Starting /dee2/code/volunteer_pipeline.sh SRR21853549 current disk space = 1550666444800 free memory = 1377837220 SRR21853549 SRAfilesize 1b1e65dc078c77cafdffb11924ea0257 SRR21853549.sra SRR21853549.sra file validated SRR21853549 is single end SRR21853549 is conventional basespace SRR21853549 read1 length is 93-101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR21853549_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 93-101 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 34.922 37.0 37.0 37.0 25.0 37.0 2 35.05 37.0 37.0 37.0 25.0 37.0 3 35.821 37.0 37.0 37.0 37.0 37.0 4 35.749 37.0 37.0 37.0 37.0 37.0 5 35.777 37.0 37.0 37.0 37.0 37.0 6 35.7345 37.0 37.0 37.0 37.0 37.0 7 35.7505 37.0 37.0 37.0 37.0 37.0 8 35.7645 37.0 37.0 37.0 37.0 37.0 9 35.7925 37.0 37.0 37.0 37.0 37.0 10-11 35.92725 37.0 37.0 37.0 37.0 37.0 12-13 35.81125 37.0 37.0 37.0 37.0 37.0 14-15 35.8925 37.0 37.0 37.0 37.0 37.0 16-17 35.93875 37.0 37.0 37.0 37.0 37.0 18-19 35.806 37.0 37.0 37.0 37.0 37.0 20-21 35.90275 37.0 37.0 37.0 37.0 37.0 22-23 35.90275 37.0 37.0 37.0 37.0 37.0 24-25 35.657250000000005 37.0 37.0 37.0 37.0 37.0 26-27 35.72825 37.0 37.0 37.0 37.0 37.0 28-29 35.7505 37.0 37.0 37.0 37.0 37.0 30-31 35.65275 37.0 37.0 37.0 37.0 37.0 32-33 35.65375 37.0 37.0 37.0 37.0 37.0 34-35 35.607749999999996 37.0 37.0 37.0 37.0 37.0 36-37 35.66575 37.0 37.0 37.0 37.0 37.0 38-39 35.6245 37.0 37.0 37.0 37.0 37.0 40-41 35.668 37.0 37.0 37.0 37.0 37.0 42-43 35.5005 37.0 37.0 37.0 37.0 37.0 44-45 35.5605 37.0 37.0 37.0 37.0 37.0 46-47 35.62625 37.0 37.0 37.0 37.0 37.0 48-49 35.557249999999996 37.0 37.0 37.0 37.0 37.0 50-51 35.56275 37.0 37.0 37.0 37.0 37.0 52-53 35.457499999999996 37.0 37.0 37.0 37.0 37.0 54-55 35.401250000000005 37.0 37.0 37.0 37.0 37.0 56-57 35.55175 37.0 37.0 37.0 37.0 37.0 58-59 35.567499999999995 37.0 37.0 37.0 37.0 37.0 60-61 35.36475 37.0 37.0 37.0 31.0 37.0 62-63 35.4345 37.0 37.0 37.0 37.0 37.0 64-65 35.35625 37.0 37.0 37.0 37.0 37.0 66-67 35.3535 37.0 37.0 37.0 37.0 37.0 68-69 35.31575 37.0 37.0 37.0 31.0 37.0 70-71 35.35175 37.0 37.0 37.0 37.0 37.0 72-73 35.395250000000004 37.0 37.0 37.0 37.0 37.0 74-75 35.433 37.0 37.0 37.0 37.0 37.0 76-77 35.232 37.0 37.0 37.0 31.0 37.0 78-79 35.26975 37.0 37.0 37.0 31.0 37.0 80-81 35.3765 37.0 37.0 37.0 37.0 37.0 82-83 35.389250000000004 37.0 37.0 37.0 37.0 37.0 84-85 35.212999999999994 37.0 37.0 37.0 25.0 37.0 86-87 35.2735 37.0 37.0 37.0 37.0 37.0 88-89 35.293499999999995 37.0 37.0 37.0 31.0 37.0 90-91 35.28675 37.0 37.0 37.0 31.0 37.0 92-93 35.320750000000004 37.0 37.0 37.0 37.0 37.0 94-95 35.27456864216054 37.0 37.0 37.0 31.0 37.0 96-97 35.25860333376285 37.0 37.0 37.0 37.0 37.0 98-99 35.14724856283199 37.0 37.0 37.0 25.0 37.0 100-101 35.28826647196419 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100-101 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 19 1.0 20 1.0 21 0.0 22 3.0 23 1.0 24 5.0 25 8.0 26 13.0 27 21.0 28 34.0 29 48.0 30 75.0 31 111.0 32 136.0 33 179.0 34 300.0 35 493.0 36 2119.0 37 452.