Starting /dee2/code/volunteer_pipeline.sh SRR21853548 current disk space = 1550670114816 free memory = 1602927352 SRR21853548 SRAfilesize ed33b44712906891e2a3957671529c14 SRR21853548.sra SRR21853548.sra file validated SRR21853548 is single end SRR21853548 is conventional basespace SRR21853548 read1 length is 41-101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR21853548_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 41-101 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.272 32.0 32.0 32.0 32.0 32.0 2 31.378 32.0 32.0 32.0 32.0 32.0 3 31.51175 32.0 32.0 32.0 32.0 32.0 4 31.5585 32.0 32.0 32.0 32.0 32.0 5 31.48525 32.0 32.0 32.0 32.0 32.0 6 34.86875 36.0 36.0 36.0 36.0 36.0 7 35.16675 36.0 36.0 36.0 36.0 36.0 8 35.101 36.0 36.0 36.0 36.0 36.0 9 35.077 36.0 36.0 36.0 36.0 36.0 10-11 35.173874999999995 36.0 36.0 36.0 36.0 36.0 12-13 35.092375000000004 36.0 36.0 36.0 36.0 36.0 14-15 35.096875 36.0 36.0 36.0 36.0 36.0 16-17 35.085750000000004 36.0 36.0 36.0 36.0 36.0 18-19 35.101875 36.0 36.0 36.0 36.0 36.0 20-21 35.068749999999994 36.0 36.0 36.0 36.0 36.0 22-23 34.97 36.0 36.0 36.0 34.0 36.0 24-25 34.927875 36.0 36.0 36.0 36.0 36.0 26-27 34.88875 36.0 36.0 36.0 34.0 36.0 28-29 34.8995 36.0 36.0 36.0 34.0 36.0 30-31 34.915625 36.0 36.0 36.0 32.0 36.0 32-33 34.78325 36.0 36.0 36.0 32.0 36.0 34-35 34.909625000000005 36.0 36.0 36.0 36.0 36.0 36-37 34.756125 36.0 36.0 36.0 32.0 36.0 38-39 34.670625 36.0 36.0 36.0 34.0 36.0 40-41 34.63125 36.0 36.0 36.0 32.0 36.0 42-43 34.79357339334834 36.0 36.0 36.0 34.0 36.0 44-45 34.69067266816704 36.0 36.0 36.0 32.0 36.0 46-47 34.6721680420105 36.0 36.0 36.0 32.0 36.0 48-49 34.61227806951738 36.0 36.0 36.0 32.0 36.0 50-51 34.74893723430858 36.0 36.0 36.0 32.0 36.0 52-53 34.56814203550888 36.0 36.0 36.0 32.0 36.0 54-55 34.487996999249816 36.0 36.0 36.0 32.0 36.0 56-57 34.432233058264565 36.0 36.0 36.0 32.0 36.0 58-59 34.273318329582395 36.0 36.0 36.0 32.0 36.0 60-61 34.404726181545385 36.0 36.0 36.0 32.0 36.0 62-63 34.27869467366842 36.0 36.0 36.0 32.0 36.0 64-65 34.2430607651913 36.0 36.0 36.0 32.0 36.0 66-67 34.184796199049764 36.0 36.0 36.0 32.0 36.0 68-69 34.38109527381846 36.0 36.0 36.0 32.0 36.0 70-71 34.17104276069017 36.0 36.0 36.0 32.0 36.0 72-73 34.126031507876974 36.0 36.0 36.0 32.0 36.0 74-75 33.99274818704676 36.0 36.0 36.0 32.0 36.0 76-77 34.14178544636159 36.0 36.0 36.0 32.0 36.0 78-79 33.95647823911956 36.0 36.0 36.0 32.0 36.0 80-81 33.947848924462235 36.0 36.0 36.0 32.0 36.0 82-83 34.050025012506254 36.0 36.0 36.0 32.0 36.0 84-85 33.96910955477739 36.0 36.0 36.0 32.0 36.0 86-87 33.83016508254127 36.0 36.0 36.0 27.0 36.0 88-89 33.900700350175086 36.0 36.0 36.0 32.0 36.0 90-91 33.747498749374685 36.0 36.0 36.0 27.0 36.0 92-93 33.750437828371275 36.0 36.0 36.0 27.0 36.0 94-95 33.75750750750751 36.0 36.0 36.0 27.0 36.0 96-97 33.70087389939178 36.0 36.0 36.0 27.0 36.0 98-99 33.5540918372622 36.0 36.0 36.0 27.0 36.0 100-101 32.73439288766407 36.0 34.0 36.0 20.5 36.