000004 21.3 24.224999999999998 7 20.75 15.7 38.574999999999996 24.975 8 22.1 20.875 25.25 31.775 9 22.125 20.4 30.0 27.474999999999998 10-11 25.9875 27.237499999999997 19.537499999999998 27.237499999999997 12-13 22.925 21.0375 26.625 29.4125 14-15 23.849999999999998 24.25 25.0 26.900000000000002 16-17 25.687500000000004 24.462500000000002 23.075000000000003 26.775 18-19 24.525 23.974999999999998 24.462500000000002 27.037499999999998 20-21 24.525 24.8625 24.462500000000002 26.150000000000002 22-23 24.9 25.162499999999998 23.9125 26.025 24-25 25.05 24.8125 23.5375 26.6 26-27 24.925 24.0 24.2 26.875 28-29 24.224999999999998 25.624999999999996 23.474999999999998 26.674999999999997 30-31 24.0125 24.5375 24.45 27.0 32-33 25.412499999999998 24.525 24.575 25.4875 34-35 25.45 24.45 24.075 26.025 36-37 25.04376094023506 24.593648412103025 23.768442110527634 26.59414853713428 38-39 25.1 24.9125 24.5125 25.474999999999998 40-41 25.63140785196299 24.36859214803701 23.78094523630908 26.219054763690924 42-43 24.50612653163291 24.281070267566893 24.74368592148037 26.469117279319832 44-45 25.312656328164078 25.07503751875938 23.59929964982491 26.013006503251624 46-47 25.65032516258129 24.6248124062031 23.336668334167083 26.388194097048522 48-49 25.406351587896975 24.5311327831958 23.380845211302827 26.6816704176044 50-51 24.943735933983497 25.818954738684667 23.34333583395849 25.893973493373345 52-53 25.10627656914228 23.905976494123532 23.53088272068017 27.45686421605401 54-55 24.568642160540136 24.731182795698924 23.85596399099775 26.84421105276319 56-57 24.893723430857715 24.668667166791696 23.593398349587396 26.84421105276319 58-59 24.93123280820205 24.3935983995999 24.131032758189548 26.544136034008503 60-61 25.18129532383096 24.518629657414355 23.355838959739934 26.944236059014752 62-63 25.156289072268066 24.143535883970994 24.381095273818453 26.319079769942487 64-65 25.28132033008252 24.056014003500874 24.23105776444111 26.431607901975497 66-67 25.406351587896975 24.131032758189548 23.40585146286572 27.056764191047762 68-69 25.868967241810452 24.831207801950487 23.20580145036259 26.094023505876468 70-71 25.618904726181547 23.380845211302827 24.168542135533883 26.831707926981746 72-73 24.55613903475869 24.20605151287822 24.343585896474117 26.894223555888974 74-75 25.681420355088775 23.543385846461614 24.056014003500874 26.71917979494874 76-77 26.19404851212803 23.905976494123532 23.968492123030757 25.93148287071768 78-79 25.481370342585645 24.268567141785446 24.456114028507127 25.79394848712178 80-81 25.93148287071768 23.88097024256064 23.893473368342086 26.294073518379594 82-83 26.481620405101275 24.918729682420604 23.10577644411103 25.49387346836709 84-85 26.25656414103526 23.830957739434858 23.655913978494624 26.25656414103526 86-87 25.51887971992998 24.843710927731934 23.843460865216304 25.79394848712178 88-89 25.743935983995996 24.193548387096776 23.280820205051263 26.78169542385596 90-91 25.49387346836709 23.968492123030757 23.1807951987997 27.35683920980245 92-93 25.303314571607256 24.377736085053158 23.75234521575985 26.566604127579733 94-95 25.472288252220693 24.15863880895784 23.795821343675716 26.573251595145752 96-97 25.441563322059373 23.387197795315046 23.9634222723287 27.20781661029688 98-99 25.739307018657193 23.480137073232644 24.520878284046198 26.259677624063965 100-101 26.936289818863212 11.196127420362274 28.935040599625232 32.93254216114928 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 0.0 22 0.0 23 0.5 24 1.0 25 0.5 26 1.0 27 3.5 28 6.5 29 6.5 30 3.5 31 6.5 32 12.5 33 17.5 34 24.5 35 36.0 36 47.0 37 52.0 38 66.5 39 93.5 40 111.5 41 125.0 42 141.5 43 159.5 44 166.5 45 165.0 46 183.0 47 181.5 48 158.0 49 148.5 50 134.0 51 124.5 52 118.0 53 109.0 54 105.5 55 94.0 56 86.5 57 77.0 58 69.5 59 86.0 60 89.5 61 80.5 62 81.5 63 80.0 64 79.0 65 78.5 66 71.0 67 56.0 68 58.0 69 68.0 70 66.0 71 52.5 72 37.5 73 37.5 74 36.5 75 30.5 76 26.0 77 19.0 78 11.5 79 6.5 80 5.0 81 4.5 82 3.0 83 1.