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 22.025 14.625 11.1 52.25 2 22.996957403651116 20.63894523326572 37.27180527383367 19.092292089249494 3 23.549999999999997 25.575 23.875 27.0 4 26.125 31.4 19.025 23.45 5 28.4 30.375000000000004 20.225 21.0 6 19.85 33.475 22.35 24.325 7 19.05 15.875 40.35 24.725 8 20.875 21.55 24.75 32.824999999999996 9 21.3 20.65 30.225 27.825 10-11 25.424999999999997 27.150000000000002 20.7 26.724999999999998 12-13 23.5875 23.150000000000002 26.325 26.937499999999996 14-15 23.0 24.637500000000003 25.424999999999997 26.937499999999996 16-17 24.3875 24.1875 24.3625 27.0625 18-19 24.224999999999998 25.8125 23.7125 26.25 20-21 24.6875 24.3625 24.925 26.025 22-23 24.525 25.3125 24.2 25.9625 24-25 24.575 24.224999999999998 25.525 25.674999999999997 26-27 25.2875 24.925 24.4125 25.374999999999996 28-29 23.6875 24.575 25.6125 26.125 30-31 24.575 25.6125 24.375 25.4375 32-33 24.175 25.474999999999998 24.4375 25.912499999999998 34-35 25.074999999999996 24.3625 24.9 25.662499999999998 36-37 24.2375 25.124999999999996 24.462500000000002 26.174999999999997 38-39 24.8 24.775 24.625 25.8 40-41 24.775 24.2625 24.875 26.087500000000002 42-43 25.0375 24.55 24.5375 25.874999999999996 44-45 25.412499999999998 25.45 23.7625 25.374999999999996 46-47 25.0125 25.724999999999998 23.575 25.687500000000004 48-49 25.2 24.3875 24.3625 26.05 50-51 24.7875 24.962500000000002 25.124999999999996 25.124999999999996 52-53 24.762500000000003 25.5 23.6125 26.125 54-55 24.2375 24.925 24.762500000000003 26.075 56-57 25.05 25.412499999999998 24.349999999999998 25.1875 58-59 25.4375 23.9375 24.962500000000002 25.662499999999998 60-61 24.95 24.425 24.837500000000002 25.7875 62-63 24.975 25.3 23.8375 25.887500000000003 64-65 24.95 24.05 24.8625 26.137500000000003 66-67 24.212500000000002 24.45 24.8625 26.474999999999998 68-69 25.15 25.0375 25.162499999999998 24.65 70-71 25.7 24.25 23.375 26.674999999999997 72-73 24.887500000000003 24.962500000000002 24.85 25.3 74-75 25.162499999999998 24.4875 24.7875 25.5625 76-77 25.137500000000003 25.124999999999996 23.9125 25.825 78-79 24.125 25.637500000000003 23.9125 26.325 80-81 25.587500000000002 25.825 23.425 25.162499999999998 82-83 25.0 24.0375 25.0375 25.924999999999997 84-85 24.6125 24.725 25.275 25.387500000000003 86-87 24.875 24.9125 24.3875 25.825 88-89 25.900000000000002 24.4125 24.349999999999998 25.337500000000002 90-91 25.137500000000003 24.425 24.8625 25.575 92-93 25.924999999999997 24.825 23.925 25.324999999999996 94-95 25.381345336334082 24.793698424606152 23.643410852713178 26.18154538634659 96-97 24.759043685066967 24.996870697208664 24.62135436224809 25.62273125547628 98-99 25.620465826651394 24.23316787577956 24.57681048746341 25.569555810105637 100-101 25.992664646786796 11.274118960293414 30.601180035082127 32.13203635783767 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 1.0 23 1.5 24 1.0 25 1.5 26 1.5 27 1.5 28 2.5 29 4.0 30 7.5 31 10.0 32 9.5 33 17.0 34 27.5 35 33.0 36 44.5 37 64.5 38 74.0 39 97.0 40 115.5 41 127.5 42 146.0 43 170.0 44 196.5 45 205.5 46 204.5 47 190.5 48 172.5 49 150.0 50 138.5 51 136.0 52 129.5 53 115.0 54 109.0 55 97.5 56 82.0 57 86.5 58 80.5 59 72.0 60 64.0 61 69.5 62 75.0 63 66.5 64 59.5 65 50.0 66 53.0 67 56.5 68 60.5 69 51.0 70 47.0 71 49.0 72 34.0 73 27.0 74 28.5 75 26.5 76 21.0 77 17.0 78 9.0 79 5.5 80 4.0 81 1.5 82 2.0 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 1.4000000000000001 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 93 1.0 94 0.0 95 2.0 96 5.0 97 22.0 98 83.0 99 286.0 100 931.0 101 2670.