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 11101 1 0.0 11101 2 0.0 11101 3 0.0 11101 4 0.0 11101 5 0.0 11101 6 0.0 11101 7 0.0 11101 8 0.0 11101 9 0.0 11101 10-11 0.0 11101 12-13 0.0 11101 14-15 0.0 11101 16-17 0.0 11101 18-19 0.0 11101 20-21 0.0 11101 22-23 0.0 11101 24-25 0.0 11101 26-27 0.0 11101 28-29 0.0 11101 30-31 0.0 11101 32-33 0.0 11101 34-35 0.0 11101 36-37 0.0 11101 38-39 0.0 11101 40-41 0.0 11101 42-43 0.0 11101 44-45 0.0 11101 46-47 0.0 11101 48-49 0.0 11101 50-51 0.0 11101 52-53 0.0 11101 54-55 0.0 11101 56-57 0.0 11101 58-59 0.0 11101 60-61 0.0 11101 62-63 0.0 11101 64-65 0.0 11101 66-67 0.0 11101 68-69 0.0 11101 70-71 0.0 11101 72-73 0.0 11101 74-75 0.0 11101 76-77 0.0 11101 78-79 0.0 11101 80-81 0.0 11101 82-83 0.0 11101 84-85 0.0 11101 86-87 0.0 11101 88-89 0.0 11101 90-91 0.0 11101 92-93 0.0 11101 94-95 0.0 11101 96-97 0.0 11101 98-99 0.0 11101 100-101 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 2.0 21 3.0 22 4.0 23 10.0 24 10.0 25 11.0 26 14.0 27 42.0 28 54.0 29 76.0 30 113.0 31 136.0 32 210.0 33 342.0 34 712.0 35 2261.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 22.3 14.6 12.049999999999999 51.05 2 22.675 21.975 35.6 19.75 3 21.525 25.7 24.775 28.000000000000004 4 25.074999999999996 30.7 18.6 25.624999999999996 5 25.874999999999996 31.2 21.7 21.224999999999998 6 21.24780756702581 31.89676772738662 22.500626409421198 24.354798296166376 7 20.4 15.875 39.15 24.575 8 21.05 20.724999999999998 26.575 31.65 9 19.875 21.349999999999998 28.799999999999997 29.975 10-11 24.95 28.012500000000003 20.0625 26.974999999999998 12-13 22.900000000000002 22.775000000000002 26.474999999999998 27.85 14-15 23.9375 24.224999999999998 25.35 26.487500000000004 16-17 25.0625 24.1875 24.25 26.5 18-19 24.1125 24.2375 24.887500000000003 26.7625 20-21 25.1 24.462500000000002 24.0125 26.424999999999997 22-23 24.175 26.275 23.775 25.775 24-25 24.4375 25.4375 23.974999999999998 26.150000000000002 26-27 24.125 24.85 23.7875 27.237499999999997 28-29 24.925 25.05 23.925 26.1 30-31 24.887500000000003 24.474999999999998 24.025 26.6125 32-33 25.1 24.625 25.112499999999997 25.162499999999998 34-35 25.662499999999998 25.0 24.0 25.337500000000002 36-37 24.2875 23.8625 24.7375 27.1125 38-39 25.775 24.212500000000002 24.212500000000002 25.8 40-41 24.85 25.8625 23.3125 25.974999999999998 42-43 25.30632658164541 24.343585896474117 23.85596399099775 26.494123530882717 44-45 24.44361090272568 24.268567141785446 24.60615153788447 26.6816704176044 46-47 25.10627656914228 24.756189047261813 23.868467116779193 26.269067266816705 48-49 23.868467116779193 25.318829707426854 24.281070267566893 26.531632908227053 50-51 24.256064016004 24.74368592148037 23.93098274568642 27.069267316829208 52-53 25.44386096524131 24.318579644911228 23.85596399099775 26.38159539884971 54-55 24.23105776444111 24.456114028507127 24.01850462615654 27.294323580895224 56-57 24.706176544136035 24.10602650662666 24.093523380845213 27.094273568392097 58-59 24.50612653163291 23.36834208552138 24.60615153788447 27.51937984496124 60-61 25.55638909727432 23.768442110527634 24.10602650662666 26.569142285571395 62-63 25.806451612903224 24.418604651162788 