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.075 2 0.0 3 0.025 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.025 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.025006251562890724 46-47 0.025006251562890724 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 38-39 1.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 1.0 92-93 1.0 94-95 1.0 96-97 25.0 98-99 290.0 100-101 3681.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.1 #Duplication Level Percentage of deduplicated Percentage of total 1 95.11041009463722 90.45 2 4.6267087276550996 8.799999999999999 3 0.26288117770767616 0.75 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 123401 spots for SRR21853547.sra Written 123401 spots for SRR21853547.sra Read 123401 spots for SRR21853547.sra Written 123401 spots for SRR21853547.sra Read 123401 spots for SRR21853547.sra Written 123401 spots for SRR21853547.sra Read 123401 spots for SRR21853547.sra Written 123401 spots for SRR21853547.sra Read 123401 spots for SRR21853547.sra Written 123401 spots for SRR21853547.sra Read 123401 spots for SRR21853547.sra Written 123401 spots for SRR21853547.sra Read 123401 spots for SRR21853547.sra Written 123401 spots for SRR21853547.sra Read 123401 spots for SRR21853547.sra Written 123401 spots for SRR21853547.sra Read 123401 spots for SRR21853547.sra Written 123401 spots for SRR21853547.sra Read 123401 spots for SRR21853547.sra Written 123401 spots for SRR21853547.sra Read 123401 spots for SRR21853547.sra Written 123401 spots for SRR21853547.sra Read 123401 spots for SRR21853547.sra Written 123401 spots for SRR21853547.sra Read 123401 spots for SRR21853547.sra Written 123401 spots for SRR21853547.sra Read 123401 spots for SRR21853547.sra Written 123401 spots for SRR21853547.sra Read 123401 spots for SRR21853547.sra Written 123401 spots for SRR21853547.sra Read 123401 spots for SRR21853547.sra Written 123401 spots for SRR21853547.sra Read 123401 spots for SRR21853547.sra Written 123401 spots for SRR21853547.sra Read 123413 spots for SRR21853547.sra Written 123413 spots for SRR21853547.sra Read 123401 spots for SRR21853547.sra Written 123401 spots for SRR21853547.sra Read 123401 spots for SRR21853547.sra Written 123401 spots for SRR21853547.sra SRR ids: ['SRR21853547.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ewpmt1z1 SRR21853547.sra spots: 2468032 blocks: [[1, 123401], [123402, 246802], [246803, 370203], [370204, 493604], [493605, 617005], [617006, 740406], [740407, 863807], [863808, 987208], [987209, 1110609], [1110610, 1234010], [1234011, 1357411], [1357412, 1480812], [1480813, 1604213], [1604214, 1727614], [1727615, 1851015], [1851016, 1974416], [1974417, 2097817], [2097818, 2221218], [2221219, 2344619], [2344620, 2468032]] SRR21853547 file size 662883 SRR21853547 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR21853547 SRR21853547_1.fastq Input file: SRR21853547_1.fastq trimmed: SRR21853547-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Fri Dec 6 17:36:00 2024 >> started Fri Dec 6 17:36:02 2024 >> done (1.742s) 2468032 reads processed; of these: 2 ( 0.00%) short reads filtered out after trimming by size control 2636 ( 0.11%) empty reads filtered out after trimming by size control 2465394 (99.89%) reads available; of these: 176 ( 0.01%) trimmed reads available after processing 2465218 (99.99%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 19 1 0.00% 20 0 0.00% 21 0 0.00% 22 0 0.00% 23 0 0.00% 24 1 0.00% 25 0 0.00% 26 0 0.00% 27 0 0.00% 28 0 0.00% 29 0 0.00% 30 0 0.00% 31 0 0.00% 32 2 0.00% 33 0 0.00% 34 1 0.00% 35 11 0.00% 36 3 0.00% 37 5 0.00% 38 6 0.00% 39 6 0.00% 40 9 0.00% 41 5 0.00% 42 6 0.00% 43 10 0.00% 44 6 0.00% 45 2 0.00% 46 7 0.00% 47 7 0.00% 48 6 0.00% 49 7 0.00% 50 4 0.00% 51 6 0.00% 52 14 0.00% 53 8 0.00% 54 8 0.00% 55 7 0.00% 56 8 0.00% 57 11 0.00% 58 7 0.00% 59 8 0.00% 60 13 0.00% 61 13 0.00% 62 17 0.00% 63 15 0.00% 64 21 0.00% 65 11 0.00% 66 13 0.00% 67 15 0.00% 68 15 0.00% 69 7 0.00% 70 12 0.00% 71 13 0.00% 72 19 0.00% 73 9 0.00% 74 11 0.00% 75 14 0.00% 76 14 0.00% 77 17 0.00% 78 15 0.00% 79 19 0.00% 80 11 0.00% 81 10 0.00% 82 15 0.00% 83 27 0.00% 84 16 0.00% 85 18 0.00% 86 28 0.00% 87 19 0.00% 88 26 0.00% 89 35 0.00% 90 51 0.00% 91 72 0.00% 92 42 0.00% 93 58 0.00% 94 158 0.01% 95 578 0.02% 96 3278 0.13% 97 11308 0.46% 98 43601 1.77% 99 162237 6.58% 100 548951 22.27% 101 1694390 68.73% 2465394 reads passed initial QC criterion=sequence-density sequence-density=0.29 sequence-density-rank=1 fanout-score=2.35 fanout-score-rank=25 prefix-density=0.35 prefix-fanout=2.0 sequence=GCTCCTTTCCAGGG criterion=fanout-score sequence-density=0.08 sequence-density-rank=25 fanout-score=274.14 fanout-score-rank=1 prefix-density=0.93 prefix-fanout=23.7 sequence=CGCCGCCGCCGA Started job on | Dec 06 17:36:23 Started mapping on | Dec 06 17:36:23 Finished on | Dec 06 17:36:28 Mapping speed, Million of reads per hour | 1775.08 Number of input reads | 2465394 Average input read length | 100 UNIQUE READS: Uniquely mapped reads number | 2347539 Uniquely mapped reads % | 95.22% Average mapped length | 100.35 Number of splices: Total | 805430 Number of splices: Annotated (sjdb) | 763395 Number of splices: GT/AG | 794797 Number of splices: GC/AG | 9567 Number of splices: AT/AC | 424 Number of splices: Non-canonical | 642 Mismatch rate per base, % | 0.17% Deletion rate per base | 0.00% Deletion average length | 1.69 Insertion rate per base | 0.00% Insertion average length | 1.28 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 57094 % of reads mapped to multiple loci | 2.32% Number of reads mapped to too many loci | 41791 % of reads mapped to too many loci | 1.70% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.62% % of reads unmapped: other | 0.15% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 60761 60761 60761 N_multimapping 57094 57094 57094 N_noFeature 92215 1214816 1193617 N_ambiguous 36175 2715 2366 UnstrandedReadsAssigned:2219149 PositiveStrandReadsAssigned:1130008 NegativeStrandReadsAssigned:1151556 Dataset is classified unstranded MeadianReadLen=101 20thPercentileLength=100 echo kmer=95 SRR21853547 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR21853547-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 2,465,394 reads, 2,283,793 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,072 rounds 52973 SRR21853547.ke.tsv 35125 SRR21853547.se.tsv 88098 total ==> SRR21853547.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 0 0 PNS24247 1044 945 6.03894 4.88187 PNS24249 1928 1829 29.8832 12.4816 PNS24246 1044 945 6.03894 4.88187 PNS24248 1044 945 6.03894 4.88187 PNS24244 1471 1372 0 0 PNS24243 293 194 6 23.6269 KQK14069 1603 1504 404.352 205.385 KQK14071 474 375 20.9976 42.7755 ==> SRR21853547.se.tsv <== BRADI_1g14170v3 440 BRADI_1g53295v3 15 BRADI_1g59795v3 21 BRADI_1g07683v3 0 BRADI_1g00485v3 18 BRADI_1g20270v3 257 BRADI_1g74790v3 18 BRADI_1g09890v3 0 BRADI_1g77505v3 38 BRADI_1g48960v3 0 SRR21853547 completed mapping pipeline successfully