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.075 #Duplication Level Percentage of deduplicated Percentage of total 1 93.94100451767207 88.375 2 5.846399149614669 11.0 3 0.1860217911241031 0.525 4 0.026574541589157584 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1057217 spots for SRR21853549.sra Written 1057217 spots for SRR21853549.sra Read 1057217 spots for SRR21853549.sra Written 1057217 spots for SRR21853549.sra Read 1057217 spots for SRR21853549.sra Written 1057217 spots for SRR21853549.sra Read 1057217 spots for SRR21853549.sra Written 1057217 spots for SRR21853549.sra Read 1057217 spots for SRR21853549.sra Written 1057217 spots for SRR21853549.sra Read 1057217 spots for SRR21853549.sra Written 1057217 spots for SRR21853549.sra Read 1057217 spots for SRR21853549.sra Written 1057217 spots for SRR21853549.sra Read 1057217 spots for SRR21853549.sra Written 1057217 spots for SRR21853549.sra Read 1057217 spots for SRR21853549.sra Written 1057217 spots for SRR21853549.sra Read 1057217 spots for SRR21853549.sra Written 1057217 spots for SRR21853549.sra Read 1057228 spots for SRR21853549.sra Written 1057228 spots for SRR21853549.sra Read 1057217 spots for SRR21853549.sra Written 1057217 spots for SRR21853549.sra Read 1057217 spots for SRR21853549.sra Written 1057217 spots for SRR21853549.sra Read 1057217 spots for SRR21853549.sra Written 1057217 spots for SRR21853549.sra Read 1057217 spots for SRR21853549.sra Written 1057217 spots for SRR21853549.sra Read 1057217 spots for SRR21853549.sra Written 1057217 spots for SRR21853549.sra Read 1057217 spots for SRR21853549.sra Written 1057217 spots for SRR21853549.sra Read 1057217 spots for SRR21853549.sra Written 1057217 spots for SRR21853549.sra Read 1057217 spots for SRR21853549.sra Written 1057217 spots for SRR21853549.sra Read 1057217 spots for SRR21853549.sra Written 1057217 spots for SRR21853549.sra SRR ids: ['SRR21853549.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_r669iimp SRR21853549.sra spots: 21144351 blocks: [[1, 1057217], [1057218, 2114434], [2114435, 3171651], [3171652, 4228868], [4228869, 5286085], [5286086, 6343302], [6343303, 7400519], [7400520, 8457736], [8457737, 9514953], [9514954, 10572170], [10572171, 11629387], [11629388, 12686604], [12686605, 13743821], [13743822, 14801038], [14801039, 15858255], [15858256, 16915472], [16915473, 17972689], [17972690, 19029906], [19029907, 20087123], [20087124, 21144351]] SRR21853549 file size 5696974 SRR21853549 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR21853549 SRR21853549_1.fastq Input file: SRR21853549_1.fastq trimmed: SRR21853549-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Fri Dec 6 17:38:42 2024 >> started Fri Dec 6 17:38:55 2024 >> done (12.277s) 21144351 reads processed; of these: 19 ( 0.00%) short reads filtered out after trimming by size control 20566 ( 0.10%) empty reads filtered out after trimming by size control 21123766 (99.90%) reads available; of these: 553 ( 0.00%) trimmed reads available after processing 21123213 (100.00%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 0 0.00% 20 2 0.00% 21 2 0.00% 22 3 0.00% 23 2 0.00% 24 3 0.00% 25 3 0.00% 26 5 0.00% 27 4 0.00% 28 5 0.00% 29 8 0.00% 30 7 0.00% 31 8 0.00% 32 13 0.00% 33 12 0.00% 34 10 0.00% 35 122 0.00% 36 120 0.00% 37 141 0.00% 38 123 0.00% 39 123 0.00% 40 116 0.00% 41 108 0.00% 42 135 0.00% 43 143 0.00% 44 114 0.00% 45 116 0.00% 46 143 0.00% 47 174 0.00% 48 136 0.00% 49 140 0.00% 50 163 0.00% 