23.63090772693173 26.144036009002253 64-65 25.10627656914228 24.63115778944736 23.543385846461614 26.71917979494874 66-67 24.756189047261813 24.90622655663916 24.10602650662666 26.231557889472366 68-69 25.543885971492873 24.90622655663916 24.15603900975244 25.393848462115532 70-71 25.318829707426854 23.818454613653415 24.44361090272568 26.419104776194047 72-73 25.168792198049513 24.58114528632158 23.730932733183295 26.51912978244561 74-75 25.131282820705174 24.306076519129782 24.10602650662666 26.456614153538382 76-77 25.11877969492373 24.243560890222557 24.44361090272568 26.19404851212803 78-79 25.212606303151574 24.61230615307654 23.17408704352176 27.00100050025013 80-81 25.550275137568786 24.874937468734366 23.224112056028016 26.350675337668832 82-83 25.15007503751876 24.474737368684345 23.774387193596798 26.600800400200097 84-85 25.337668834417208 24.024512256128062 24.087043521760883 26.550775387693847 86-87 24.79989994997499 24.437218609304654 24.212106053026513 26.550775387693847 88-89 25.53776888444222 24.112056028014006 24.23711855927964 26.113056528264135 90-91 24.712356178089045 24.58729364682341 24.074537268634316 26.625812906453227 92-93 24.83112334250688 23.942957217913435 24.418313735301474 26.80760570427821 94-95 25.775775775775777 24.436936936936938 23.4984984984985 26.288788788788786 96-97 25.51033187226049 23.994990607388857 23.544145272385723 26.950532247964937 98-99 25.546517539400103 23.04270462633452 24.504321301474327 26.90645653279105 100-101 27.030436839615202 10.581927140829523 29.569468538085474 32.8181674814698 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.0 20 0.0 21 0.5 22 1.0 23 1.0 24 0.5 25 0.5 26 1.5 27 1.5 28 2.0 29 3.5 30 6.5 31 7.0 32 8.0 33 15.0 34 23.0 35 36.0 36 50.5 37 53.0 38 59.5 39 88.5 40 116.5 41 133.0 42 159.0 43 170.0 44 168.0 45 180.5 46 177.0 47 165.0 48 171.0 49 161.0 50 151.5 51 149.0 52 129.0 53 109.5 54 104.0 55 108.5 56 96.0 57 76.0 58 73.0 59 75.5 60 67.5 61 64.5 62 75.0 63 74.0 64 73.0 65 70.0 66 62.0 67 67.0 68 67.5 69 51.5 70 44.5 71 42.5 72 35.5 73 38.0 74 30.5 75 22.0 76 18.5 77 15.0 78 11.5 79 9.5 80 9.5 81 5.5 82 2.5 83 3.0 84 2.5 85 0.5 86 0.5 87 1.0 88 0.5 89 1.5 90 1.5 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.5 100 0.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.22499999999999998 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 40-41 1.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 1.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 1.0 92-93 1.0 94-95 1.0 96-97 27.0 98-99 338.0 100-101 3630.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.47500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.54762503141494 99.02499999999999 2 0.3769791404875597 0.75 3 0.07539582809751194 0.22499999999999998 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 478877 spots for SRR21853548.sra Written 478877 spots for SRR21853548.sra Read 478877 spots for SRR21853548.sra Written 478877 spots for SRR21853548.sra Read 478877 spots for SRR21853548.sra Written 478877 spots for SRR21853548.sra Read 478877 spots for SRR21853548.sra Written 478877 spots for SRR21853548.sra Read 478877 spots for SRR21853548.sra Written 478877 spots for SRR21853548.sra Read 478877 spots for SRR21853548.sra Written 478877 spots for SRR21853548.sra Read 478877 spots for SRR21853548.sra Written 478877 spots for SRR21853548.sra Read 478877 spots for SRR21853548.sra Written 478877 spots for SRR21853548.sra Read 478877 spots for SRR21853548.sra Written 478877 spots for SRR21853548.sra Read 478877 spots for SRR21853548.sra Written 478877 spots for SRR21853548.sra Read 478877 spots for SRR21853548.sra Written 478877 spots for SRR21853548.sra Read 478877 spots for SRR21853548.sra Written 478877 spots for SRR21853548.sra Read 478877 spots for SRR21853548.sra Written 478877 spots for SRR21853548.sra Read 478877 spots for SRR21853548.sra Written 478877 spots for SRR21853548.sra Read 478877 spots for SRR21853548.sra Written 478877 spots for SRR21853548.sra Read 478890 spots for SRR21853548.sra Written 478890 spots for SRR21853548.sra Read 478877 spots for SRR21853548.sra Written 478877 spots for SRR21853548.sra Read 478877 spots for SRR21853548.sra Written 478877 spots for SRR21853548.sra Read 478877 spots for SRR21853548.sra Written 478877 spots for SRR21853548.sra Read 478877 spots for SRR21853548.sra Written 478877 spots for SRR21853548.sra SRR ids: ['SRR21853548.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_l93f2mb7 SRR21853548.sra spots: 9577553 blocks: [[1, 478877], [478878, 957754], [957755, 1436631], [1436632, 1915508], [1915509, 2394385], [2394386, 2873262], [2873263, 3352139], [3352140, 3831016], [3831017, 4309893], [4309894, 4788770], [4788771, 5267647], [5267648, 5746524], [5746525, 6225401], [6225402, 6704278], [6704279, 7183155], [7183156, 7662032], [7662033, 8140909], [8140910, 8619786], [8619787, 9098663], [9098664, 9577553]] SRR21853548 file size 2610384 SRR21853548 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR21853548 SRR21853548_1.fastq Input file: SRR21853548_1.fastq trimmed: SRR21853548-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Fri Dec 6 17:37:54 2024 >> started Fri Dec 6 17:37:59 2024 >> done (5.042s) 9577553 reads processed; of these: 10 ( 0.00%) short reads filtered out after trimming by size control 22711 ( 0.24%) empty reads filtered out after trimming by size control 9554832 (99.76%) reads available; of these: 119 ( 0.00%) trimmed reads available after processing 9554713 (100.00%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 1 0.00% 20 1 0.00% 21 0 0.00% 22 1 0.00% 23 0 0.00% 24 2 0.00% 25 0 0.00% 26 3 0.00% 27 0 0.00% 28 3 0.00% 29 3 0.00% 30 0 0.00% 31 2 0.00% 32 0 0.00% 33 1 0.00% 34 0 0.00% 35 31 0.00% 36 32 0.00% 37 24 0.00% 38 26 0.00% 39 22 0.00% 40 33 0.00% 41 31 0.00% 42 13 0.00% 43 32 0.00% 44 28 0.00% 45 44 0.00% 46 23 0.00% 47 47 0.00% 48 44 0.00% 49 29 0.00% 50 39 0.00% 51 29 0.00% 52 41 0.00% 53 33 0.00% 54 26 0.00% 55 43 0.00% 56 35 0.00% 57 42 0.00% 58 41 0.00% 59 41 0.00% 60 53 0.00% 61 34 0.00% 62 51 0.00% 63 52 0.00% 64 48 0.00% 65 49 0.00% 66 60 0.00% 67 37 0.00% 68 47 0.00% 69 54 0.00% 70 61 0.00% 71 