51 144 0.00% 52 155 0.00% 53 172 0.00% 54 175 0.00% 55 169 0.00% 56 151 0.00% 57 149 0.00% 58 170 0.00% 59 207 0.00% 60 206 0.00% 61 188 0.00% 62 224 0.00% 63 208 0.00% 64 216 0.00% 65 217 0.00% 66 211 0.00% 67 219 0.00% 68 253 0.00% 69 212 0.00% 70 247 0.00% 71 260 0.00% 72 251 0.00% 73 249 0.00% 74 246 0.00% 75 261 0.00% 76 290 0.00% 77 251 0.00% 78 284 0.00% 79 306 0.00% 80 308 0.00% 81 373 0.00% 82 304 0.00% 83 351 0.00% 84 376 0.00% 85 378 0.00% 86 405 0.00% 87 398 0.00% 88 450 0.00% 89 497 0.00% 90 612 0.00% 91 1081 0.01% 92 591 0.00% 93 755 0.00% 94 1427 0.01% 95 5015 0.02% 96 27693 0.13% 97 101993 0.48% 98 384510 1.82% 99 1407386 6.66% 100 4858946 23.00% 101 14321420 67.80% 21123766 reads passed initial QC criterion=sequence-density sequence-density=0.23 sequence-density-rank=1 fanout-score=2.34 fanout-score-rank=15 prefix-density=0.28 prefix-fanout=1.9 sequence=GCTCCTTTCCAGGG criterion=fanout-score sequence-density=0.09 sequence-density-rank=13 fanout-score=178.70 fanout-score-rank=1 prefix-density=0.74 prefix-fanout=22.2 sequence=CGCCGCCGCCGC Started job on | Dec 06 17:39:16 Started mapping on | Dec 06 17:39:16 Finished on | Dec 06 17:39:40 Mapping speed, Million of reads per hour | 3168.56 Number of input reads | 21123766 Average input read length | 100 UNIQUE READS: Uniquely mapped reads number | 19521470 Uniquely mapped reads % | 92.41% Average mapped length | 100.29 Number of splices: Total | 7028340 Number of splices: Annotated (sjdb) | 6667061 Number of splices: GT/AG | 6933568 Number of splices: GC/AG | 83176 Number of splices: AT/AC | 3999 Number of splices: Non-canonical | 7597 Mismatch rate per base, % | 0.32% Deletion rate per base | 0.00% Deletion average length | 1.87 Insertion rate per base | 0.00% Insertion average length | 1.64 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 744937 % of reads mapped to multiple loci | 3.53% Number of reads mapped to too many loci | 573269 % of reads mapped to too many loci | 2.71% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.87% % of reads unmapped: other | 0.47% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 857359 857359 857359 N_multimapping 744937 744937 744937 N_noFeature 870368 10158087 9979356 N_ambiguous 293398 21347 20017 UnstrandedReadsAssigned:18357704 PositiveStrandReadsAssigned:9342036 NegativeStrandReadsAssigned:9522097 Dataset is classified unstranded MeadianReadLen=101 20thPercentileLength=100 echo kmer=95 SRR21853549 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR21853549-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 21,123,766 reads, 18,971,882 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,142 rounds 52973 SRR21853549.ke.tsv 35125 SRR21853549.se.tsv 88098 total ==> SRR21853549.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 45.9731 5.17464 PNS24247 1044 945 49.196 4.90456 PNS24249 1928 1829 149.847 7.71857 PNS24246 1044 945 49.196 4.90456 PNS24248 1044 945 49.196 4.90456 PNS24244 1471 1372 17.5918 1.20798 PNS24243 293 194 27 13.1119 KQK14069 1603 1504 2059.15 128.986 KQK14071 474 375 116.738 29.328 ==> SRR21853549.se.tsv <== BRADI_1g14170v3 2413 BRADI_1g53295v3 126 BRADI_1g59795v3 244 BRADI_1g07683v3 0 BRADI_1g00485v3 106 BRADI_1g20270v3 2391 BRADI_1g74790v3 164 BRADI_1g09890v3 14 BRADI_1g77505v3 213 BRADI_1g48960v3 0 SRR21853549 completed mapping pipeline successfully