60 0.00% 72 74 0.00% 73 69 0.00% 74 71 0.00% 75 64 0.00% 76 84 0.00% 77 68 0.00% 78 81 0.00% 79 82 0.00% 80 84 0.00% 81 68 0.00% 82 82 0.00% 83 94 0.00% 84 85 0.00% 85 115 0.00% 86 110 0.00% 87 113 0.00% 88 103 0.00% 89 142 0.00% 90 198 0.00% 91 385 0.00% 92 162 0.00% 93 226 0.00% 94 579 0.01% 95 2173 0.02% 96 12010 0.13% 97 44363 0.46% 98 168217 1.76% 99 619978 6.49% 100 2139048 22.39% 101 6564451 68.70% 9554832 reads passed initial QC criterion=sequence-density sequence-density=0.37 sequence-density-rank=1 fanout-score=2.29 fanout-score-rank=20 prefix-density=0.39 prefix-fanout=2.2 sequence=CCATGGCACCCACCGTGATGGCTTCCTCCGCCACCTCCGTGGC criterion=fanout-score sequence-density=0.08 sequence-density-rank=24 fanout-score=231.38 fanout-score-rank=1 prefix-density=0.80 prefix-fanout=23.9 sequence=CCGCCGCCGCCA Started job on | Dec 06 17:38:14 Started mapping on | Dec 06 17:38:14 Finished on | Dec 06 17:38:26 Mapping speed, Million of reads per hour | 2866.45 Number of input reads | 9554832 Average input read length | 100 UNIQUE READS: Uniquely mapped reads number | 9074533 Uniquely mapped reads % | 94.97% Average mapped length | 100.30 Number of splices: Total | 3127092 Number of splices: Annotated (sjdb) | 2967583 Number of splices: GT/AG | 3085600 Number of splices: GC/AG | 37164 Number of splices: AT/AC | 1702 Number of splices: Non-canonical | 2626 Mismatch rate per base, % | 0.27% Deletion rate per base | 0.00% Deletion average length | 1.48 Insertion rate per base | 0.00% Insertion average length | 1.27 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 215702 % of reads mapped to multiple loci | 2.26% Number of reads mapped to too many loci | 154917 % of reads mapped to too many loci | 1.62% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.96% % of reads unmapped: other | 0.18% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 264597 264597 264597 N_multimapping 215702 215702 215702 N_noFeature 375600 4703130 4626794 N_ambiguous 138983 10873 8971 UnstrandedReadsAssigned:8559950 PositiveStrandReadsAssigned:4360530 NegativeStrandReadsAssigned:4438768 Dataset is classified unstranded MeadianReadLen=101 20thPercentileLength=100 echo kmer=95 SRR21853548 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR21853548-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 9,554,832 reads, 8,819,068 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,208 rounds 52973 SRR21853548.ke.tsv 35125 SRR21853548.se.tsv 88098 total ==> SRR21853548.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 0 0 PNS24247 1044 945 20.9039 4.36993 PNS24249 1928 1829 95.5424 10.3196 PNS24246 1044 945 20.9039 4.36993 PNS24248 1044 945 20.9039 4.36993 PNS24244 1471 1372 23.7458 3.4191 PNS24243 293 194 12 12.2196 KQK14069 1603 1504 1237.84 162.591 KQK14071 474 375 92.322 48.6354 ==> SRR21853548.se.tsv <== BRADI_1g14170v3 1475 BRADI_1g53295v3 53 BRADI_1g59795v3 130 BRADI_1g07683v3 0 BRADI_1g00485v3 40 BRADI_1g20270v3 1000 BRADI_1g74790v3 77 BRADI_1g09890v3 3 BRADI_1g77505v3 125 BRADI_1g48960v3 0 SRR21853548 completed mapping pipeline successfully